ID: 948960069

View in Genome Browser
Species Human (GRCh38)
Location 2:241327966-241327988
Sequence TCACCTCAGCCTGAGACGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 375
Summary {0: 1, 1: 0, 2: 0, 3: 34, 4: 340}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948960064_948960069 16 Left 948960064 2:241327927-241327949 CCGGTAGTCACAGCTACTTGAGA 0: 31
1: 2510
2: 53653
3: 175471
4: 235980
Right 948960069 2:241327966-241327988 TCACCTCAGCCTGAGACGTCAGG 0: 1
1: 0
2: 0
3: 34
4: 340

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948960069 Original CRISPR TCACCTCAGCCTGAGACGTC AGG Intronic
900502062 1:3011226-3011248 ACACCTCAGTTTGGGACGTCTGG - Intergenic
900749142 1:4383130-4383152 TTGCCTCAGCCTGAGAAGTTTGG + Intergenic
901723443 1:11219128-11219150 TCACTTCAGCCTCAGAGGTGAGG + Intronic
901774804 1:11553192-11553214 TCACCACAGCCAGGGAAGTCTGG + Intergenic
902305016 1:15530271-15530293 TCACTTCAGCCTCAAACTTCTGG - Intronic
902395747 1:16131793-16131815 TCACCTCTGCCAGCGACGTGTGG - Exonic
902909454 1:19584456-19584478 TCATCTGAGCCTGGGAGGTCAGG + Intergenic
903478942 1:23639233-23639255 TCACCTCAGCCTTTGCAGTCTGG - Exonic
903787423 1:25870552-25870574 TCACCTCTGCATGAGACTTACGG + Intronic
904726365 1:32551335-32551357 TCACTTGAGCCTGAGAGGTCAGG + Intronic
905052445 1:35063380-35063402 TCACCACAGCCTCAGACTCCTGG + Intronic
905633105 1:39530095-39530117 TCACCTAAGCCTCAGAGGTGAGG - Intergenic
906815329 1:48872971-48872993 TCACCTCAGGCTGAGCCTTTGGG + Intronic
907358081 1:53892798-53892820 TCACCTCAGCCAGAGTAGTTAGG - Intronic
908593867 1:65664416-65664438 TCACTTCAGCCTGGGAGGTCAGG - Intergenic
910913934 1:92269001-92269023 TCACCTGTGCCTGGGAGGTCTGG - Intronic
910933699 1:92467881-92467903 TCACCTGAGCCAGGGAGGTCAGG + Intergenic
911226325 1:95309298-95309320 TCACCTCAGACAGAAATGTCAGG - Intergenic
911324162 1:96449925-96449947 TCACCTGAGCATGGGAGGTCAGG - Intergenic
914678575 1:149922955-149922977 TCACCTGAGCCTGGGAGGTTGGG + Intergenic
914772393 1:150700350-150700372 TCACTGCAGCCTGAAACTTCTGG + Intronic
915139619 1:153759159-153759181 TCACCTCAGCCTGGGACTACAGG - Intronic
915169408 1:153967564-153967586 TCACCTGAGCCCGGGAGGTCGGG + Intronic
916530837 1:165654614-165654636 TCACAGCAGCCTGAAACTTCTGG - Intronic
917926347 1:179792192-179792214 TCACTGCAGCCTCAGACTTCTGG + Intronic
917936913 1:179877470-179877492 TCACCACAGCCTCATACTTCTGG - Intronic
918065405 1:181097404-181097426 TCACCTCAGCATCAGGCATCTGG + Intergenic
920111832 1:203592416-203592438 TCAGCCCAGCCAGAGACGCCAGG - Intergenic
921088489 1:211819416-211819438 TCACTACAGCCTGAAACTTCTGG - Intronic
921145537 1:212352532-212352554 TCACCTGAGCCTGGGAGGTCAGG - Intronic
922490922 1:226015811-226015833 TCACCTGAGCCTGGGAGATCAGG + Intergenic
922520377 1:226245495-226245517 TCACCACAGCCTCAAACTTCTGG + Intronic
924055033 1:240116679-240116701 TCACTGCAGCCTCAGACTTCTGG - Intronic
