ID: 948959327

View in Genome Browser
Species Human (GRCh38)
Location 2:241319892-241319914
Sequence GAAAACAGTAAGAAAACTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 561
Summary {0: 1, 1: 0, 2: 7, 3: 64, 4: 489}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948959327 Original CRISPR GAAAACAGTAAGAAAACTGC TGG (reversed) Intronic
900735003 1:4294027-4294049 GAAGACAGTGAGAGAACTGAGGG + Intergenic
901364219 1:8731683-8731705 GAAAAAAACAAGAAAACTACAGG + Intronic
901419360 1:9140030-9140052 AAAAAAAGAAAGAAAAGTGCTGG + Intergenic
902668395 1:17954919-17954941 GAAAAAAGAAAAAAAAATGCTGG - Intergenic
902684499 1:18067135-18067157 GAAACCAGTATGCAAACTGGTGG - Intergenic
903036258 1:20494513-20494535 GAAAACAATAAGGCAGCTGCAGG + Intergenic
906066593 1:42985326-42985348 CACAACAGTCAGAAAACTGTAGG - Intergenic
906663687 1:47602114-47602136 GAAAACAGTAAGTGAACTAGAGG + Intergenic
906682250 1:47736546-47736568 AAAAACAAAAAGAAAACTACAGG - Intergenic
907027440 1:51135039-51135061 CAAAACAAAAAGAAAACTTCAGG + Intronic
907263003 1:53236002-53236024 GAAAACATTTTGAAAACTGTAGG + Intronic
907739181 1:57147424-57147446 AAAAACAAAAAGAAAACTGGGGG - Intronic
908368844 1:63458886-63458908 TAAAAAAATGAGAAAACTGCAGG - Intronic
908621500 1:65986083-65986105 CAAGACAGTAACAAAAATGCAGG + Intronic
908908229 1:69040738-69040760 GAAAACAATAACAAAATGGCAGG + Intergenic
910498458 1:87860656-87860678 CAAAACAGTAAGAAATCCGTAGG + Intergenic
910610844 1:89140460-89140482 GAAAAAAAAAAGAAAAATGCAGG + Intronic
910994340 1:93088099-93088121 GAAAAAAATAAGAGAACTGAGGG - Intronic
911239991 1:95454706-95454728 GAACAGAGCAAGAAAAATGCGGG - Intergenic
911241029 1:95466895-95466917 AAAAACACAAAGAAAACTACAGG - Intergenic
911343527 1:96669307-96669329 AAAAAAAGAAAGAAAACTGCAGG - Intergenic
912108417 1:106310206-106310228 AAAACAAGAAAGAAAACTGCAGG + Intergenic
912533496 1:110343796-110343818 GATAACAGAAAGAAAACAGTTGG - Intronic
913092107 1:115483375-115483397 GAAAACAAAAACAAAACTCCAGG + Intergenic
913577509 1:120191777-120191799 GAAAAGAGTGTGAAAATTGCTGG - Intergenic
914419066 1:147511799-147511821 AAAAAAAGAAAAAAAACTGCAGG + Intergenic
914559422 1:148803204-148803226 GAAAAGAGTGTGAAAATTGCTGG - Intergenic
914613411 1:149327019-149327041 GAAAAGAGTGTGAAAATTGCTGG + Intergenic
915337627 1:155155687-155155709 GAAAACATTGAGGAAACTCCAGG + Intergenic
916620581 1:166492139-166492161 AAAAACAGTAAGACAATTGTTGG - Intergenic
916721403 1:167487080-167487102 AAAAAAAGGAAGAAAACGGCCGG + Intronic
916789093 1:168109318-168109340 GAAAAAAGAAAGAAACCTACAGG + Intronic
917060833 1:171036916-171036938 GAAAACAGTAAGAAAAATCAAGG + Intronic
917611575 1:176693998-176694020 GAGAAAAGGAAGCAAACTGCAGG - Intronic
917741645 1:177967119-177967141 GAAAGCAGATAGAAACCTGCAGG - Intronic
918376104 1:183910596-183910618 GAAAGCAGTAAGAAAGCCCCAGG - Intronic
918665866 1:187150248-187150270 GAAAAAAATAAGAAAACTGAAGG - Intergenic
919404393 1:197159943-197159965 GAAAACATTAACAAAACACCTGG - Exonic
921525111 1:216208248-216208270 GAAAATAGTACGTAAACTGGTGG - Intronic
921987611 1:221329305-221329327 GAAACCAGTTAAAAATCTGCAGG + Intergenic
922248021 1:223819383-223819405 GTAAAGAGTAAGAAAACTGAGGG + Intronic
1063267545 10:4471325-4471347 AAACACTGTAAGAAAAATGCTGG - Intergenic
1064255041 10:13736281-13736303 GAAAACAGGAAGAAAAATACAGG + Intronic
1064521197 10:16203386-16203408 GAAAAAAGAAAAAAAACTGGGGG - Intergenic
1064994173 10:21281856-21281878 GGATACAGTAAGAAGACTGTTGG - Intergenic
1065162205 10:22934232-22934254 AAAGACAGTAAGAAAAGTGTTGG + Intronic
1065262226 10:23936053-23936075 GGAAACAGTAAAAATACAGCAGG + Intronic
1065421610 10:25550944-25550966 GAAAACAGAAAGAGACCTTCAGG - Intronic
1067023473 10:42822736-42822758 GAAAACAGTAAGATAAACGCTGG - Intronic
1068304198 10:55182736-55182758 GAAAACAGGAGGAAAACTGTGGG + Intronic
1069335470 10:67344287-67344309 AAAAAGAGAAAGAAAACTACAGG - Intronic
1070278938 10:75034831-75034853 GAAAACAGAGAGAACACTCCCGG - Intergenic
1071085087 10:81860743-81860765 GAAAAAAGTCAGCAAACTTCAGG - Intergenic
1071218421 10:83434198-83434220 GTCATCAGTAGGAAAACTGCAGG + Intergenic
1071242488 10:83723349-83723371 GAAAACAGTAGGAAAATTTGAGG + Intergenic
1078244090 11:9557589-9557611 GAAAAAAGAAAGAAAACAACAGG - Intergenic
1078847359 11:15130933-15130955 GAAAACATAAAATAAACTGCTGG - Intronic
1078849012 11:15146973-15146995 GAAAATACTAAGAAAATTCCAGG - Intronic
1078903626 11:15664232-15664254 GAAAACAGGAAAAGAACAGCAGG - Intergenic
1080567191 11:33521478-33521500 GCAAACACTTAGAAAAATGCTGG + Intergenic
1080593109 11:33740725-33740747 GAAAACTGTAAGAAAACAAGTGG - Intergenic
1081043362 11:38239449-38239471 AAGAAAAGAAAGAAAACTGCAGG - Intergenic
1081101035 11:39002324-39002346 GAAAACAGGAAGAGAACTGCAGG - Intergenic
1081438944 11:43058989-43059011 GTAAACTGTAAAAAAACAGCAGG + Intergenic
1082883280 11:58058911-58058933 GGAAACAGTTGGAAAACTGGGGG + Intronic
1082992233 11:59217223-59217245 GAAACCAGTGTGAAAACTGATGG + Intergenic
