ID: 948953205

View in Genome Browser
Species Human (GRCh38)
Location 2:241268528-241268550
Sequence CCTGCCAGCTTTTGCTGGTA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 148}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948953199_948953205 1 Left 948953199 2:241268504-241268526 CCGTCCTGAGGCCGCCTCTGTCA 0: 1
1: 0
2: 1
3: 15
4: 247
Right 948953205 2:241268528-241268550 CCTGCCAGCTTTTGCTGGTATGG 0: 1
1: 0
2: 1
3: 16
4: 148
948953201_948953205 -10 Left 948953201 2:241268515-241268537 CCGCCTCTGTCAGCCTGCCAGCT 0: 1
1: 0
2: 3
3: 54
4: 572
Right 948953205 2:241268528-241268550 CCTGCCAGCTTTTGCTGGTATGG 0: 1
1: 0
2: 1
3: 16
4: 148
948953200_948953205 -3 Left 948953200 2:241268508-241268530 CCTGAGGCCGCCTCTGTCAGCCT 0: 1
1: 0
2: 1
3: 31
4: 230
Right 948953205 2:241268528-241268550 CCTGCCAGCTTTTGCTGGTATGG 0: 1
1: 0
2: 1
3: 16
4: 148
948953195_948953205 29 Left 948953195 2:241268476-241268498 CCAGCAAAACGGTCAGTAGCCAG 0: 1
1: 0
2: 0
3: 2
4: 51
Right 948953205 2:241268528-241268550 CCTGCCAGCTTTTGCTGGTATGG 0: 1
1: 0
2: 1
3: 16
4: 148
948953198_948953205 10 Left 948953198 2:241268495-241268517 CCAGAAGGTCCGTCCTGAGGCCG 0: 1
1: 0
2: 0
3: 26
4: 379
Right 948953205 2:241268528-241268550 CCTGCCAGCTTTTGCTGGTATGG 0: 1
1: 0
2: 1
3: 16
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948953205 Original CRISPR CCTGCCAGCTTTTGCTGGTA TGG Exonic
900321469 1:2086449-2086471 CCTCCCAGGTTTGGCTGGCAGGG + Intronic
904040562 1:27582048-27582070 CTGGCCAGCTTCTGCTGGTCTGG - Intronic
909048349 1:70737518-70737540 CCTTTCACCTTTTGCTGGTGTGG + Intergenic
909126291 1:71674564-71674586 TCTGCAGGCTTTTGCTGGGAGGG + Intronic
909376730 1:74950180-74950202 CCTCCCAGCTTGTGATGGGAGGG - Intergenic
912159158 1:106959950-106959972 CCTGACAGCTTTTTTTGGTATGG - Intergenic
919555662 1:199049581-199049603 TCTGCCAGATTTTGGTGTTAGGG - Intergenic
919694067 1:200555108-200555130 ACTGTCAGCTTTTGCTTGGATGG - Intronic
922571792 1:226638716-226638738 CTCGCCAGCTCTTGCTGGCAGGG + Intronic
924368904 1:243325998-243326020 CCTGCCTGCTTGTGTTGGAAGGG + Intronic
1064531342 10:16313530-16313552 CCTGCCTGTTTTTGCAGGAAAGG - Intergenic
1068931923 10:62599441-62599463 TCTCACAGCTTTTGCTGGTATGG + Intronic
1069612360 10:69782983-69783005 TCTTCCAAATTTTGCTGGTATGG - Intergenic
1071128159 10:82359893-82359915 CCAGGCAGCTTCTGCTGGCATGG - Intronic
1072092573 10:92143088-92143110 ACTGCCAGCTTTCGCAGGTTTGG - Exonic
1073438947 10:103540995-103541017 TCTGCCAGAGTTGGCTGGTAGGG + Intronic
1074820182 10:117172635-117172657 CGTACTAGCTTTTGCTGGTTTGG + Intergenic