924430723 1:243994326-243994348 TCACCGCAGCCTCAGACTCCTGG - Intergenic
924599982 1:245480192-245480214 TCACTTGAGCCTGGGAAGTCAGG + Intronic
1063660320 10:8031283-8031305 TCACTGCAGCCTCAGACTTCTGG + Intergenic
1064192691 10:13221382-13221404 TCACCTAAGCCTGGAAGGTCGGG + Intergenic
1065323536 10:24530819-24530841 TCACCTCAGCCTCAAACTCCTGG - Intronic
1069138613 10:64796608-64796630 TCACCTAAGCCAGAGACTTATGG - Intergenic
1069428937 10:68315710-68315732 TCACCTCTGACTGAGACCTAGGG + Intronic
1069863503 10:71485856-71485878 GCATCTCAGACTGAGACGCCTGG - Intronic
1071290223 10:84183728-84183750 TCACCTGAGCCTGGGAGGTGAGG - Intronic
1072492638 10:95922872-95922894 TCACTGCAGCCTCAGACTTCTGG + Intronic
1073113989 10:101080688-101080710 TCACCTGAGCCTGGGAAGTCGGG - Intergenic
1073297412 10:102449732-102449754 TCACCTGAGCCCGAGAGGGCGGG - Intergenic
1073616194 10:104998700-104998722 CCTCCTCTGCCTGAGACCTCTGG - Intronic
1074870829 10:117574708-117574730 GCAGCTCAGCCTCAGAAGTCCGG - Intergenic
1075761710 10:124862654-124862676 TCACTTCAGCCTGGGAGGTCAGG - Intergenic
1076787730 10:132759451-132759473 ACACCTCAGCCTGGGATTTCCGG + Intronic
1077011977 11:382979-383001 TCACCTGAGCCCGGGAGGTCAGG + Intergenic
1077109773 11:857097-857119 TCACCTCCACCGGAGACGGCAGG - Intronic
1077232894 11:1466185-1466207 TCACTGCAGCCTCAGACTTCCGG - Intergenic
1077693400 11:4370258-4370280 TGGCCTCAGACTGAGACTTCAGG + Intergenic
1078141302 11:8694985-8695007 TCACCGCAGCCTCAAACTTCTGG - Intronic
1078339697 11:10489898-10489920 TCACCTGAGGCTGAGAGTTCGGG - Intronic
1078489601 11:11756954-11756976 GCACCTCACTCTGAGAAGTCAGG + Intergenic
1079991463 11:27250888-27250910 TCACCTAAGCCCGCGAAGTCTGG + Intergenic
1080212698 11:29805477-29805499 CCACCTCAGCCTGAGTAGCCAGG + Intergenic
1081027369 11:38032533-38032555 TCACCTGAGCCTGGGAAGTTGGG + Intergenic
1083806276 11:65076198-65076220 TCACCTGAGCCTGGGAGGTCGGG - Intronic
1084277040 11:68057972-68057994 TCACTTTAGCCTGGGAAGTCAGG - Intronic
1084416356 11:69035212-69035234 TCACCTCAGCCTCAAACCTCGGG + Intergenic
1085216167 11:74834778-74834800 ACACCTCAGCCACAGACCTCCGG + Intronic
1085502630 11:77037826-77037848 TCACCTGAGCCTGGGAAGTGCGG + Intronic
1085685421 11:78617731-78617753 TCACTGCAGCCTCAGACTTCTGG - Intergenic
1085767180 11:79293430-79293452 TCACTGCAGCCTCAAACGTCTGG - Intronic
1086482823 11:87261694-87261716 TCACTGCAGCCTCAAACGTCTGG + Intronic
1088488601 11:110365538-110365560 TCACTTGAGCCTGGGAAGTCAGG - Intergenic
1088506560 11:110533045-110533067 TCACCGCAGCCTCAGACTCCTGG - Intergenic
1089080667 11:115773854-115773876 CCACCCCAGCCTGAGGCCTCTGG - Intergenic
1090598560 11:128345808-128345830 TCACCTTAGCCTTATATGTCAGG + Intergenic
1092051753 12:5475749-5475771 TCACCTGAGCCCAAGAGGTCGGG + Intronic
1092149880 12:6240523-6240545 TCACCTGAGCCTGGGAGGTCAGG + Intergenic
1092350320 12:7750921-7750943 TCACCTGAGCCTTAGAGATCAGG + Intronic