1084018441 11:66401803-66401825 GTAATAAGTAACAAAACTGCAGG - Intergenic
1084737023 11:71112095-71112117 GAGCACAGTAAGAATCCTGCCGG + Intronic
1085616081 11:77999982-78000004 CAAATCAGTTAGCAAACTGCTGG - Intergenic
1086129619 11:83387307-83387329 GAAGAAAAAAAGAAAACTGCTGG + Intergenic
1086467292 11:87068227-87068249 TAAAACAGTAAGTTAACTCCTGG + Intronic
1086625333 11:88943912-88943934 GAAAAGAGAAACAAAACTGAGGG - Intronic
1087247205 11:95853306-95853328 GAAAAAAGTGAGCAAACTTCTGG - Intronic
1091152744 11:133343943-133343965 GAATAAACTGAGAAAACTGCAGG - Intronic
1091200436 11:133776203-133776225 GAAAACTGTGAGAAAACTCTTGG - Intergenic
1091822545 12:3487116-3487138 GAAGACACTAAGAACACTGCTGG + Intronic
1092087142 12:5772106-5772128 GAAAACATAAAGAACACTGATGG + Intronic
1093218731 12:16393333-16393355 GAAATGAGGAAGGAAACTGCAGG - Intronic
1093337967 12:17932945-17932967 GAAAACATAAACAAAACTGAAGG - Intergenic
1094661767 12:32476179-32476201 GACAACAGCTAGAAGACTGCTGG - Intronic
1095915948 12:47478735-47478757 CAACAAAATAAGAAAACTGCAGG + Intergenic
1096329811 12:50701266-50701288 GAAGCCAGTAAGAAAAATACTGG - Intronic
1096664781 12:53156529-53156551 TAAGACAGTAAGAAAACCACAGG + Intergenic
1096963707 12:55606825-55606847 CAAAAGAGAAAGAAAACTGGTGG - Intergenic
1097570817 12:61328808-61328830 GAAAACATTAAGATGACTGCTGG - Intergenic
1097764464 12:63509185-63509207 AAAAAAAGAAAGAAAATTGCAGG + Intergenic
1097902348 12:64885716-64885738 CAAATCAGTAAGAAAAAGGCTGG - Intergenic
1098698091 12:73584823-73584845 TCAAACAGTAAGAAAAGTGGTGG + Intergenic
1099034400 12:77567391-77567413 TAAAACAACAAGAACACTGCTGG - Intergenic
1099299073 12:80868606-80868628 AAAAACAGGAAAGAAACTGCAGG + Intronic
1099449307 12:82789799-82789821 GAACACAGAAAGCAAACTGAGGG - Intronic
1099711109 12:86225486-86225508 TAACACAAAAAGAAAACTGCAGG + Intronic
1100042313 12:90335226-90335248 AAAAACAGGTATAAAACTGCAGG + Intergenic
1100061268 12:90578870-90578892 AAAACCAGTAATAAAATTGCTGG - Intergenic
1100062909 12:90603536-90603558 GAAAATAGGAAGAAAACTAGAGG - Intergenic
1100730134 12:97456757-97456779 GAAATCACTATGGAAACTGCAGG + Intergenic
1100924245 12:99525591-99525613 CAAATCAGTAAGAAAACCACGGG + Intronic
1100935132 12:99655822-99655844 GACAATATTAAGAAAACTTCTGG + Intronic
1101470989 12:104996911-104996933 GCAAACAGAAAGAAAAAGGCAGG - Intronic
1101562503 12:105871143-105871165 GAAAAAAGTAACAAAATGGCAGG + Intergenic
1101864273 12:108508556-108508578 GAAAGCAGTCAGTAAACAGCTGG + Intergenic
1102295570 12:111733876-111733898 GACAGCACTAAGAAAACTGCCGG - Intronic
1102325529 12:111979448-111979470 GAAAACAGAAAGCAGACTGGTGG + Intronic
1102526424 12:113515360-113515382 GAAAAAAGAAAGAAAACGCCTGG - Intergenic
1102654459 12:114469787-114469809 AAAAACATTAACAAAACTGAAGG - Intergenic
1102943274 12:116962500-116962522 GAAAACAGTGTGCAGACTGCTGG + Intronic
1103226822 12:119295023-119295045 TTAAACAGTAAGAACACAGCAGG - Intergenic
1104341576 12:127954785-127954807 GCAAACTGGAAGAGAACTGCTGG + Intergenic
1105661547 13:22501237-22501259 ACAAACAGCAAGAAAACTGCTGG - Intergenic
1105901637 13:24759774-24759796 GAAAACAATAACAAAACTTTAGG + Intergenic
1105989045 13:25600091-25600113 GAGTACAGTAAGAAAACTCTAGG + Intronic
1106583081 13:31034221-31034243 GAAAACACTGGAAAAACTGCAGG - Intergenic
1106744226 13:32682632-32682654 GAAAACAGTAATTAAATTGCTGG + Intronic
1107075037 13:36314573-36314595 GTATTCAGGAAGAAAACTGCAGG - Intronic
1107932633 13:45318969-45318991 GAAAAGAAAAAGAAAACTGGAGG + Intergenic
1108406760 13:50111218-50111240 GAAAAATGCAATAAAACTGCAGG - Intronic
1108685057 13:52812350-52812372 GAAAAGAAAAAGAAAATTGCCGG - Intergenic
1109122872 13:58480712-58480734 GGAAACAGTAAGAAATATGAAGG - Intergenic
1109665790 13:65534839-65534861 GAAAACAGAGAGAAAACTATAGG - Intergenic
1109974359 13:69811821-69811843 GAAAACATCAACAAAACTGATGG - Intronic
1109979677 13:69890804-69890826 TAAAGCAATAAGAAAAATGCAGG - Intronic
1110286670 13:73757616-73757638 GAAAACCAGAACAAAACTGCTGG + Intronic
1110562667 13:76926112-76926134 GAAGAAAATAAGAGAACTGCAGG + Intergenic
1110809856 13:79800294-79800316 GGAAATATTAAGAAAACTGAGGG + Intergenic
1110937780 13:81314598-81314620 GAAAACATAATGAACACTGCAGG + Intergenic
1111188580 13:84777530-84777552 GAAAACAACAAGAATACTGTTGG - Intergenic
1112071237 13:95852889-95852911 GAAAAGAGTAAGAAAAAAGAGGG + Intronic
1112618595 13:101031971-101031993 GAAAACAATAACAAAATGGCAGG - Intergenic
1112943012 13:104889749-104889771 AAAAACAGGAAAATAACTGCAGG + Intergenic
1113049314 13:106191132-106191154 GAAAAAAGGAAGACAACTGCAGG - Intergenic
1113208698 13:107948918-107948940 GAAAAAAGAAAAAAAACTACAGG + Intergenic
1114068179 14:19084297-19084319 GAAAACAGTAAGATAAACACTGG + Intergenic
1114094084 14:19315729-19315751 GAAAACAGTAAGATAAACACTGG - Intergenic
1115273791 14:31584140-31584162 AAAAAAAAAAAGAAAACTGCTGG - Intronic
1115276092 14:31610624-31610646 AAAAAAAGAAAGAAAACTGCAGG + Intronic
1115958094 14:38804940-38804962 GAATACAAAAAGAAAACTACAGG + Intergenic
