ID: 948953206

View in Genome Browser
Species Human (GRCh38)
Location 2:241268529-241268551
Sequence CTGCCAGCTTTTGCTGGTAT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 164}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948953198_948953206 11 Left 948953198 2:241268495-241268517 CCAGAAGGTCCGTCCTGAGGCCG 0: 1
1: 0
2: 0
3: 26
4: 379
Right 948953206 2:241268529-241268551 CTGCCAGCTTTTGCTGGTATGGG 0: 1
1: 0
2: 2
3: 15
4: 164
948953199_948953206 2 Left 948953199 2:241268504-241268526 CCGTCCTGAGGCCGCCTCTGTCA 0: 1
1: 0
2: 1
3: 15
4: 247
Right 948953206 2:241268529-241268551 CTGCCAGCTTTTGCTGGTATGGG 0: 1
1: 0
2: 2
3: 15
4: 164
948953200_948953206 -2 Left 948953200 2:241268508-241268530 CCTGAGGCCGCCTCTGTCAGCCT 0: 1
1: 0
2: 1
3: 31
4: 230
Right 948953206 2:241268529-241268551 CTGCCAGCTTTTGCTGGTATGGG 0: 1
1: 0
2: 2
3: 15
4: 164
948953195_948953206 30 Left 948953195 2:241268476-241268498 CCAGCAAAACGGTCAGTAGCCAG 0: 1
1: 0
2: 0
3: 2
4: 51
Right 948953206 2:241268529-241268551 CTGCCAGCTTTTGCTGGTATGGG 0: 1
1: 0
2: 2
3: 15
4: 164
948953201_948953206 -9 Left 948953201 2:241268515-241268537 CCGCCTCTGTCAGCCTGCCAGCT 0: 1
1: 0
2: 3
3: 54
4: 572
Right 948953206 2:241268529-241268551 CTGCCAGCTTTTGCTGGTATGGG 0: 1
1: 0
2: 2
3: 15
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948953206 Original CRISPR CTGCCAGCTTTTGCTGGTAT GGG Exonic
906197680 1:43939064-43939086 CTGCCAGCTTTTGAGGGAACAGG + Intergenic
906253601 1:44330629-44330651 CTGCCAGCCTTTGCTGGGGGTGG + Intronic
909048350 1:70737519-70737541 CTTTCACCTTTTGCTGGTGTGGG + Intergenic
909355445 1:74703571-74703593 CTGACAGGTTTTGCTGTTCTTGG + Intergenic
914967566 1:152274395-152274417 TTCTCAGCTTTTGCTTGTATGGG + Intergenic
919036563 1:192318447-192318469 CTGGCAGATTTTGCTGTTCTGGG - Intronic
919694066 1:200555107-200555129 CTGTCAGCTTTTGCTTGGATGGG - Intronic
920279353 1:204831053-204831075 CTGCCAGCTTTTCCTGGTACAGG + Intronic
922621674 1:226993446-226993468 GAGCCAGGTTTTGCTGGTTTGGG - Exonic
1066527099 10:36293358-36293380 CCCCCAGCTTTTGCTTGTCTTGG + Intergenic
1068034498 10:51742850-51742872 CAGCCAACTTTTCCTGGTCTAGG - Intronic
1069612359 10:69782982-69783004 CTTCCAAATTTTGCTGGTATGGG - Intergenic
1074983919 10:118641157-118641179 CAGCTAGCTTTGTCTGGTATGGG + Intergenic
1076282440 10:129259759-129259781 CTGCCAGCTTGTGCCTGTAATGG - Intergenic
1076413324 10:130267053-130267075 ATGCCAGCTTTTGGTGCTCTGGG + Intergenic
1076573996 10:131451907-131451929 CTGCCAGCTTCTGCAGCTGTGGG + Intergenic
1077520409 11:3029980-3030002 GTGCCATGTTTTGCTGGGATTGG - Intronic
1077909629 11:6563023-6563045 CTTCCAGCTGCTGCTTGTATAGG - Exonic
1079444212 11:20545223-20545245 CTGCCAGCTTCTTTTGGTATGGG + Intergenic
1084520792 11:69661457-69661479 CTCCCAGCTTCTGGTGGTTTCGG + Intronic