1092771236 12:11899047-11899069 TCACTGCAGCCTGAAACTTCTGG + Intergenic
1093826372 12:23695033-23695055 TCACCAGAGCCTGGGAAGTCGGG + Intronic
1094163397 12:27416886-27416908 TCACTTCAGCCTGAAACTTCTGG - Intronic
1095249476 12:39961571-39961593 TCACCACAGCCTTAAACTTCTGG + Intronic
1096080495 12:48829319-48829341 TCACCACAGCCTGATACAGCTGG + Intergenic
1096135880 12:49200256-49200278 TCACCTCAGGCTGGGAGTTCGGG - Intronic
1096157212 12:49347331-49347353 GCACCTGAGCCTGAGACCTGAGG - Exonic
1097748332 12:63324450-63324472 TCCCCACAGCCTCAGACTTCTGG + Intergenic
1097833459 12:64250115-64250137 TCACCTCAGCCTCATACCTGTGG + Intergenic
1099665220 12:85619779-85619801 TCACCACAGCCTCAGCCCTCTGG - Intergenic
1101242363 12:102851007-102851029 TCACTGCAGCCTCAGACTTCTGG - Intronic
1101866510 12:108524452-108524474 TCATCACAGCCTGCGACGCCTGG + Exonic
1102377560 12:112435101-112435123 TTGCCTGAGCCTGGGACGTCGGG - Intronic
1104016823 12:124967180-124967202 GCACCTCAGCCTGCCCCGTCAGG + Exonic
1104381586 12:128312388-128312410 TCACCTGAGCCTGGGAAGTTGGG - Intronic
1104883817 12:132091950-132091972 TCACTTGAGCCTGCGAGGTCGGG + Intronic
1105015651 12:132785393-132785415 TCGCCTCAGCCTGGGAGGTGAGG - Intronic
1107121836 13:36804559-36804581 CCACCTCAGCCTGGGACTACAGG + Intergenic
1109055672 13:57545020-57545042 TAACTTCAGCCTGATATGTCAGG - Intergenic
1110437581 13:75492558-75492580 TCACCACAGCCTCAAACTTCTGG - Intergenic
1110451841 13:75645436-75645458 TCACCGCAGCCTCAAACTTCTGG - Intronic
1110565439 13:76953054-76953076 TCACTTGAGCCTGAGAGGTTGGG + Intronic
1111964501 13:94847212-94847234 TCACCTGAGCCCGAGAGGTGAGG + Intergenic
1114158401 14:20133604-20133626 TCACCTGAGCCTGGGAAGTCAGG - Intergenic
1114832576 14:26163154-26163176 TCACCTGATCCTGGGAGGTCAGG - Intergenic
1115248554 14:31321269-31321291 CCACCTCAGCCTGAGACTACCGG + Intronic
1115894456 14:38070043-38070065 TCACCTGAGCTTGGGAGGTCGGG + Intergenic
1119426633 14:74539619-74539641 TCACTTGAGCCTGGGAGGTCAGG + Intronic
1119571059 14:75673011-75673033 TCACTGCAGCCTCAGACTTCTGG + Intronic
1121271732 14:92642185-92642207 TCACCTGAGCCTGGGAAGTTGGG - Intronic
1121520606 14:94583724-94583746 TCACCTTGGCCTGAGATGACAGG + Intronic
1121842767 14:97148317-97148339 TCACTTCAGCCTGAAACTCCTGG - Intergenic
1123215127 14:106802537-106802559 TCTCCTCAGCTGGAGAAGTCAGG - Intergenic
1124045318 15:26144190-26144212 TCACTGCAGCCTCAGACTTCTGG + Intergenic
1126172983 15:45709392-45709414 TCACCTCAGCCTGTGACGAAGGG - Intergenic
1127876817 15:63118846-63118868 TCACCTGAGCCTGGGAGGTTGGG + Intergenic
1127990862 15:64115646-64115668 TCACTTGAGCCTGGGAGGTCGGG - Intronic
1128163277 15:65438800-65438822 TCACCTGAGCCTGGGAGGTTGGG + Intergenic
1130073017 15:80665019-80665041 TCACTGCAGCCTCAGACTTCTGG - Intergenic
1130421565 15:83752945-83752967 ACTCCTCAGCCTGTGAAGTCAGG - Intronic