1115966289 14:38892320-38892342 GCAAACATTGAGAAAACTGGAGG + Intergenic
1117461489 14:55949562-55949584 CAGAACAGAAAGAAAAATGCTGG - Intergenic
1117942015 14:60978018-60978040 GAAAACAGTAAAACATCTGCCGG + Intronic
1118057643 14:62098115-62098137 CAACATAGAAAGAAAACTGCAGG + Intronic
1118317325 14:64733121-64733143 GAAAAAAGTAAGAAAAAGGTGGG - Intronic
1118318651 14:64740780-64740802 GAAAACAGTAAGAATGCAGATGG - Intronic
1119464732 14:74847548-74847570 TAAAACAGTAAGAAGACTATTGG + Intronic
1119525458 14:75319092-75319114 GAAAGCAGTAGGGAAACTGGTGG + Intergenic
1120108314 14:80521864-80521886 GAAAACAGTAGTAAAACTGTAGG - Intronic
1120230017 14:81831728-81831750 GAGAACATTAAGAGAACTGTGGG + Intergenic
1120943462 14:89971482-89971504 GAAATTAGTAAGAAGACTTCAGG - Intronic
1121263398 14:92582825-92582847 GACAACATTAAGAAAGCAGCAGG + Intronic
1121358755 14:93235905-93235927 GAAAACAGGAGGAGAAATGCTGG - Intergenic
1122002283 14:98669032-98669054 GGAAAAAGAAAGAAAACTGCAGG - Intergenic
1122468603 14:101950774-101950796 GAGAACAGCAAGAAAGCTGCTGG - Intergenic
1122727830 14:103770807-103770829 CACAACAGTAAGGAAACTACAGG + Intronic
1123424613 15:20159778-20159800 GAAAACAGTAAGATAAATGCTGG - Intergenic
1123533837 15:21166309-21166331 GAAAACAGTAAGATAAATGCTGG - Intergenic
1124070344 15:26386757-26386779 AAAAAGAAAAAGAAAACTGCAGG - Intergenic
1124421955 15:29530451-29530473 AAAAACAATGAGAAAACTCCTGG - Intronic
1124557258 15:30737260-30737282 GAAAAAACTATCAAAACTGCAGG + Intronic
1126332516 15:47548827-47548849 GTAAACATTTAGAAAAATGCAGG + Intronic
1126385216 15:48087293-48087315 TAATACAGTAAGAAAAAGGCAGG - Intergenic
1127015436 15:54680962-54680984 GAAAACAGCTAGAAATCTGGAGG + Intergenic
1127229244 15:56970751-56970773 GAAAATTGGAAGAAAACAGCTGG + Intronic
1127290576 15:57567056-57567078 GATATCAGTACGAAAACTGTGGG - Intergenic
1127327499 15:57909931-57909953 GAAAACAGAAACAAAATTCCTGG + Intergenic
1127700365 15:61493731-61493753 TAAAACAGTAAGAAAAATACTGG + Intergenic
1127742141 15:61920513-61920535 GAAAACATTAAGACAACTTTTGG + Exonic
1128266841 15:66274223-66274245 TTAAAGAGGAAGAAAACTGCTGG + Intergenic
1129422912 15:75443749-75443771 AAAAGCAATAAGAAAACTGAAGG + Intronic
1130318782 15:82821670-82821692 GAAAATAGTCAGAAAACTTGTGG - Intronic
1131459173 15:92606478-92606500 GAGACCAGTTAGGAAACTGCAGG + Intergenic
1132281706 15:100622839-100622861 GAAAACAGGAAAAACACTTCAGG + Intronic
1133143179 16:3763318-3763340 GAAAAAAATAAGAAAATAGCTGG - Intronic
1133331451 16:4977143-4977165 GAATACAAAAAGAAACCTGCAGG + Intronic
1133739985 16:8644110-8644132 GAGAACAGAGAGAAAACTGCTGG - Intronic
1134145624 16:11758915-11758937 GAAAGCAGTAAAGAAACTGCAGG + Intronic
1134767020 16:16768548-16768570 GAAAATAGCAAGAAAATTTCAGG - Intergenic
1136502283 16:30677972-30677994 GCAAACAGTTAGCAAAGTGCGGG - Intergenic
1136860240 16:33695968-33695990 GAAAACAGTAAGATAAACGCCGG + Intergenic
1137738855 16:50745256-50745278 GGGAACAGTAAGACAACTGAAGG - Intronic
1138878705 16:60984161-60984183 GAGAACAAAATGAAAACTGCAGG + Intergenic
1138984720 16:62314483-62314505 GAACACAGAAAGAAAATGGCGGG + Intergenic
1138992954 16:62413866-62413888 AAAAACAAGAAGAAAACTACAGG - Intergenic
1139055845 16:63182426-63182448 GAAAACATTAAAAAAATTGGGGG - Intergenic
1139294780 16:65890953-65890975 GAAGACAGTAAGAAAAATATGGG - Intergenic
1139347094 16:66310928-66310950 GAGAACTGTAAGGAATCTGCTGG + Intergenic
1139398946 16:66664754-66664776 GAAAACAGGAACAAAACAGAGGG + Intronic
1139786625 16:69398140-69398162 GAAAACAATAAATAAACTGGTGG - Intronic
1140800263 16:78480950-78480972 GCAAATAGTAAGAAAAGAGCAGG + Intronic
1141728626 16:85807600-85807622 AAAAAAAAAAAGAAAACTGCAGG - Intergenic
1141995097 16:87631728-87631750 CAAAACAGTAAGAAAATTAAAGG - Intronic
1203121746 16_KI270728v1_random:1544136-1544158 GAAAACAGTAAGATAAACGCCGG + Intergenic
1143173189 17:4941926-4941948 AAAAACAAAAAGAAAACTGAAGG + Intronic
1145401673 17:22542155-22542177 GCAAACATTAACAAAACTTCAGG + Intergenic
1145994092 17:29095789-29095811 AAAAAAAGTAAGAAAACTCCGGG + Intronic
1146214542 17:30968751-30968773 GAAAAAAGTTTGAAAACTACTGG + Intergenic
1146583112 17:34057600-34057622 TACAACAGAAAGAAAATTGCAGG + Intronic
1146778488 17:35644735-35644757 TAAAACAGTAAGTATGCTGCTGG + Intronic
1147534805 17:41312997-41313019 GAAGACATTAATAATACTGCTGG + Intergenic
1148459258 17:47828960-47828982 GAACACATTAAGAAAAGTGGGGG + Intronic
1148537915 17:48456130-48456152 GGAAACAGCATGAAAAATGCAGG + Intergenic
1149360480 17:55889781-55889803 GACAAGAGTAGGATAACTGCTGG - Intergenic
1149896121 17:60429706-60429728 AAAAACAGAAAGGAAAATGCGGG - Intronic
1152456582 17:80420614-80420636 GGATTCAGTAACAAAACTGCAGG + Intronic
1152594128 17:81230009-81230031 GAAAACAGGAAGAAAGAAGCTGG + Intronic
1154509187 18:15077140-15077162 CATAACAGAAAGAAAACTACAGG - Intergenic
1155225019 18:23721772-23721794 GAAATCAGTTAGAAGACTGGTGG - Intronic
1155976554 18:32138215-32138237 GAAAACAGAAAAAAATCTGCAGG - Intronic