1084664980 11:70571529-70571551 CAGCCAGCTATTGCTGGGGTGGG - Intronic
1084956405 11:72693847-72693869 CTGCCAGCCTTTGGTGGTATCGG - Intronic
1085836936 11:79966852-79966874 CTGACAGTTTGTGCTGGTAGAGG - Intergenic
1093931837 12:24961618-24961640 CTGTCAGCTTTTGGTGATGTTGG - Intergenic
1095340133 12:41080446-41080468 CTACCAGCTTTTGATGGAACGGG - Intergenic
1096451112 12:51742394-51742416 CTCTCAGCTTTTGCTTGTCTGGG + Intronic
1096829416 12:54302529-54302551 CTGCCTGCTTCTGCTGGAATTGG + Intronic
1096889881 12:54758894-54758916 CTGTCAGCTTTTGTTTGTTTGGG + Intergenic
1098011836 12:66061577-66061599 CTGCCATCTTATGCTGGATTGGG - Intergenic
1101440671 12:104702211-104702233 CACCCAGCATGTGCTGGTATAGG - Intronic
1101463440 12:104921552-104921574 CTCCCAGCTTTTGTTTGTCTGGG - Intronic
1101736745 12:107468999-107469021 CTGCCTACTTTTGCGGGTGTGGG - Intronic
1103966515 12:124643371-124643393 CCGCCAGCTCTTGATGGTGTTGG - Intergenic
1105321015 13:19322488-19322510 CTCTCAGCATTTGCTGGTCTTGG - Intergenic
1106407554 13:29487193-29487215 CTGCCAGCCTCACCTGGTATTGG + Intronic
1109458123 13:62620277-62620299 CTGTCTGCTTTTGCTAGTCTAGG - Intergenic
1110162651 13:72397745-72397767 CTCCCAACCTTTGCTGGTTTTGG + Intergenic
1110909501 13:80938593-80938615 CTGTCAGCTTTTGCTTGTCTGGG + Intergenic
1112952764 13:105021781-105021803 CACTTAGCTTTTGCTGGTATGGG - Intergenic
1115801206 14:36996008-36996030 CTGCCAGTTTTAGCTGGCTTTGG - Intronic
1116947694 14:50851307-50851329 CTGCCAGGTATAGCTGGGATAGG - Intergenic
1120626535 14:86833449-86833471 CTCTCAGCTTTTGCTTGTCTGGG - Intergenic
1122199218 14:100112128-100112150 CTGCCAGCTTCAGCTCATATAGG + Intronic
1124245196 15:28063997-28064019 CCCTCAGCTTTTGTTGGTATGGG + Intronic
1124562412 15:30787386-30787408 CTTCCAATTTTTGCTGCTATTGG - Intergenic
1127364480 15:58274919-58274941 CTGACGGCTTTTGTTGATATAGG + Intronic
1127636826 15:60878970-60878992 CTGTCAGCTTGTGCAGGTTTTGG + Intronic
1128984350 15:72208268-72208290 CTACCAGTGTTTGCTGGAATGGG - Intronic
1129608331 15:77035548-77035570 TTGGCAGCTTCTGCTGGTAAAGG + Exonic
1138164798 16:54791422-54791444 TTGCCAGATTATCCTGGTATAGG + Intergenic
1138234412 16:55369632-55369654 TTGCCTCCTTTTGCTGGTAGAGG - Intergenic
1139431645 16:66913928-66913950 CTGCCATCTCTTGCTGCCATGGG - Intronic
1139935732 16:70569788-70569810 CTGGCAGATTTTGTGGGTATGGG + Intronic
1141374249 16:83515017-83515039 CAGCCAGCTTTTGGAGGTTTAGG + Intronic
1147664633 17:42138725-42138747 CTGGCCCCTTTTGCAGGTATTGG - Intronic
1148672674 17:49422839-49422861 CTCCCAGTTTTTGCTTGTCTGGG + Intronic
1150517666 17:65830931-65830953 CTGCCAATTTTTTCTGGTCTGGG - Intronic
1153147444 18:2049964-2049986 CTGCCAGCTTTTACTCCTTTTGG + Intergenic
1154258086 18:12802797-12802819 CTTGCAGCTTTTGCTTGTCTGGG - Intronic
1157182706 18:45511624-45511646 CTGCAAGCTTTTCCTGGTTATGG - Intronic
1157853231 18:51078258-51078280 CTGTCAGCTGCTGCTGGAATTGG + Exonic