1132057344 15:98662324-98662346 TGACCTGAGACTCAGACGTCCGG - Intronic
1132153778 15:99480854-99480876 TCCCCTGAGCCTGAGCCATCTGG + Intergenic
1132492712 16:242297-242319 TCACTTCAGCCTGGGAGGTAGGG - Intronic
1132664937 16:1077235-1077257 TGACCTCAGCATGTGCCGTCTGG - Intergenic
1132764447 16:1527170-1527192 TCACCTGAGCCTGAGATTGCAGG + Intronic
1133606607 16:7393793-7393815 TCACCTTAGCCAGAGATGCCTGG - Intronic
1134047149 16:11109275-11109297 CCACCTCAGCCTGGGACCACAGG + Intronic
1135221714 16:20620467-20620489 CCACCTCAGCCTGGGACTACAGG + Intronic
1135463781 16:22667895-22667917 TCACTGCAGCCTCAGACTTCTGG + Intergenic
1135731531 16:24898889-24898911 TCACTGCAGCCTCAGACTTCTGG + Intronic
1135778505 16:25277958-25277980 TCACCTGAGCCTGGGAGGTGGGG + Intergenic
1135795295 16:25435596-25435618 TCACTTGAGCCTGGGAGGTCGGG - Intergenic
1135818522 16:25658329-25658351 TCACTTCAGCCTGATACCTCAGG + Intergenic
1137638424 16:50007658-50007680 TCACTTCAACCTGGGAGGTCAGG + Intergenic
1137644889 16:50065619-50065641 TCACCTCAGCCTCAAACTCCTGG + Intergenic
1138525502 16:57603811-57603833 TCACCTCCTCCTGTGACGCCTGG - Intergenic
1139415760 16:66807986-66808008 TCACCTGAGCCTGGGAAGTTGGG - Intronic
1139553932 16:67694077-67694099 TCGCCTCAGCCTCAGAGCTCGGG - Intronic
1139964660 16:70738679-70738701 TCACCTGAGCCTGAGGCCCCCGG - Intronic
1140213490 16:72989096-72989118 TCACCGCAGCCTCAAACTTCTGG - Intronic
1140269685 16:73454050-73454072 CCAGCTCAGCCTTAGACATCAGG + Intergenic
1141591099 16:85069283-85069305 TCACCACAGCCTCAAACTTCTGG + Intronic
1143858573 17:9871239-9871261 TCACCTTAGCCTGGGACTACAGG - Intronic
1145861856 17:28217754-28217776 TCACCTGAGCCTGGGAGGTCAGG - Intergenic
1146111415 17:30093428-30093450 TCATCACAGCCTGAGGCCTCTGG - Intronic
1147337152 17:39734013-39734035 TCACTTGAGCCTGAGAAGTTGGG - Intergenic
1148009594 17:44466128-44466150 CCACCTCAGCCTGGGAGGTATGG + Intronic
1148474420 17:47917725-47917747 CCACCTCAGCCTGAGTAGCCAGG + Intronic
1148592992 17:48830695-48830717 TCACCTGAGCCCGGGAGGTCGGG + Intergenic
1150269216 17:63851893-63851915 TCACCGCAGCCTCAGACTCCTGG - Intergenic
1150724309 17:67639046-67639068 TCACTGCAGCCTCAAACGTCTGG - Intronic
1150902137 17:69292022-69292044 TCACCTGAGCTTGGGAAGTCAGG + Intronic
1151860003 17:76753601-76753623 TCACCTGAGCCTGCGAGGTGGGG + Intronic
1153180737 18:2429992-2430014 TCACTTCAGCCTCAGACTCCTGG + Intergenic
1154343117 18:13520766-13520788 TCACCTGAGCCTGAGAGTTAGGG + Intronic
1155264229 18:24075597-24075619 TCACCTGAGCTTGGGAGGTCGGG + Intronic
1155268484 18:24116908-24116930 TCACCTGAGCCGGGGAGGTCTGG - Intronic
1157365725 18:47062307-47062329 TCACCGCAGCCTTAAACTTCTGG - Intronic
1157852029 18:51063495-51063517 TCACCTAAGTCTGGGAGGTCAGG - Intronic
1157930278 18:51814140-51814162 TCACTTCAGCCTCTGACTTCTGG + Intergenic
1158380728 18:56927245-56927267 TCAGCTCAGCAGGAGATGTCGGG - Intronic
1160570623 18:79815353-79815375 TCACTTGAGCCTGGGAGGTCAGG + Intergenic