1156415241 18:36880473-36880495 GAAAATATTAAGAAATCTCCAGG - Intronic
1156639860 18:39079851-39079873 GGAAACATTAAGAAAAATGATGG + Intergenic
1156810612 18:41245309-41245331 GAAAAAAATAAGCAAACTCCAGG + Intergenic
1158282406 18:55841582-55841604 TAAAACAGTATGATTACTGCTGG + Intergenic
1158674439 18:59505591-59505613 TAACACAGTAAGAAAAGTGCTGG - Intronic
1159347090 18:67220205-67220227 GAAAACGAAAAGAACACTGCAGG + Intergenic
1159678907 18:71322229-71322251 GAAAACTTTAAGATAGCTGCAGG + Intergenic
1160213275 18:76902556-76902578 GAAAAAAGAAAGAAAAATGCAGG - Intronic
1161304438 19:3559009-3559031 AAAGAAAGAAAGAAAACTGCTGG - Intronic
1164271232 19:23673900-23673922 TAGAACATTAAGAAAACTGTTGG + Intronic
1164491251 19:28716508-28716530 AAAAAAAGAAAGAAAACTACAGG + Intergenic
1165197840 19:34119358-34119380 CAAAACAGTATTAAAACTTCAGG + Intergenic
1166225611 19:41393198-41393220 GAAAACACTTAGAACACTGCGGG + Intronic
1166880965 19:45929690-45929712 GAAAACAAAAAGAAATCTGAGGG - Intergenic
1167281152 19:48569508-48569530 AAAAAAAGAAAGAAAACTCCTGG - Intronic
1167614915 19:50527326-50527348 GAAAAAAGAAAGAAAACAGCCGG - Intronic
1167884124 19:52486467-52486489 GAAAAAAGTAAGAAAGCAGGAGG + Intronic
926519049 2:13886360-13886382 GAAAACAATAACAAAATGGCAGG + Intergenic
927221769 2:20717382-20717404 CAAACCAGTAAGAAAAAGGCTGG + Intronic
927723011 2:25398985-25399007 GAAAAGAGCAGGAAAAGTGCTGG + Intronic
927810302 2:26176612-26176634 CAGAACAGAATGAAAACTGCTGG - Intronic
928703468 2:33922768-33922790 GAAAACATTATGAAAAGTGAAGG - Intergenic
928797959 2:35047237-35047259 TAAACCAGGAAGAAAACTTCTGG + Intergenic
928851691 2:35755431-35755453 AAAAAAAGAAAGAAAACTACAGG - Intergenic
928932819 2:36642361-36642383 AAAAAAAGGAAGAAAACTACAGG + Intronic
929332043 2:40693879-40693901 GTAAACAGTCAGGAAACAGCAGG + Intergenic
932121466 2:69104533-69104555 GAAAAAAGAAAGAACTCTGCTGG - Intronic
933457609 2:82536483-82536505 GAAGGGAGTAGGAAAACTGCAGG - Intergenic
933538837 2:83613124-83613146 GTAAAAAATAACAAAACTGCTGG - Intergenic
933763164 2:85688192-85688214 GAAAATATCAAGAAAACTGCAGG + Intronic
933987389 2:87603274-87603296 GGACACAGGAAGAAAAGTGCTGG + Intergenic
935791458 2:106594821-106594843 GAAAACAGTGAGAAAACATCAGG - Intergenic
936158842 2:110069103-110069125 GGAAGCAGTAAGAAAGCAGCAGG + Intergenic
936185818 2:110302229-110302251 GGAAGCAGTAAGAAAGCAGCAGG - Intergenic
936306450 2:111347534-111347556 GGACACAGGAAGAAAAGTGCTGG - Intergenic
939322623 2:140643900-140643922 GAAAACAGTAGGAAAGGTGGGGG + Intronic
939903816 2:147884831-147884853 GAAAACAATGAGTAAACTGTTGG - Intronic
940467947 2:154056966-154056988 GAAAACATTAAGAAAAAGGCAGG + Intronic
940929694 2:159413305-159413327 GCAAGAAGTAAGAAAACTGTAGG + Intronic
941038547 2:160594567-160594589 AAAAACACTAAGGAAAATGCAGG - Intergenic
941247746 2:163121886-163121908 AAAAACAGGCAGAAAACTGCAGG - Intergenic
941461322 2:165775133-165775155 GAACAGAGTTAGAAAAATGCTGG - Intronic
941880221 2:170473440-170473462 GAAAATAGTGATAAAACGGCTGG - Intronic
942683779 2:178509385-178509407 AAAAGCAGTTAGAAAAGTGCTGG + Exonic
942914335 2:181284995-181285017 AAAAAAAATTAGAAAACTGCAGG - Intergenic
943149643 2:184095871-184095893 CAAAAAAATAAGAAAACTACAGG - Intergenic
944243530 2:197508729-197508751 GAAAACAGTAATTAACTTGCTGG - Intronic
944621602 2:201521695-201521717 AAAAAAAGAAAGAAAACTACAGG + Intronic
944655107 2:201869560-201869582 AAAAAAAGAAAGAAAACTGAGGG + Intronic
945045616 2:205778924-205778946 GATAACACTATGAAAATTGCTGG - Intronic
945194149 2:207222620-207222642 GAAAATGGAAAGAATACTGCAGG - Intergenic
946206762 2:218114797-218114819 GAAAACAGTTAGCAGGCTGCAGG - Intergenic
947297549 2:228648892-228648914 GAAAACTGGAAGAAAACTGGTGG + Intergenic
948959327 2:241319892-241319914 GAAAACAGTAAGAAAACTGCTGG - Intronic
1169176390 20:3519014-3519036 AAAAAAAGAAAGAAAACTGTAGG + Intronic
1169319173 20:4617169-4617191 GAAAACAGTAAGAAAACCTCTGG - Intergenic
1169655494 20:7918165-7918187 GAAAACAGGAGCAAAACAGCAGG + Intronic
1169980996 20:11383811-11383833 GAAAACTGGAAGGAAGCTGCAGG + Intergenic
1170010764 20:11720568-11720590 CAAAGTAGAAAGAAAACTGCTGG + Intergenic
1170794532 20:19534831-19534853 GAAAACAGTTTGGAAAATGCTGG - Intronic
1172475767 20:35236348-35236370 GAAGAGAGAAAGAAAACTCCGGG - Intronic
1173298142 20:41777571-41777593 GACAAGAGCAAGAAAACTGGTGG + Intergenic
1173599874 20:44286927-44286949 AAAAAAAGAAAGAAAACTACAGG - Intergenic
1174167480 20:48595409-48595431 GAAAAAAGGAAGGAAGCTGCAGG + Intergenic
1175381031 20:58564469-58564491 GAAGGCAGTTAGAGAACTGCTGG + Intergenic
1176006657 20:62868098-62868120 GAAAAAAGAAAAAAAACTGAAGG + Intergenic
1177082807 21:16661974-16661996 TAAAAGAGTAATAAAACTGCTGG + Intergenic
1177563295 21:22784785-22784807 GAAAGCTATAAGAAAACTGTCGG + Intergenic
1178313264 21:31547488-31547510 GAAAAAAGGAAAAAAACTACAGG + Intronic
1178563259 21:33659008-33659030 GGAAGCAGTCAGGAAACTGCAGG + Intronic
1178987519 21:37319868-37319890 GAAAACAGAATGATAATTGCTGG + Intergenic
