ID: 948953967

View in Genome Browser
Species Human (GRCh38)
Location 2:241272805-241272827
Sequence CGTCCCGGCTTCTCCCGCGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 73}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948953967_948953970 -10 Left 948953967 2:241272805-241272827 CCCGCGCGGGAGAAGCCGGGACG 0: 1
1: 0
2: 0
3: 5
4: 73
Right 948953970 2:241272818-241272840 AGCCGGGACGCTCCGAGGCGCGG 0: 1
1: 0
2: 0
3: 3
4: 84
948953967_948953972 -3 Left 948953967 2:241272805-241272827 CCCGCGCGGGAGAAGCCGGGACG 0: 1
1: 0
2: 0
3: 5
4: 73
Right 948953972 2:241272825-241272847 ACGCTCCGAGGCGCGGCGCCCGG 0: 1
1: 0
2: 0
3: 1
4: 79
948953967_948953975 4 Left 948953967 2:241272805-241272827 CCCGCGCGGGAGAAGCCGGGACG 0: 1
1: 0
2: 0
3: 5
4: 73
Right 948953975 2:241272832-241272854 GAGGCGCGGCGCCCGGGCCCCGG 0: 1
1: 0
2: 4
3: 97
4: 719
948953967_948953978 16 Left 948953967 2:241272805-241272827 CCCGCGCGGGAGAAGCCGGGACG 0: 1
1: 0
2: 0
3: 5
4: 73
Right 948953978 2:241272844-241272866 CCGGGCCCCGGCTGCTATATAGG 0: 1
1: 0
2: 0
3: 4
4: 40
948953967_948953973 -2 Left 948953967 2:241272805-241272827 CCCGCGCGGGAGAAGCCGGGACG 0: 1
1: 0
2: 0
3: 5
4: 73
Right 948953973 2:241272826-241272848 CGCTCCGAGGCGCGGCGCCCGGG 0: 1
1: 0
2: 0
3: 11
4: 144
948953967_948953979 17 Left 948953967 2:241272805-241272827 CCCGCGCGGGAGAAGCCGGGACG 0: 1
1: 0
2: 0
3: 5
4: 73
Right 948953979 2:241272845-241272867 CGGGCCCCGGCTGCTATATAGGG 0: 1
1: 0
2: 0
3: 0
4: 19
948953967_948953984 23 Left 948953967 2:241272805-241272827 CCCGCGCGGGAGAAGCCGGGACG 0: 1
1: 0
2: 0
3: 5
4: 73
Right 948953984 2:241272851-241272873 CCGGCTGCTATATAGGGCGGCGG 0: 1
1: 0
2: 0
3: 0
4: 36
948953967_948953980 20 Left 948953967 2:241272805-241272827 CCCGCGCGGGAGAAGCCGGGACG 0: 1
1: 0
2: 0
3: 5
4: 73
Right 948953980 2:241272848-241272870 GCCCCGGCTGCTATATAGGGCGG 0: 1
1: 0
2: 0
3: 1
4: 36

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948953967 Original CRISPR CGTCCCGGCTTCTCCCGCGC GGG (reversed) Exonic