1160936164 19:1596222-1596244 TCACCACAGCCTCAAACTTCTGG + Intergenic
1161021500 19:2013627-2013649 CCACCTCAGCCAGAGACCCCTGG - Intronic
1161518457 19:4710271-4710293 GGATCTCAGCCTGGGACGTCGGG + Intronic
1161692862 19:5747257-5747279 TCACTTGAGCCTGAGAGGTGGGG - Intronic
1162384941 19:10355215-10355237 TCACTGCAGCCTGAGACTCCTGG - Intronic
1162571316 19:11475387-11475409 TCACTTGAGCCTGAGAGTTCAGG - Intronic
1163581603 19:18142726-18142748 TCACTTCAGCCTCAGACTCCTGG + Intronic
1165524087 19:36338112-36338134 CCACCTCAGCCTGGGACTACAGG + Exonic
1165527151 19:36365873-36365895 TCACCTGAGCCTGGGAGGTCGGG + Intronic
1165683378 19:37796635-37796657 TCACTGCAGCCTGAGACTCCTGG - Intronic
1166870950 19:45870642-45870664 TCACCGCAGCCTCAGACTCCTGG + Intronic
1167240168 19:48338830-48338852 CCACCCCAGCCTGGGACATCCGG + Intronic
1167333785 19:48872535-48872557 TCATCTCACCCTCAGGCGTCGGG - Exonic
1167490126 19:49788029-49788051 TCACCTGAGCCTGGGAGGTCAGG - Intronic
1167500771 19:49846131-49846153 TCTCCGCAGCCTGTGACGTCAGG + Intergenic
1168262497 19:55204192-55204214 TCACCACAGCCTCCGCCGTCCGG + Intronic
1168329223 19:55556808-55556830 TCACTTAAGCCTGGGAGGTCAGG - Intergenic
1168557658 19:57356592-57356614 TCACCTCAGCATGAGTCATCTGG - Exonic
1168719400 19:58546611-58546633 TGACCTTTGCCTGGGACGTCTGG - Intronic
927891357 2:26751954-26751976 CCACCTCAGCCTGGGACTACAGG + Intergenic
929128865 2:38546387-38546409 TCACTGCAGCCTGAAACTTCTGG + Intergenic
929475262 2:42240638-42240660 TAACCTCATCCTTAGACTTCAGG + Intronic
930128346 2:47822009-47822031 TCACAGCAGCCTCAGACTTCTGG - Intronic
930381869 2:50640041-50640063 TCACCTTAGCCTGAGATGCCTGG - Intronic
931799338 2:65743173-65743195 TCACCTCTGCCTGTGATGCCTGG - Intergenic
932133555 2:69208985-69209007 TCACTGGAGCCTGAGAGGTCGGG - Intronic
932186894 2:69705209-69705231 TCACTGAAGCCTGAGAAGTCTGG + Intronic
932590703 2:73065173-73065195 TCACTGCAGCCTCAGACTTCTGG + Intronic
933672303 2:85020539-85020561 CCACCTCAACCTGAGAAGTAGGG + Intronic
937208935 2:120254760-120254782 TCACCTGAGCCTGGGAGGTGGGG - Intronic
938839128 2:135141297-135141319 TCACTGCAGCCTGAGTCTTCCGG + Intronic
939691851 2:145273117-145273139 TCACTTGAGCCTGAGAGGTCAGG - Intergenic
940816785 2:158305667-158305689 TCACTTGAGCCTGGGACATCTGG + Intronic
941393227 2:164942348-164942370 TCACCTGAGCCCGGGAGGTCAGG + Intronic
942016625 2:171823868-171823890 TCACCTGAGCCGGGGAGGTCAGG + Intronic
942503531 2:176617497-176617519 TCACTGCAGCCTGAGACTCCTGG - Intergenic
942575127 2:177355276-177355298 TCACCTGCGCCTGACAGGTCAGG - Intronic
945082333 2:206098620-206098642 TCACTTGAGCCTGGGAGGTCGGG - Intergenic
946572633 2:221041475-221041497 TCACCGCAGCCTCAAACCTCTGG - Intergenic
947418813 2:229922939-229922961 TCACCTCAGCGTGAGAAGGAGGG + Intronic
947650745 2:231784405-231784427 TCACCTCAGCCTTGAACTTCTGG - Intronic