1179046378 21:37848793-37848815 GATAAGAGTAAGAAAACAGTTGG + Intronic
1179339812 21:40495265-40495287 GAACACTCTAAGAAAATTGCAGG + Intronic
1180486652 22:15806861-15806883 GAAAACAGTAAGATAAACACTGG + Intergenic
1181357597 22:22309350-22309372 GAAAACAGTAAGATAAACGCTGG - Intergenic
1181916186 22:26282220-26282242 GAACACAGTAAAATATCTGCAGG - Intronic
1182180638 22:28344467-28344489 GAAAGCATTAAGGAAACTGTAGG + Intronic
1182185177 22:28394071-28394093 AAAAAGAGTAAAAAAAATGCTGG - Intronic
1182203666 22:28600241-28600263 GAAAACAAAAAAAAAACAGCTGG + Intronic
1182221557 22:28762894-28762916 CAAAACAATAATAAAACTTCTGG + Intergenic
1182667800 22:31972114-31972136 AAAAACAGAAAAAAAACGGCCGG - Intergenic
1182780529 22:32863883-32863905 GCATACAGTAAGAAAAATCCAGG + Intronic
1183453701 22:37910198-37910220 GAAAACTGTAAAAAACCTTCAGG - Intronic
1185006827 22:48282943-48282965 GAAAACAGTAACAAAGATGGTGG + Intergenic
1185177764 22:49339528-49339550 GAAGCCAGGAAGAAAACTGCTGG - Intergenic
949184860 3:1178204-1178226 GAATAAAGTAAGAAAAGTGCAGG - Intronic
949621317 3:5814986-5815008 AAAATCATTAAGCAAACTGCAGG - Intergenic
949796506 3:7857035-7857057 AAATACAGTGTGAAAACTGCAGG + Intergenic
949852616 3:8434157-8434179 GAGAAAAATAAGAAAACTGAGGG + Intergenic
949922362 3:9013213-9013235 TCAAGCAGTAAGAAAACTGAAGG + Intronic
950050772 3:9987226-9987248 AAAAAAAGAAAGAAAACTACAGG + Intronic
950882280 3:16332281-16332303 TAAAAGAGTAAGAAAACTGTGGG - Intronic
950901470 3:16502105-16502127 GAAAACAATAAGAACACTTTGGG + Intronic
951024634 3:17816415-17816437 CAAAACAATAAGAAAAATGAGGG + Intronic
951253658 3:20423969-20423991 GAAAACAGAATGAAATCAGCAGG + Intergenic
951860600 3:27247783-27247805 GAAAATTAAAAGAAAACTGCAGG - Intronic
951959719 3:28303487-28303509 AAAAACAGTAACAAAACTTCGGG - Intronic
952635913 3:35530595-35530617 AAAAAAAGGAAGAAAACTGGGGG + Intergenic
953044273 3:39281191-39281213 GAACAAAGAAAGAAAACTGCTGG - Intronic
953797538 3:45996855-45996877 GAGAACAGAAAGAAAACGGGGGG + Intergenic
954462821 3:50637337-50637359 AAAACCAGTAAGAAAGGTGCTGG + Intronic
954613344 3:51957632-51957654 GGAAGCAGCAAGAAATCTGCAGG + Exonic
955646634 3:61145550-61145572 GAAAAAAATAAAAAAACAGCTGG + Intronic
956955000 3:74327474-74327496 GAATACAGTAAGAAAACTTAAGG - Intronic
957485931 3:80863063-80863085 GAAAAAAATAACAAAACTGGAGG + Intergenic
957836970 3:85607326-85607348 GAAGACAGTATGAAAATGGCTGG + Intronic
957838855 3:85639521-85639543 AAAAACAGTAAGACAACTCCTGG - Intronic
958508983 3:95021199-95021221 CAACACAAAAAGAAAACTGCAGG - Intergenic
958657423 3:97020134-97020156 GAAAACACTAGGAAAGCTCCTGG - Intronic
958778733 3:98516193-98516215 GAAAACAGCACTAATACTGCTGG + Exonic
958795013 3:98698086-98698108 GGGAACAATTAGAAAACTGCAGG + Intergenic
958806337 3:98815349-98815371 GAGAAAAATAAGAAAACTGAAGG + Intronic
959164139 3:102755854-102755876 CAAAGCAGTCAGAAACCTGCAGG - Intergenic
960785966 3:121373131-121373153 GAATCCAGTAAGAAAACAACAGG + Intronic
960897295 3:122518959-122518981 TAAAACAGAAATAAACCTGCTGG - Intergenic
960903096 3:122571737-122571759 GAATTGAGTAAGACAACTGCTGG + Exonic
961952304 3:130762585-130762607 AAAAACAGAAAGAAAACTAAAGG + Intergenic
962592110 3:136901348-136901370 AAAAAAAGAAAGAAAACTACAGG - Intronic
963652138 3:147993312-147993334 GAAATAATTAAGAAAAATGCAGG - Intergenic
964122635 3:153201677-153201699 TAGCACAGTAAGAAAAATGCTGG - Intergenic
964184738 3:153929243-153929265 GAAAACAGTAAGATTACTTCTGG - Intergenic
964419805 3:156489582-156489604 GAAAAAAGTAAGGAAACATCTGG + Intronic
964581526 3:158244571-158244593 CAAAACAAAAAGAAAACTTCAGG - Intronic
964635805 3:158857947-158857969 AAAAACAGTAAGTAAAATACTGG - Intergenic
964685448 3:159391220-159391242 GAAAGCAGTAAAAAAACTCTAGG - Intronic
964689391 3:159433049-159433071 GAAAATGGTAACAAAACTGGGGG - Intronic
964882325 3:161437256-161437278 GAAAAAAGCAAGAAAACTGCTGG + Intergenic
964901619 3:161665940-161665962 GAAAACAGGAAAAACACTTCAGG - Intergenic
965470173 3:169080580-169080602 TAAAACAGGAATAAGACTGCCGG + Intergenic
965510064 3:169558370-169558392 GAAAACACTAGAAAAACAGCAGG - Intronic
965765697 3:172127992-172128014 GAAAACAGTATTAAAACTTTTGG + Intronic
965911450 3:173782570-173782592 GAAAATAGTAAAATAACTGTAGG + Intronic
965940757 3:174178218-174178240 GAAAACAGAAAGCATACTTCTGG - Intronic
966453765 3:180092491-180092513 AAAAACAAAAAGAAAACTTCAGG - Intergenic
966804853 3:183799017-183799039 TAAAAAAGTAACAAAACTTCTGG - Intronic
967060582 3:185869061-185869083 GAAAACAATAAGGAAACTATAGG + Intergenic
967820788 3:193836986-193837008 GGATACAGTAAGAAGGCTGCCGG - Intergenic
969314016 4:6370729-6370751 GATAACTGTAAGAGAGCTGCGGG - Intronic
970285119 4:14504156-14504178 GAAAAAAGAAAAAAAACTTCAGG - Intergenic
970597318 4:17612345-17612367 CAAAACTGTCTGAAAACTGCTGG + Intergenic
971016152 4:22491216-22491238 GAGAAGAGTAATAAAACTCCAGG + Intronic
971924690 4:32993138-32993160 GAAGAGACTAAGAAAACAGCAGG - Intergenic
972757413 4:42062441-42062463 GAAAACACCCAGAAAACTGAAGG + Intronic
