ID: 948953436

View in Genome Browser
Species Human (GRCh38)
Location 2:241270213-241270235
Sequence GAACCTACTCCTGTGTCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 124}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948953432_948953436 6 Left 948953432 2:241270184-241270206 CCTATACTGAAAGGAGTCTCAAC 0: 1
1: 0
2: 0
3: 4
4: 81
Right 948953436 2:241270213-241270235 GAACCTACTCCTGTGTCTGAGGG 0: 1
1: 0
2: 0
3: 12
4: 124
948953430_948953436 12 Left 948953430 2:241270178-241270200 CCGGACCCTATACTGAAAGGAGT 0: 1
1: 0
2: 0
3: 5
4: 70
Right 948953436 2:241270213-241270235 GAACCTACTCCTGTGTCTGAGGG 0: 1
1: 0
2: 0
3: 12
4: 124
948953427_948953436 22 Left 948953427 2:241270168-241270190 CCAAGTCCAGCCGGACCCTATAC 0: 1
1: 0
2: 0
3: 4
4: 47
Right 948953436 2:241270213-241270235 GAACCTACTCCTGTGTCTGAGGG 0: 1
1: 0
2: 0
3: 12
4: 124
948953428_948953436 16 Left 948953428 2:241270174-241270196 CCAGCCGGACCCTATACTGAAAG 0: 1
1: 0
2: 0
3: 1
4: 45
Right 948953436 2:241270213-241270235 GAACCTACTCCTGTGTCTGAGGG 0: 1
1: 0
2: 0
3: 12
4: 124
948953431_948953436 7 Left 948953431 2:241270183-241270205 CCCTATACTGAAAGGAGTCTCAA 0: 1
1: 0
2: 1
3: 4
4: 121
Right 948953436 2:241270213-241270235 GAACCTACTCCTGTGTCTGAGGG 0: 1
1: 0
2: 0
3: 12
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948953436 Original CRISPR GAACCTACTCCTGTGTCTGA GGG Intronic