948000898 2:234566444-234566466 TCATCTCAACCTCAGATGTCTGG - Intergenic
948089253 2:235278562-235278584 TCACTTGAGCCTGAGAGGTGGGG - Intergenic
948693687 2:239722213-239722235 TCCCCACAGCCTGAGAGGTGCGG + Intergenic
948704775 2:239782101-239782123 ACACCTCAGTCTCAGACTTCTGG + Intronic
948960069 2:241327966-241327988 TCACCTCAGCCTGAGACGTCAGG + Intronic
1168904248 20:1391357-1391379 GCACCTGAGCCTGGGAGGTCTGG - Intronic
1169086647 20:2830081-2830103 TCACCACAGCCTCAAACTTCTGG + Intergenic
1169430730 20:5533839-5533861 TCACCTGAGCCTGGGAAGTTGGG + Intergenic
1169503027 20:6179736-6179758 TCACTTCAGCCTGACACCACTGG + Intergenic
1171990581 20:31693371-31693393 TCACTTCAGCCTCAAACCTCTGG - Intronic
1172121966 20:32603806-32603828 TCACTTGAGCCTGGGAGGTCGGG - Intronic
1172411838 20:34730151-34730173 TCACTTGAGCCTGGGAGGTCAGG - Intronic
1172577816 20:36022741-36022763 CCACCTCAGCCTGGGACTACAGG + Intronic
1172772149 20:37388129-37388151 TCACCCCAGTCTGAGACGCTTGG - Intronic
1172832128 20:37844861-37844883 TCACTTGAGCCTGAGAGGTAAGG + Intronic
1173754045 20:45499225-45499247 TCACTGCAGCCTGAAACTTCTGG - Intergenic
1174171174 20:48619072-48619094 CCACCTCAGCCTGGGACCACAGG + Intergenic
1175678445 20:60967033-60967055 TAATCTCAGCCAGAAACGTCCGG + Intergenic
1177627972 21:23689185-23689207 TCACTTCAGCCTGGCAGGTCGGG + Intergenic
1177679942 21:24353782-24353804 TCACCGCAGCCTCAGCCGCCTGG - Intergenic
1179166220 21:38937181-38937203 TCAGGTCAGCCTGAGGCGGCAGG + Intergenic
1179993698 21:44962835-44962857 TCTCCTCAGCCTCGGCCGTCTGG + Intronic
1181476949 22:23174327-23174349 TCACTGCAGCCTTAGACGCCTGG - Intergenic
1181503487 22:23334187-23334209 TCACTTGAGCCTGGGAAGTCAGG - Intergenic
1181654048 22:24280660-24280682 TCACTTGAGCCTGGGAAGTCAGG - Intronic
1181708477 22:24664418-24664440 TCACTTGAGCCTGGGAAGTCAGG - Intergenic
1181770087 22:25118933-25118955 TCACCACAGCCTGGAACGTCGGG - Intronic
1181882798 22:25994389-25994411 TCACCACAGCCTCAAACTTCTGG - Intronic
1182601634 22:31469765-31469787 TCACTGCAGCCTGAAACTTCTGG + Intronic
1183315303 22:37133751-37133773 TCACCACAGCCTGAGGCCCCAGG + Intronic
1184176938 22:42794006-42794028 TCACCCCAGCCTGGGACAGCCGG - Intergenic
1184297418 22:43533697-43533719 TCAGGTCAGCATGAGACGCCAGG - Intronic
949512854 3:4781896-4781918 TCACTTGAGCCTGGGAGGTCAGG + Intronic
950514082 3:13452742-13452764 TCACTGCAGCCTCAGACTTCTGG + Intergenic
950780143 3:15384662-15384684 TCACCTCAGCCTGGAACTCCTGG - Intronic
951026701 3:17838895-17838917 TCACCTGAGCCCCAGAAGTCAGG - Intronic
953702689 3:45209193-45209215 TCACTTGAGCCTGGGAAGTCGGG - Intergenic
953716900 3:45323395-45323417 CCACCTCAGCCTGGGACTTTAGG - Intergenic
954361366 3:50124478-50124500 TCACCACAGCCTGACTAGTCTGG - Intergenic
954375457 3:50192041-50192063 TCACCTGAGGCAGAGCCGTCTGG - Intronic
954945183 3:54417869-54417891 TCACCTGAGCCTGGGAGGTCCGG - Intronic
955075651 3:55610592-55610614 CCACCTCAGCCTCAGCCTTCCGG - Intronic