972768971 4:42178387-42178409 GAAAACATTTAAAATACTGCAGG + Intergenic
974205209 4:58693725-58693747 GAAAACAATAATAAAACTACAGG + Intergenic
974273652 4:59686970-59686992 GAAAACAGTGTGAAAACTTCTGG + Intergenic
974483614 4:62477242-62477264 AAGAACAGTAAGAAAACTATGGG - Intergenic
976954057 4:90872519-90872541 ACAAAAAGTAAGAAAACTGATGG - Intronic
977090131 4:92662411-92662433 GAAGACAATAAGAAAAATTCAGG + Intronic
977268750 4:94888273-94888295 GAAAACAGTAAAATGACTGATGG + Intronic
977679419 4:99782523-99782545 AAAATCTGTAAGAAAACTGATGG - Intergenic
978000197 4:103547953-103547975 GAAAAAAGGAAGAAAGCTTCAGG - Intergenic
980113327 4:128655293-128655315 GAAAACAGCAAGAGAGCTGGTGG - Intergenic
980401715 4:132296151-132296173 CACAACAAAAAGAAAACTGCAGG + Intergenic
980477859 4:133343006-133343028 GAAAACACTGATAAAACTGAAGG - Intergenic
980485752 4:133455936-133455958 CAAATCAGTAAGAACACTGCTGG + Intergenic
981498236 4:145417449-145417471 GAAAAAAGTAAGAAAAAAGAAGG + Intergenic
982556142 4:156867723-156867745 GAAAACAGTATGAAACCTAGTGG - Intronic
982599791 4:157433182-157433204 GAACACTGAAAGAAAACTGAAGG - Intergenic
982822698 4:159963554-159963576 CAACACAGAAAGAAAACTACAGG - Intergenic
983029143 4:162777072-162777094 GTAAACAGTAATAATACAGCAGG - Intergenic
983113068 4:163777732-163777754 GAAAACAGTAAAAAATATGAAGG - Intronic
983777400 4:171625120-171625142 GAAAAAAGAAAAAAAAGTGCTGG + Intergenic
983912125 4:173251636-173251658 GGAGACAGGAAGGAAACTGCGGG - Intronic
985016414 4:185639522-185639544 GAAAATATTAAGGACACTGCTGG - Intronic
985232034 4:187828870-187828892 GATAATAATAAGAAAACTGCTGG - Intergenic
986024689 5:3839630-3839652 GAAGACAGCAGGAGAACTGCAGG - Intergenic
986135284 5:4971317-4971339 CAAAACAGTAAGAGAATTGGGGG - Intergenic
986651551 5:9968644-9968666 AAAAAAAAAAAGAAAACTGCAGG + Intergenic
987439403 5:17937799-17937821 GAAAACAGGAAAAACACTTCAGG + Intergenic
987785357 5:22492252-22492274 ATAACCAGTAAGAAAACAGCAGG + Intronic
987896640 5:23954582-23954604 AAAAAAAGAAAGAAAACTTCAGG - Intronic
988607971 5:32697430-32697452 AAAAAAAGAAAGAAAACTACAGG - Intronic
988645923 5:33095015-33095037 AAAAAGAGGAAGAAAACTGCAGG - Intergenic
989065830 5:37460724-37460746 AAAAACAAAAAGAAAACAGCAGG + Intronic
989259905 5:39407121-39407143 GAAAACAGTAAAACATTTGCTGG - Intronic
990359436 5:55003525-55003547 GAAAAGGGTCAGAAAACTGATGG - Intronic
991634833 5:68693889-68693911 GAAAACAGAAAAAAAAAAGCAGG + Intergenic
991672139 5:69058367-69058389 GAAAACATCAGGGAAACTGCAGG - Intergenic
992372496 5:76158648-76158670 GAAAACAATAAGAAAATAGAAGG + Intronic
993021044 5:82591338-82591360 AATAACAATAAGAATACTGCAGG - Intergenic
993611659 5:90061649-90061671 GAGACCAGGAAGAAAACTGATGG + Intergenic
993660386 5:90626109-90626131 GAAAACAAAAAGAAAATAGCTGG + Intronic
994265164 5:97706657-97706679 GAAAACAATAACAAAATGGCAGG + Intergenic
994265248 5:97708223-97708245 GAAAAGAAAAAGAAAACTACAGG + Intergenic
994428374 5:99623949-99623971 CAAAAAAGAAAGAAAACTACAGG - Intergenic
994609863 5:102022329-102022351 CAACAAAGTAAGAAAACTTCAGG + Intergenic
995569449 5:113463953-113463975 GAGAACAGCAAGAAGACTGTGGG + Intronic
995727841 5:115201449-115201471 GAAAAGAGCATGAAGACTGCAGG - Intergenic
996066709 5:119087466-119087488 GAAATCAGTAAGAAAACCCTTGG - Intronic
996864243 5:128101653-128101675 GAGAACAGAAACAAAACTTCTGG - Intronic
996949038 5:129102798-129102820 CAAATCAGAAAGGAAACTGCTGG - Intronic
997075959 5:130677409-130677431 GAAAACAATAAGAAATCAGAAGG + Intergenic
998665706 5:144295019-144295041 AAAAGCAGTATGTAAACTGCTGG + Intronic
999073719 5:148775008-148775030 GAATATAGTATGAAAACTGTTGG + Intergenic
999757987 5:154679529-154679551 GTAAACACTAGGAACACTGCAGG + Intergenic
1000104122 5:158042608-158042630 GAAAAGACTAAGAAAAATGGTGG - Intergenic
1000571575 5:162921367-162921389 GAAAACATTGACAGAACTGCAGG - Intergenic
1000586499 5:163105741-163105763 GAAAAGAGAAAGAAAATTCCAGG - Intergenic
1000627737 5:163558675-163558697 AGAAACAGCAAGGAAACTGCAGG + Intergenic
1001646112 5:173283561-173283583 GAAAATAAAAAGTAAACTGCTGG + Intergenic
1002609559 5:180406241-180406263 GAAAACAGTAACAAATGTGGTGG + Intergenic
1003087976 6:3076734-3076756 GAAAACAGAGAGAAAACCTCAGG - Intronic
1003750934 6:9055035-9055057 GAGGACAGTAGGAAAACTGCTGG + Intergenic
1003993439 6:11512226-11512248 GAAAATAGTAGTAAAACTGTTGG + Intergenic
1005318459 6:24627736-24627758 GAAACCAGTAAGAAGATTGCTGG - Intronic
1005627984 6:27681417-27681439 GACAACAGTCAAAAAACTGGGGG + Intergenic
1005754107 6:28910317-28910339 AAAAAAAGTAAGAAATGTGCAGG - Intronic
1005795091 6:29351658-29351680 GAACAAAATAAGAAAACTTCTGG - Intergenic
1005797956 6:29387543-29387565 GAACACAGTTACAAAACTGTGGG - Intronic
1006737357 6:36283953-36283975 GAAAACAGAGAGAAAAGAGCAGG + Intronic
1007326011 6:41060170-41060192 GAAAACAGCAGGAAAAGTCCAGG - Intronic
1008241630 6:49120064-49120086 GAAAAAAGTATGAAAACCGATGG + Intergenic
1008533949 6:52492433-52492455 CAAAACAGAAATAAAACTTCAGG - Exonic