1076413323 10:130267052-130267074 CATGCCAGCTTTTGGTGCTCTGG + Intergenic
1079444211 11:20545222-20545244 ACTGCCAGCTTCTTTTGGTATGG + Intergenic
1085856043 11:80177367-80177389 TCTGCCAGGTTTTGCTGTTAGGG + Intergenic
1086362875 11:86077526-86077548 CCTGCCATCTTTGGCAGGGAAGG - Intergenic
1087115556 11:94520757-94520779 CCTGCCACCTTTTGCAGGCCTGG + Intergenic
1088393769 11:109344884-109344906 CCTTCCAGCTTTAACTGGAAGGG - Intergenic
1089343622 11:117776427-117776449 CTTGCCACCTTTCGCAGGTAAGG + Intronic
1095340134 12:41080447-41080469 CCTACCAGCTTTTGATGGAACGG - Intergenic
1095380373 12:41583914-41583936 CATGCCAGCTGTTGATGGGATGG - Intergenic
1097835304 12:64266805-64266827 CCTTCTTGCTTTTGCTGCTAAGG + Exonic
1097929094 12:65164849-65164871 CCTCCCTGCTTTGGCTGCTAAGG - Intergenic
1101730682 12:107424717-107424739 CCACCCAGCTGTTGCTGGAAGGG + Intronic
1101736746 12:107469000-107469022 CCTGCCTACTTTTGCGGGTGTGG - Intronic
1102360578 12:112284332-112284354 CCTGCCTGTCTTTGCTGGTGGGG - Intronic
1102433247 12:112899956-112899978 CATGCCAGCTTTTGCTTTTGAGG - Intergenic
1103638326 12:122327714-122327736 CCTGCCAGTCTTTCCTGGAATGG - Intronic
1103721333 12:122977076-122977098 CCTTCCAGCTCCTGCTGGTTTGG - Intronic
1106278767 13:28243117-28243139 CCTGCCATCTTGTGCTGGCTAGG + Intronic
1108171623 13:47747958-47747980 CCTGCCAGCTTCTCCTTGTCAGG + Intergenic
1109905155 13:68830797-68830819 CCTCCCAGCTTGTGATGGGAGGG - Intergenic
1110909500 13:80938592-80938614 TCTGTCAGCTTTTGCTTGTCTGG + Intergenic
1112857290 13:103787010-103787032 CCTCCCAGCTTGTGATGGGAGGG + Intergenic
1112952765 13:105021782-105021804 CCACTTAGCTTTTGCTGGTATGG - Intergenic
1113961607 13:114129412-114129434 CCTTCCAGCTCTTGCAGGTGAGG - Intronic
1114207314 14:20584560-20584582 CCTGACAGTTATTCCTGGTAGGG + Intronic
1117394892 14:55299200-55299222 CTTGGCAGGTTTTGATGGTAGGG - Intronic
1117806775 14:59501020-59501042 CCAGCAAGCTTTTTCTGGAAAGG - Intronic
1118337764 14:64868575-64868597 TCTGCCAGCTTTTACTTGTTGGG - Intronic
1119037327 14:71241375-71241397 CCTGGCTGCCTTTGCTGGAAGGG + Intergenic
1121176677 14:91895826-91895848 ACTGCCAGCTTCTGTTGGCAGGG - Intronic
1121265280 14:92598281-92598303 CCTTCCAGCTATTCCTGCTAAGG + Intronic
1122788997 14:104176544-104176566 CCAGGCAGCTTCTGCTGGCAGGG + Exonic
1124049853 15:26186797-26186819 CCAGTCAGCCTTTGCTGGCAGGG + Intergenic
1127978628 15:64017556-64017578 CCTCCCTGCTTTCGCTGGTCTGG + Intronic
1134872873 16:17667590-17667612 CCTTCCTACTTTTGCTGGCAAGG + Intergenic
1137957927 16:52852252-52852274 CATGCCAGTTTTAGCTGGTGAGG + Intergenic
1138025446 16:53518867-53518889 CCTGCCTGCCTTTCCTGCTAGGG - Intergenic