955807151 3:62748790-62748812 TCACTTGAGCCTGGGAAGTCAGG - Intronic
956828410 3:73020583-73020605 TCACTTGAGCCTGGGAGGTCAGG + Intronic
958187382 3:90139412-90139434 TCACCGCAGCCTTAAACTTCTGG - Intergenic
960097434 3:113701641-113701663 TCACCACAGCCCGAAACTTCTGG - Intergenic
960424012 3:117483898-117483920 TCACCTAAGCCTGGGAAGTCAGG + Intergenic
961282471 3:125774836-125774858 TCACGGCCGCCTGGGACGTCAGG - Intergenic
961846839 3:129772232-129772254 CCACCTCAGCCTGGGACCACAGG - Intronic
962422554 3:135241203-135241225 TCACTTCAGCCAGCGACGTTTGG + Exonic
963161035 3:142150395-142150417 TCACCTGAGACTGGGAAGTCAGG - Intergenic
965276840 3:166694738-166694760 TCACCTGAGCCTGGGAGGTGAGG - Intergenic
966405024 3:179587743-179587765 CCACCTCAGCCTGGGACTCCAGG - Intronic
966830738 3:184006165-184006187 TTACCTCAGCCGGAGATCTCTGG + Intronic
967938070 3:194745293-194745315 TCACCCCAGCCTGAGAGGCTTGG - Intergenic
968158080 3:196399970-196399992 TCACCTGAGCCTAAGAGTTCTGG + Intronic
968281153 3:197477742-197477764 TCACTTGAGCCTGGGAGGTCGGG - Intergenic
968681155 4:1920961-1920983 TCACCACAGCCTTAAACTTCTGG - Intronic
968875570 4:3265761-3265783 TCACCTGAGTCTGGGATGTCAGG + Intronic
968879055 4:3289285-3289307 TCACTTGAGCCTGAGAAGTGAGG - Intergenic
969808397 4:9628430-9628452 TCACCACAGCCTTAAACATCTGG + Intergenic
970930452 4:21505506-21505528 TCCCCTCTGCCTGGGACTTCTGG + Intronic
971773585 4:30930862-30930884 TCACTGCAGCCTGGGACTTCTGG - Intronic
972478731 4:39477857-39477879 TCACCTCAGCCTGAGTAGCTGGG - Intergenic
972519926 4:39844073-39844095 TCACCGCAGCCTCAGACTCCTGG - Intronic
972663867 4:41145033-41145055 TCACTACAGCCTGGGAAGTCGGG + Intronic
973300413 4:48576387-48576409 TCACTTGAGCCTGAGAGGTGGGG - Intronic
973309667 4:48694947-48694969 TCACCTTAGCCTGGGACTACAGG - Intronic
974038846 4:56840754-56840776 TCACCACAGCCTCAAACTTCTGG + Intergenic
974113153 4:57548717-57548739 TCATCTGAGCCTGGGACGTCAGG + Intergenic
978136139 4:105262952-105262974 TCACCGCAGCCTCAGACTCCTGG - Intronic
978459032 4:108929749-108929771 TCACCTCAGCCTCAAACTCCTGG - Intronic
979731567 4:124029457-124029479 TCACTTGAGCCTGAGAGGTTGGG - Intergenic
980490190 4:133514665-133514687 TCACATGAGCCTGGGAGGTCAGG + Intergenic
982261317 4:153496640-153496662 TCACCTGAGCCTGAGAGGTGGGG - Intronic
984116576 4:175688925-175688947 TCACCACAGCCTCAAACCTCTGG + Intronic
984230407 4:177090905-177090927 TCACTTGAGCCTGGGACGTCAGG - Intergenic
984414544 4:179440016-179440038 TCACCGCAGCCTCAAACCTCTGG - Intergenic
984419552 4:179502703-179502725 TCACTTCAGCCTGGGAGATCAGG - Intergenic
984679827 4:182594448-182594470 TCACCACAGCTTCAGACTTCTGG - Intronic
984799516 4:183700920-183700942 TCACTGCAGCCTCAGACTTCTGG + Intronic
986770680 5:10970054-10970076 TCACCTCCACCTCAGACGGCAGG - Intergenic
986845261 5:11744857-11744879 CCACCTCAGCCTGGGACTACAGG + Intronic