1009334481 6:62469524-62469546 GAAGACAGTAAGGAAGCAGCAGG + Intergenic
1009499845 6:64397419-64397441 GAAAACACAAAGAAAATTTCAGG - Intronic
1009668126 6:66709272-66709294 GAAAAAAAGAAAAAAACTGCTGG - Intergenic
1010392495 6:75353679-75353701 AAAAACAGAAAGAAACCTACCGG - Exonic
1010483346 6:76380277-76380299 GAAAACAATAATAAAATGGCAGG - Intergenic
1010677859 6:78765289-78765311 TAAAAAAGTAAGAAAACTTCAGG + Intergenic
1011385623 6:86795230-86795252 AAAAAAAGAAAGAAAACTACAGG - Intergenic
1012056752 6:94422208-94422230 GAAAACAATAAGACACCTGAAGG - Intergenic
1012222105 6:96661347-96661369 CAACACAGAAAGAAAACTTCAGG + Intergenic
1012253370 6:97004924-97004946 AAAAAAAGAAAGAAAACTTCAGG - Intronic
1012255246 6:97023681-97023703 GAAAACAGTGAAAAGCCTGCTGG - Intronic
1012484994 6:99711222-99711244 GTGAACAGTAAGAAAGCTGTAGG + Intergenic
1013594218 6:111646303-111646325 GAAAAAAAAAAGAAAAATGCAGG - Intergenic
1013883264 6:114931218-114931240 GAAAACAGAAAAAAAAGAGCTGG - Intergenic
1013975454 6:116072861-116072883 AGAAATAGTAAGTAAACTGCTGG + Intergenic
1015946485 6:138506996-138507018 GTAATCTGTAAGAAAAATGCCGG - Intronic
1018518739 6:164618563-164618585 GAAAACAGAAAAAAAAATACAGG - Intergenic
1018632328 6:165831824-165831846 GAAAACAGTATTAAAAAGGCAGG - Intronic
1018648719 6:165972833-165972855 GAAAACAGTAATAAAATCCCTGG - Intronic
1018837423 6:167495835-167495857 GAAAAAACTAAGAAAGCTCCGGG - Intergenic
1018894828 6:168006580-168006602 GAGAACAGTTAAAAAAATGCTGG + Intronic
1019000996 6:168751908-168751930 GAAAATACTAAGAAATCTACAGG - Intergenic
1019038144 6:169079259-169079281 GAAAACAGTAAACAAAATGTTGG + Intergenic
1019204991 6:170353441-170353463 GAACAAAGAAAGAAAACTTCAGG + Intronic
1021230483 7:18081698-18081720 GAAAACAGAAAAAAAATTGAAGG - Intergenic
1021733922 7:23624128-23624150 GACCACAGTAACAAAACTCCAGG - Intronic
1021904925 7:25323789-25323811 GAAAACAGTTAGAAAAGAGAAGG - Intergenic
1023188216 7:37552896-37552918 TAATACAGTGAGAAAACTGAAGG - Intergenic
1023547518 7:41334220-41334242 GAAAACAGAATGAAGACAGCTGG - Intergenic
1023782697 7:43672212-43672234 AGACACAGTAAGAAAACTGCAGG + Intronic
1024276048 7:47678053-47678075 GGTAACAGTAAGAAAAATGGGGG + Intergenic
1025805353 7:64826203-64826225 TAAAACAGAAAAAAAACTACAGG - Intronic
1025964405 7:66254780-66254802 CAAAACATTAGGAAAGCTGCGGG - Intronic
1026169931 7:67945104-67945126 GAAAAGAGACAGAAAACAGCAGG - Intergenic
1026510611 7:71024428-71024450 GACTACACTTAGAAAACTGCTGG + Intergenic
1027473948 7:78606826-78606848 GAAAACATAAAGAAAATTGTGGG - Intronic
1027732414 7:81891651-81891673 GATAACATGAAGGAAACTGCAGG + Intergenic
1027784516 7:82564061-82564083 AAACACAGTAAGAAAACCACAGG + Intergenic
1027837558 7:83264556-83264578 GAAAACACAAAGCAAACTGATGG - Intergenic
1028260135 7:88654182-88654204 GAAAAGAATAAGAAAAATGATGG - Intergenic
1028419351 7:90614379-90614401 CAAAACTGAAAGCAAACTGCTGG - Intronic
1028571877 7:92298053-92298075 GAGAACAGAAAGAATACTGGAGG - Intronic
1028809405 7:95067343-95067365 TAAAACAGTCAGAAGACTCCAGG + Intronic
1028872677 7:95786440-95786462 GAAAACACTAACAACATTGCAGG - Intronic
1029022644 7:97381498-97381520 AAAAAAAGTAGAAAAACTGCTGG - Intergenic
1029128093 7:98309147-98309169 CAAAAAAGAAAGAAAACTGCTGG - Intronic
1029281801 7:99440033-99440055 GAAGACACAAAGAAAACTACTGG - Intronic
1030095561 7:105895545-105895567 CAAATCAGTAAGAAAAAGGCAGG + Intronic
1030250989 7:107444453-107444475 AAACAGTGTAAGAAAACTGCAGG - Intronic
1030476466 7:110039896-110039918 GAAAAAAAAAAGAAAACTACAGG - Intergenic
1030675102 7:112376132-112376154 GAAAACAGAAAGAAAACTGAAGG - Intergenic
1031020727 7:116625013-116625035 GAGAGTAGTAAGCAAACTGCAGG - Intergenic
1031022964 7:116648539-116648561 AAAAACAGAAATAAAAATGCTGG + Intergenic
1031783871 7:126004193-126004215 CAAAACAGAAACAAAACTGGAGG + Intergenic
1031965614 7:128026214-128026236 ATAAAAAGAAAGAAAACTGCAGG - Intronic
1032851239 7:135797414-135797436 GAAGGAAGGAAGAAAACTGCAGG - Intergenic
1033008614 7:137594679-137594701 GAATTCATGAAGAAAACTGCTGG - Intronic
1034001005 7:147413199-147413221 GAATTGAGTAAGAAAACAGCTGG + Intronic
1034220849 7:149445016-149445038 GGAAAGAATAAGAAAACTGAAGG - Intronic
1034246962 7:149652420-149652442 AAAAAAAGAAAGAAAACTACAGG + Intergenic
1034384720 7:150730941-150730963 GAAAACCGTAAGAATACGGAAGG + Intronic
1034816108 7:154173445-154173467 GAAAACAGAAATAAAAATCCGGG - Intronic
1035489975 7:159266879-159266901 CAACACAGAAAGAAAACTACAGG - Intergenic
1037342580 8:17862217-17862239 GAAAGCAGTAAGAAAAGCGAAGG - Intergenic
1038152065 8:24950869-24950891 GAATACTGAAAGAGAACTGCAGG + Intergenic
1038785206 8:30607940-30607962 CAATGCAGTAAGAAAACTGAAGG - Intronic
1038843556 8:31208492-31208514 TAAAAGAATAAGAAAACGGCCGG - Intergenic
1039050931 8:33492492-33492514 GAAAACACTGAGAAAACTCCAGG - Intronic
1039129070 8:34240828-34240850 GGAAACAGTAAGAAAATTGATGG + Intergenic
1039173496 8:34776944-34776966 CAAAACAAAAAGAAAACTCCAGG + Intergenic
1039192339 8:34990909-34990931 GAGAAAAGTAAGAAAGCTGCAGG + Intergenic