1160299548 18:77667715-77667737 CTGACAGCTGTTGCAGGGATGGG - Intergenic
925744135 2:7030384-7030406 CTGCTGGTTTTTGCTGGTATAGG + Intronic
927294781 2:21441470-21441492 CAGCCAACTTTTGATGTTATTGG + Intergenic
931709124 2:64972598-64972620 GTTCCAGCTCTTTCTGGTATAGG - Intergenic
932579997 2:72986931-72986953 CTGCAAGCTTCTGCTAGTCTAGG - Intronic
933490381 2:82978561-82978583 CTGGCATCTGTTTCTGGTATGGG - Intergenic
933877397 2:86632825-86632847 CTGCCTGCTGTTACTGGTGTTGG - Intronic
934656497 2:96119156-96119178 CTGCTGGCTGTTGCTGGTCTGGG - Intergenic
937485658 2:122312313-122312335 TTGCCAGCATTTGGTGGTTTTGG + Intergenic
939948013 2:148433828-148433850 CTGCCAGCTTTTGTTGTCAGGGG + Intronic
940619249 2:156090044-156090066 TTGCCAGCATTTGGTGGTGTTGG + Intergenic
942000078 2:171637422-171637444 CTGCTACCATTTGCTGGAATTGG - Intergenic
943640522 2:190352867-190352889 CTGACAGCTATTGCTGCTAGTGG - Intronic
944321703 2:198352372-198352394 ATTTCAGCTTTTGCTGTTATTGG + Intronic
947818943 2:233057518-233057540 CTGCCAGCTGCTGCTGGCAGGGG - Intergenic
948953206 2:241268529-241268551 CTGCCAGCTTTTGCTGGTATGGG + Exonic
1169424078 20:5482999-5483021 CTGGCAGCTTCTGCTGTCATTGG + Intergenic
1169426217 20:5499270-5499292 CTGGCAGCTTCTGCTGTCATTGG - Intergenic
1170090560 20:12585472-12585494 CTGCTAGCTTTTGAATGTATTGG - Intergenic
1170371825 20:15657364-15657386 CTACCTGTTGTTGCTGGTATGGG + Intronic
1172788756 20:37487794-37487816 CTGCCAGGATTTGCTGGGATTGG - Intergenic
1173374367 20:42470364-42470386 CAGCCAGTTTTTGCTGGACTTGG + Intronic
1173772758 20:45677558-45677580 CTCTCAGCTTTTGCTTGTTTGGG + Intergenic
1173904675 20:46617690-46617712 CAGCCAGCTTATGCTGGCTTGGG - Intronic
1175094816 20:56533042-56533064 CCTCGAGCTTTTGCTGGTAGAGG - Intergenic
1175567574 20:59992699-59992721 CTGCCCTCTTTCGATGGTATTGG - Intronic
1175865099 20:62171383-62171405 TTGCCAGCTGTTGCTGGAACCGG + Intronic
1175873337 20:62218568-62218590 CTGCAAGCTGTGGCTGGTAGTGG - Exonic
1180222889 21:46370464-46370486 CTGCCAGCTGATGATGGCATAGG + Intronic
1182349097 22:29688645-29688667 CAGGCAGCTTTTGCTGCTTTGGG + Intronic
1183608610 22:38882474-38882496 CTGCCTCCTTTTCCTGGTGTGGG - Intergenic
949423766 3:3893938-3893960 CTGCCACCTATTGCTGTTAGTGG - Intronic
951068590 3:18297366-18297388 CTCTCAGCTTTTGCTTGTCTGGG - Intronic
952250653 3:31650060-31650082 CTCTCAGCTTTTGCTTGTCTAGG - Intergenic
953023510 3:39131026-39131048 GTGCCTGCTTTTGCTGGCAAAGG + Exonic
954763030 3:52890853-52890875 CTGCCTGCTTCTGCTGCTCTGGG + Intronic
955820354 3:62889952-62889974 CTGACAGATATTGCTGGTCTAGG + Intergenic
956436953 3:69243481-69243503 ATGCCAGGTTGTGCTGGTGTTGG + Intronic
957070296 3:75562664-75562686 CTGCAAGCTTTTGCAAATATAGG + Intergenic
959361863 3:105403428-105403450 CTACCAGCTTAGGCTGGTACTGG - Intronic