1138855775 16:60689527-60689549 CCTGGCAGCCTTTGCTGCTGAGG - Intergenic
1139935731 16:70569787-70569809 CCTGGCAGATTTTGTGGGTATGG + Intronic
1142943981 17:3409398-3409420 GCTTCCAGCTTTTGCTCGTTCGG + Intergenic
1149127938 17:53257912-53257934 TCTGCCAGGTTTTGGTGTTAGGG - Intergenic
1150268859 17:63849589-63849611 CAGGCCAGCTCTTGCTGGCAAGG - Intergenic
1150517667 17:65830932-65830954 CCTGCCAATTTTTTCTGGTCTGG - Intronic
1156285050 18:35684776-35684798 AAAGCCAGCTTTCGCTGGTAGGG + Intronic
1157546128 18:48547687-48547709 CCTGCTTGCTTCTGCTGGAAGGG + Intronic
1159087884 18:63814800-63814822 TCTGCCAGCTTTTGCTGTCAGGG + Intergenic
1159947076 18:74451765-74451787 CCTGCCAGCTTCCACAGGTAAGG + Intronic
1164833498 19:31340856-31340878 GCTGCCAGCTTTAGCTGGCTGGG - Intronic
1166368209 19:42287750-42287772 CCTCCCAGCTTCTTCTGGTGGGG + Intronic
925698021 2:6602893-6602915 CCACTCAGCTTTTGCTGGTATGG + Intergenic
927143034 2:20142591-20142613 CCTGCCTGTTTTGGCTGGGAGGG - Intergenic
927491404 2:23523501-23523523 CCTGCCAGCCTTAGCTGAAAGGG - Intronic
928250671 2:29675485-29675507 CCCATCAGGTTTTGCTGGTAGGG - Intronic
931740805 2:65241468-65241490 CCTAGCAGCATTTGCTTGTATGG + Intronic
931838710 2:66127085-66127107 CTTCCCAGCTGTTGCTGGAACGG + Intergenic
933626010 2:84600114-84600136 TCTGCCAGCTTGTTCTGTTAGGG + Intronic
934662365 2:96150008-96150030 CCTTCCAGCTTTGGGAGGTACGG + Intergenic
934951776 2:98580552-98580574 CCTGCCAGCCTCTCCTGGCAGGG + Intronic
938194688 2:129316676-129316698 CCTGCCATATTGTGCTGGCAAGG - Intergenic
939948012 2:148433827-148433849 TCTGCCAGCTTTTGTTGTCAGGG + Intronic
939993263 2:148896340-148896362 CATGCCAGCTTTTCCTGGGGAGG + Intronic
941041916 2:160632899-160632921 CTTGTGAGGTTTTGCTGGTATGG + Intergenic
941351931 2:164448273-164448295 CCTGCCAGCTAACGCTGGTTGGG - Intergenic
942206491 2:173624797-173624819 CCTGCCAGAGTTTGCTGGGATGG + Intergenic
943432727 2:187824868-187824890 ACTGCCAGGTTTTGCTTATAAGG - Intergenic
944941820 2:204636649-204636671 CCTGCCATCTTGTGCTCTTATGG + Intronic
947818944 2:233057519-233057541 ACTGCCAGCTGCTGCTGGCAGGG - Intergenic
948953205 2:241268528-241268550 CCTGCCAGCTTTTGCTGGTATGG + Exonic
1169183249 20:3589873-3589895 CCTCCCAGCCTTGGGTGGTAGGG + Intronic
1171360458 20:24583184-24583206 CTTCCCAGCTTCTGCTAGTAAGG + Intronic
1171417295 20:24991948-24991970 CCTGGCAGTTTTTCCTGATAGGG - Intronic
1172432676 20:34905638-34905660 CCTGTCAGCTTTTGCTTGCTAGG - Intronic
1172444486 20:34985960-34985982 CCTGCCAGCTTGTGTGGGGAGGG - Intronic
1173379932 20:42531032-42531054 ACTGCCACCTGTTGGTGGTATGG + Intronic