1040654474 8:49489980-49490002 GAAAACAGATACAAAACAGCAGG - Intergenic
1041768591 8:61447806-61447828 GAATACAGTAAGAAAACTATAGG - Intronic
1041824015 8:62071328-62071350 GAAAACATTAACAGAACTGGAGG + Intergenic
1042631243 8:70819240-70819262 GAAAACTGTAAGACATATGCAGG - Intergenic
1042725811 8:71875475-71875497 GTAACCAGTAACAAGACTGCTGG + Intronic
1042830481 8:73022356-73022378 GAAAACTGAAAGAAAATTGGAGG + Intronic
1042865949 8:73356820-73356842 GAAAACAATGAGACAGCTGCTGG - Intergenic
1043268490 8:78298681-78298703 GAAAACAGTAATAATACTCCAGG - Intergenic
1043848374 8:85187427-85187449 GAAAACATTAATAAATCTGAAGG - Intronic
1044279250 8:90337346-90337368 ACAAACAGTGAGAAAACTGATGG - Intergenic
1044796242 8:95901288-95901310 GAAAAAAGAAAGAAATCTGAAGG + Intergenic
1045340004 8:101245156-101245178 CAAAGCAGTTAGAAAGCTGCTGG - Intergenic
1045930573 8:107620853-107620875 GCAACCAGTAAGGAAAGTGCAGG - Intergenic
1045982288 8:108204638-108204660 GAAAACATAAATAAAACTGACGG + Intronic
1047686592 8:127311555-127311577 ATAAAAAGTAAGAAAAATGCCGG + Intergenic
1047933859 8:129755960-129755982 GAAAACAATAACAAAATGGCAGG + Intronic
1048548674 8:135412964-135412986 GAAAACAATAGAAAAAATGCTGG - Intergenic
1049609293 8:143546138-143546160 GATAACAGCAAGATAACAGCTGG + Intergenic
1050852735 9:10308151-10308173 GAAAACAGGAAAAACACTTCAGG - Intronic
1051017346 9:12494829-12494851 GCAACCAGTTAGAAAACTACAGG + Intergenic
1052113782 9:24623700-24623722 GAAAAAATTAAGAAAAATTCTGG - Intergenic
1052876019 9:33564697-33564719 GAAAACACAAAAAAAAGTGCTGG - Intronic
1054300348 9:63373830-63373852 GAAAACAGTAAGATAAACGCCGG + Intergenic
1054730739 9:68700517-68700539 AAGAACAATAAGAAAACTGGAGG - Intergenic
1055136735 9:72837732-72837754 GAAATCAGTAAGTCAACTGCAGG - Intergenic
1055169457 9:73237728-73237750 GAAAATAGTAAGAGAACACCAGG + Intergenic
1055326425 9:75135548-75135570 GGAAAAATTAAGAAAACTGAAGG - Intronic
1056307982 9:85309789-85309811 GAAAACATTTTGAAAACTGGTGG - Intergenic
1056952244 9:91050593-91050615 AAAATCAGTAAGAAAACAGCGGG + Intergenic
1057047362 9:91896785-91896807 GAAAGTAATAAGAAAAATGCAGG - Intronic
1057679413 9:97164345-97164367 GAAAACACAAAAAAAAGTGCTGG + Intergenic
1057691336 9:97289379-97289401 CAAAACAGGCTGAAAACTGCTGG + Intergenic
1059053759 9:110956973-110956995 CAACACAAAAAGAAAACTGCAGG + Intronic
1060535138 9:124380022-124380044 GAAAACAGCCAGAAAACAACAGG + Intronic
1062060697 9:134493776-134493798 GAAAAAGAGAAGAAAACTGCAGG - Intergenic
1062657231 9:137610386-137610408 GAAAAAAAAAAGAAAAATGCTGG - Intronic
1185985729 X:4830850-4830872 GAAAATAGGCAGAAAAATGCAGG + Intergenic
1186121997 X:6373418-6373440 TAATACAATAAGTAAACTGCGGG - Intergenic
1187872617 X:23777074-23777096 GAAAACAAAATGACAACTGCTGG + Intergenic
1187983087 X:24780141-24780163 GAAAAGAAAAAGAAAACTACAGG - Intronic
1188732437 X:33666867-33666889 CAAAACAGGAAGGAAACAGCAGG + Intergenic
1188999974 X:36933548-36933570 GAAAACAGGAGGAAAAAGGCGGG - Intergenic
1189109761 X:38276678-38276700 GAAAGCAAGAAGAAAACTGTGGG - Intronic
1189266978 X:39724645-39724667 CATAACAGTAAAAAAATTGCAGG + Intergenic
1191607672 X:63079921-63079943 GAAAAAAGTAAGAAAACTACAGG + Intergenic
1191655536 X:63593801-63593823 GAAAAGAATAAGAAACCTGGAGG + Intergenic
1192634397 X:72804131-72804153 GAGAACAGTCGGAAGACTGCTGG - Intronic
1192647313 X:72916670-72916692 GAGAACAGTCGGAAGACTGCTGG + Intronic
1192720110 X:73686332-73686354 TAAAACAGAAAAAAAACTGAAGG - Intronic
1193096704 X:77556437-77556459 GAAGAGAGAAAGAAAACTACTGG + Intronic
1193267588 X:79490813-79490835 GAAAAGAATAACAAAATTGCAGG + Intergenic
1193579029 X:83239543-83239565 GAAAAGAAAAAGAAAACTACAGG + Intergenic
1193632153 X:83902999-83903021 AAAAACCCTAAGAAAACTGGGGG + Intergenic
1194903057 X:99538724-99538746 GAAAACAGTAACAAATATGGGGG + Intergenic
1194946676 X:100076483-100076505 GTAAAGAATAAGAAAACTGTGGG - Intergenic
1195404615 X:104499306-104499328 CAAAAAAGAAAGAAAAATGCAGG - Intergenic
1195888377 X:109666378-109666400 AGAAACAGTAAGAAGACTGGTGG + Intronic
1195934476 X:110111806-110111828 GAAATCAGTTAGAAAGCTGGTGG + Intronic
1196142455 X:112279059-112279081 AAAAACAATAAGAAAACTGAAGG + Intergenic
1196197358 X:112850261-112850283 GGAAACAGTAATTAAAATGCTGG - Intergenic
1196499935 X:116368354-116368376 GAAAAAAAAAAGAAAATTGCTGG + Intergenic
1196707667 X:118729674-118729696 TAAAGCAGCTAGAAAACTGCTGG - Intronic
1196745023 X:119063954-119063976 GATAAAAGAAAGAAAAATGCTGG - Intergenic
1197142087 X:123129201-123129223 GAAAAAAAAAAGAAAACTTCAGG + Intergenic
1197931567 X:131701600-131701622 GAAAATATAAACAAAACTGCTGG + Intergenic
1199339932 X:146665708-146665730 GAAAAAAGAAAGAAAACTGTAGG + Intergenic
1199381629 X:147179006-147179028 GAAAACATTAAAAAATCGGCTGG - Intergenic
1199384862 X:147212439-147212461 CAAAAGAGTAAGACAAGTGCCGG - Intergenic
1199479040 X:148277406-148277428 CAAAAAAGAAAGAAAACTTCGGG + Intergenic
1199945869 X:152666748-152666770 GAAAACATAAACAAAGCTGCAGG + Intergenic