962811729 3:138964159-138964181 TTGCCATCTTTTGTTGGTAAGGG - Intergenic
964013751 3:151921633-151921655 CTGCCAGCTTATGGTGCTAATGG + Intergenic
964035197 3:152187364-152187386 CTGCCATCCTTTTCTGGTAATGG + Intergenic
966882251 3:184357182-184357204 CTGCCAGCCTTTGCTGTCATTGG - Exonic
966903665 3:184506339-184506361 GTTTCAGCTTTTGCTGCTATTGG + Intronic
969337555 4:6520563-6520585 CTGCCAGTTTTTATTGGTTTTGG - Intronic
969686006 4:8674676-8674698 CTGCCAGCTTCTTCTGGGAAAGG + Intergenic
972113342 4:35594507-35594529 CTGTCAGATTTAGATGGTATGGG - Intergenic
973060767 4:45720877-45720899 CAGCCAGCTTTTGTTTGTCTGGG - Intergenic
976578964 4:86712015-86712037 CAGCCAGGTTTTGTTGGTACTGG + Intronic
976836927 4:89385247-89385269 CTGACAGCCGGTGCTGGTATTGG - Intergenic
977031048 4:91883411-91883433 CATCCAGCATTTGCTGGCATGGG + Intergenic
977718795 4:100214572-100214594 CAGCCAGCTTTTCCTGTTCTAGG + Intergenic
979047266 4:115883983-115884005 ATACCAGCTTTTGCTGGCATGGG - Intergenic
979815459 4:125096893-125096915 CTGTCAGATTTTGCTGATTTGGG - Intergenic
979964171 4:127057312-127057334 CTCCCAGCTTTTATTTGTATGGG - Intergenic
980533715 4:134087944-134087966 CTGGCAGCTTTTCCTGCTTTGGG + Intergenic
981117627 4:141010604-141010626 CTGCCAGCTTGTAATGGCATGGG + Intronic
983524030 4:168742026-168742048 CTGCCAGCTTTTGCCCGCACTGG - Intronic
984070954 4:175111404-175111426 CTCTCAGTTTTTGCTTGTATGGG - Intergenic
990036022 5:51320803-51320825 CTGCCAGATTTTGCTGGACATGG - Intergenic
991517055 5:67449010-67449032 CTCTCAGCTTTTGCTTGTCTGGG + Intergenic
991586258 5:68205038-68205060 CTGCCAGGTTTTCCTAGTATTGG + Intergenic
993846569 5:92951866-92951888 CTCTCAGCTTTTGCTTGTCTGGG + Intergenic
994265126 5:97706066-97706088 CTCTCAGCTTTTGCTTGTTTGGG - Intergenic
995499876 5:112793185-112793207 CTCTCATCTTTTGCTGGGATTGG - Intronic
998007994 5:138670121-138670143 AGGCCAGCTTTGGCTGGCATGGG + Intronic
1000968035 5:167682759-167682781 CTCCCAACTTTAGATGGTATAGG + Intronic
1003223033 6:4178533-4178555 CAGCCGGCTTCTTCTGGTATAGG + Intergenic
1007038005 6:38695691-38695713 CACTCAGCTTTTGCTGGCATGGG + Intronic
1008601474 6:53100318-53100340 CTGTCAGCTTTTCATAGTATTGG - Exonic
1009027601 6:58018552-58018574 CTGTCAGCTCTTGCTGGCACAGG + Intergenic
1009203137 6:60770029-60770051 CTGTCAGCTCTTGCTGGCACAGG + Intergenic
1009933067 6:70199624-70199646 CTGGCAGCTTGAGCTGGGATAGG - Exonic
1010273850 6:73946850-73946872 CTCTCAGCTTTTGCTTGTCTTGG + Intergenic
1011435885 6:87336219-87336241 CTGCCATCTAATGCTGGGATGGG - Intronic
1011792672 6:90915397-90915419 CTCCCAGCTTTTGATGGGAGGGG - Intergenic
1012320976 6:97845109-97845131 TTGCCAGCATTTGGTGGTGTTGG + Intergenic
1013908739 6:115248523-115248545 CTCCCAGCTTTTGTTTGTCTGGG - Intergenic
1014108382 6:117592496-117592518 CTCCCAGCTTTTGGTGCTGTTGG + Intronic
1014384502 6:120784245-120784267 CTGGCATCTTTTGCTTATATTGG + Intergenic