1182329318 22:29539360-29539382 CGTGCCAGTGTTTGCTGGTGAGG + Exonic
1182870645 22:33644075-33644097 TCTGCCAGGTTTTGGTGTTAGGG - Intronic
1184723524 22:46329765-46329787 CCTGCCAGCTCTTGTTGGACAGG + Intronic
1184785942 22:46672099-46672121 CCTGACAGCTTTTGCTGCCCAGG + Intronic
1185041093 22:48504827-48504849 CCTGGCAGCTGCTGCTGGCAAGG - Intronic
949584387 3:5423638-5423660 CCTGCCTGCATTTGCTGGAAGGG - Intergenic
949783997 3:7720498-7720520 CCTGCCAGGCTTTGCTGCCAGGG + Intronic
953298163 3:41742410-41742432 ACTGCCTGCTTCTGCTGGTTGGG - Intronic
953731035 3:45448311-45448333 CCAGTCAGCTCTGGCTGGTAGGG + Intronic
955596915 3:60601031-60601053 CCTTCCAGCCTCTGCTGGCAGGG - Intronic
956332797 3:68130102-68130124 CCTGCCCGGTTTTCCTGGCAGGG - Intronic
960366821 3:116782942-116782964 CCTGACAGCTATACCTGGTAAGG - Intronic
962811730 3:138964160-138964182 TTTGCCATCTTTTGTTGGTAAGG - Intergenic
969241521 4:5901758-5901780 CCTGCCAGCCTGTGCTGCTTCGG - Intronic
969316116 4:6382209-6382231 CCTACTAGCTTTTGCTGCTTGGG - Intronic
972609814 4:40646118-40646140 GCACCCATCTTTTGCTGGTATGG + Intergenic
974393566 4:61306037-61306059 CCTACCAGTTTTAGCTGGTTTGG + Intronic
975805162 4:78104679-78104701 CATGCCAGGTGTTGGTGGTATGG + Intronic
977088912 4:92644486-92644508 TTTGCCAGCTTTTGATGTTATGG + Intronic
979047267 4:115883984-115884006 CATACCAGCTTTTGCTGGCATGG - Intergenic
980408944 4:132389923-132389945 CCTTCCAGCTTGTGATGGGAGGG - Intergenic
981422075 4:144562577-144562599 CCTGCCAGCTTTTGGCTGTCAGG + Intergenic
981827565 4:148961185-148961207 ACTGCCAGCTTTTGCTAAAAAGG + Intergenic
986964178 5:13250761-13250783 CCTGCTAGATTTTGCTATTAGGG + Intergenic
988607048 5:32687626-32687648 CCTGCTAGAATTTGCTGGCATGG + Intergenic
990079049 5:51889803-51889825 CCTGTCAGGTTTTGCAGGTGGGG + Intergenic
990320781 5:54628026-54628048 CCTGCCATCTTTTCCTGGTTGGG - Intergenic
995839615 5:116430893-116430915 CCAGTCTGCTTTTGCTGGTTTGG + Intergenic
997040172 5:130243748-130243770 CCTGGCAGCTTTCTCTGGTTTGG - Intergenic
998933582 5:147208997-147209019 CCTGCCTGTTTTTGCTTCTAAGG - Intergenic
999183169 5:149684658-149684680 CCTGCCAGCATTTGTTGTCAGGG + Intergenic
1001746666 5:174098000-174098022 CCAGCCACCTTCTGCTGGGAAGG - Intronic
1006900098 6:37494366-37494388 CCTGCCCTCTTTTTCTGGTAAGG + Intronic
1007038004 6:38695690-38695712 CCACTCAGCTTTTGCTGGCATGG + Intronic
1007591015 6:43021008-43021030 CCAGCCAGGTTCTGCTGGGAAGG + Exonic
1008782418 6:55123603-55123625 TCTGCCAGGTTTTGCTATTAGGG + Intronic
1011311922 6:85989049-85989071 CCTAGCAGCTTTTGCTGGTGAGG - Intergenic
1011792673 6:90915398-90915420 CCTCCCAGCTTTTGATGGGAGGG - Intergenic