1014572047 6:123021810-123021832 CTCTCAGCCTTTGCTGGTATGGG + Intronic
1015322568 6:131892769-131892791 CACTCAGCATTTGCTGGTATGGG + Exonic
1016890396 6:149000575-149000597 CTGCCTGCCTTTCTTGGTATTGG - Intronic
1017276549 6:152576151-152576173 CTGCTTGCTTTTGCAGTTATTGG + Intronic
1022366351 7:29722964-29722986 CTGGCAGGTTTTGTTGGTCTGGG + Intergenic
1023250669 7:38257412-38257434 CTGCCATCTTAAGCTGGTGTCGG + Intergenic
1024396212 7:48870525-48870547 CTGCCAGCTGTGGATGGTCTGGG + Intergenic
1028235580 7:88357493-88357515 CTGCCTCCTTCTGCTGGGATTGG + Intergenic
1031906033 7:127460331-127460353 CTGTCAGCTTTTGTTTGTCTGGG - Intergenic
1031979742 7:128116844-128116866 CTGACAGCTGTGGCTGGTGTGGG + Intergenic
1031996724 7:128237194-128237216 TTGCCATCTTTTGCTGCTCTAGG + Intergenic
1032497603 7:132374462-132374484 CCTCCAGCCTTTGCTGGTGTAGG - Intronic
1032538435 7:132683923-132683945 CTGCTGGCTCTTGCTGGGATGGG - Intronic
1032911542 7:136437178-136437200 CTTGCAGCTTTTGCTTTTATTGG - Intergenic
1033179319 7:139159548-139159570 TTCCCACCTTGTGCTGGTATTGG + Intronic
1033649672 7:143331294-143331316 CTACCAGCTTTTGCTGCCATCGG + Exonic
1035838786 8:2788122-2788144 ATGCCAGCATTTGCGGGGATGGG + Intergenic
1035946593 8:3970329-3970351 CTGCGATCTTATGCTGGTATAGG - Intronic
1038225404 8:25652512-25652534 CTGTCACCTTTTGCTTGTCTAGG + Intergenic
1042364017 8:67915711-67915733 CAGCAAGCATTTGCTGGTGTTGG - Intergenic
1043723052 8:83572157-83572179 CTGCCATAATTTGGTGGTATTGG + Intergenic
1045586351 8:103541421-103541443 CTGTCAGCTTTTGTTTGTATGGG - Intronic
1045976581 8:108136583-108136605 CTGCCAGCTTTTTATGGCTTAGG + Intergenic
1046603000 8:116339838-116339860 CACTCGGCTTTTGCTGGTATGGG - Intergenic
1049059877 8:140268344-140268366 CTGGCAGCTTTTGGTGCTGTAGG + Intronic
1051027312 9:12628271-12628293 TAGCCAGTTTTTACTGGTATTGG + Intergenic
1051683474 9:19632215-19632237 CTGCCATCCTTTGCTGTCATAGG + Intronic
1057009560 9:91589562-91589584 CTCCCAGTTCTTGCTGGAATGGG - Intronic
1060376799 9:123122465-123122487 CTGAGAGATTTTGCTGGTATTGG - Exonic
1060461719 9:123861865-123861887 ATGGCAGCATTTGCTGGTCTTGG - Intronic
1061016385 9:127983153-127983175 CTGCCAGGTTTAGCTGGGGTTGG + Intergenic
1061518420 9:131103066-131103088 CTGCCAGCTTCTGATGGGTTTGG + Intronic
1187315126 X:18185911-18185933 CTGTCAGCTTTTGTTTGTCTGGG - Intronic
1189300956 X:39951916-39951938 CTGTCAGCTTTTGCTCAGATGGG - Intergenic
1189943541 X:46153090-46153112 CTGTCTGCTTTTGCTGGGTTAGG + Intergenic
1190262880 X:48809091-48809113 CTGCCAGTTTTTGCTATTACAGG + Intronic
1193511653 X:82409263-82409285 CTTTCAGCTTTTGCTTGTCTGGG + Intergenic
1195831156 X:109060665-109060687 CTTTCAGCTTTTGCTTGTCTGGG + Intergenic
1196163780 X:112515469-112515491 CTCTCAGCTTTTGCTTGTCTGGG - Intergenic
1199925453 X:152458312-152458334 GTGCCAAATTTTGCTGGTTTGGG - Intergenic