1012315172 6:97775920-97775942 CCTCCCAGTTTTTGCTGGAGAGG - Intergenic
1012556324 6:100517058-100517080 CATGCCATCTGCTGCTGGTATGG + Intronic
1013908740 6:115248524-115248546 CCTCCCAGCTTTTGTTTGTCTGG - Intergenic
1013932327 6:115548672-115548694 TCTGCCAGGTTTTGGTAGTAGGG - Intergenic
1014572046 6:123021809-123021831 CCTCTCAGCCTTTGCTGGTATGG + Intronic
1015322567 6:131892768-131892790 CCACTCAGCATTTGCTGGTATGG + Exonic
1018366547 6:163126296-163126318 CCTTTCACCTTTTGCTGGAATGG + Intronic
1019721251 7:2572942-2572964 CCTTCCTGCTTTTACTGGTTGGG + Intronic
1024632732 7:51262836-51262858 CCTACCAGGGGTTGCTGGTAGGG - Intronic
1031979741 7:128116843-128116865 CCTGACAGCTGTGGCTGGTGTGG + Intergenic
1033611796 7:142970397-142970419 CCTGTCAGCCTTTGCTGGCATGG - Intergenic
1033969013 7:147014704-147014726 CCTGCCAGTGTTTGGTGGAAAGG + Intronic
1035236714 7:157501848-157501870 CGTTCCAGCTCTTGCTGGAAGGG + Intergenic
1035838785 8:2788121-2788143 CATGCCAGCATTTGCGGGGATGG + Intergenic
1036793882 8:11741876-11741898 GCTGCCAGCTTTTGCCGCTGGGG + Intronic
1041813153 8:61934987-61935009 CCTCCCGGCTTTTTCTGGCAGGG + Intergenic
1043524704 8:81083530-81083552 CCTATCAGCTTTTGCTGGTAGGG + Intronic
1045352879 8:101358671-101358693 CCTCCCATCATTTGCAGGTAGGG + Intergenic
1045586352 8:103541422-103541444 TCTGTCAGCTTTTGTTTGTATGG - Intronic
1046603001 8:116339839-116339861 CCACTCGGCTTTTGCTGGTATGG - Intergenic
1052635128 9:31093490-31093512 CCTTTCTGCTTTTGCTGGCATGG - Intergenic
1052796350 9:32927056-32927078 CCTGCCAGCTTTTTCAGGGAAGG - Intergenic
1055154044 9:73038872-73038894 CCTGCCTGCTGCTGCTGCTATGG + Intronic
1057465218 9:95307775-95307797 CCTGCCAGTTGCTGCTGGAAGGG + Intronic
1059500662 9:114750772-114750794 CCTGCCAGTTTTTGAAGCTATGG - Intergenic
1060089907 9:120733438-120733460 CCAGGCAGCATTTGCTGGAAGGG - Intergenic
1186435429 X:9538955-9538977 CCCAGCAGCTTTTGCTGGCAAGG - Intronic
1186926261 X:14336087-14336109 CCTCCCAGCTTGTGATGGGAGGG + Intergenic
1188599963 X:31950561-31950583 CCTGCCAGCTATTGAGAGTAGGG + Intronic
1189996875 X:46647304-46647326 CCTACCAGCTGTTGCTGATCTGG - Intronic
1190035548 X:47019994-47020016 CTTGCGAGCTTTTGCTGATTTGG + Intronic
1192133281 X:68573249-68573271 CCTGCCTGCTCTTGCAGGTCAGG + Intergenic
1196767603 X:119262382-119262404 CCTTCCACCTTTTGGAGGTAGGG + Intergenic
1197049434 X:122041726-122041748 CCTTCCAGTTTTTGCTGGAGAGG + Intergenic
1197099864 X:122639781-122639803 ACTGCTAGCTTTTGCTGTCATGG - Intergenic
1197482530 X:127004872-127004894 CCTGGCAGCACTTGCTTGTAGGG + Intergenic
1198109138 X:133487362-133487384 TCTGCCACCTTTTACTGGTCTGG + Intergenic