988645931 5:33095104-33095126 TCACTTGAGCCTGAGAGGTAGGG - Intergenic
990943350 5:61226252-61226274 TCACTTGAGCCTAAGAGGTCAGG - Intergenic
992087293 5:73289344-73289366 TCACCTCTGCCTCAGTCCTCAGG + Intergenic
992793187 5:80232015-80232037 TCACTTCAGCCTGAGGGTTCAGG + Intronic
992985818 5:82228120-82228142 TCGCTTGAGCCTGAGAGGTCAGG + Intronic
994674033 5:102799344-102799366 CCACCTGAGCCTGATACATCTGG - Intronic
996768448 5:127059641-127059663 TCACCTGAGCCTGGGAAGTTGGG + Intronic
997555460 5:134794034-134794056 TCACTTCAGCTTGAGAGGTCCGG + Intronic
998050588 5:139029862-139029884 CCACCTCAGCCTGAGTAGTTAGG - Intronic
998214191 5:140225105-140225127 TCACCTCAGCGTCAAACTTCTGG - Intronic
998368974 5:141649272-141649294 GCACCTCAGCCTGCGCCCTCTGG + Exonic
998643139 5:144034798-144034820 TCACTTGAGCCTGAGAGGTGAGG - Intergenic
998868801 5:146532436-146532458 TCACTGCAGCCTGAAACTTCAGG - Intergenic
1002515115 5:179751917-179751939 TCATCTGAGCCTGGGAGGTCAGG + Intronic
1004880674 6:20004214-20004236 TCACCTTGGCCTCAGACTTCTGG + Intergenic
1005722582 6:28617363-28617385 TCACCTGCGCCTAAGAGGTCGGG - Intergenic
1006297878 6:33178098-33178120 TCACCTCAGGGTCAGAAGTCAGG + Intronic
1009984301 6:70764882-70764904 TCACCTGAGCCTGGAAAGTCAGG - Intronic
1010112746 6:72260055-72260077 TCAACTCAAGCTGAGATGTCTGG - Intronic
1010370221 6:75098572-75098594 TCACTTGAGCCCGAGAGGTCAGG + Intronic
1011273062 6:85599693-85599715 CCACCTCAGCCTGGGACCACAGG - Intronic
1011841866 6:91510881-91510903 TCACCTGAGCCCGGGAAGTCAGG + Intergenic
1012472960 6:99591101-99591123 TAAACTCGGCCTGAGACGTGGGG + Intergenic
1013114829 6:107094903-107094925 TCGCCTGAGCCTGGGAGGTCGGG - Intronic
1014236052 6:118956290-118956312 TCACTGCAGCCTCAGACGCCTGG + Intergenic
1015010780 6:128344598-128344620 TCACCTGAACCTGGGAGGTCAGG - Intronic
1015470342 6:133598250-133598272 TCACTTTAGCCTGAAACTTCTGG - Intergenic
1017475515 6:154787271-154787293 TCATTTGAGCCTGAGAGGTCGGG + Intronic
1018312563 6:162525936-162525958 TCACCTGAGCCTGGGAGGTCGGG - Intronic
1019850497 7:3551748-3551770 TCACCGCAGCCTGAGACTCGTGG + Intronic
1020667895 7:11070160-11070182 TCACCTGAGCCTAAGAGTTCAGG - Intronic
1021114644 7:16733825-16733847 TCACTTGAGCCTGGGAGGTCAGG + Intergenic
1021622788 7:22564619-22564641 TAGCCTAAGCCTGAGAAGTCTGG - Intronic
1021921831 7:25493005-25493027 TCAGCTCAGTCTGAAACATCAGG + Intergenic
1023592253 7:41792745-41792767 TCACTGCAGCCTGAAACTTCTGG + Intergenic
1024370067 7:48572391-48572413 TCACCACAGCCTCAAACATCTGG + Intronic
1029068202 7:97873005-97873027 TCACCTCAGCCTCAAACGCCTGG - Intergenic
1029092705 7:98060741-98060763 TCACTTCAGCCTCAGACTCCTGG + Intergenic
1029796312 7:102898413-102898435 TCACCGCAGCCTCAGACTACAGG + Intronic
1030315930 7:108114352-108114374 TCACCTGAGCCTGGGAGGTTGGG + Intronic
1030532937 7:110732858-110732880 TCACCGCAGCCTCAAACTTCAGG + Intronic
1031995945 7:128231017-128231039 TCACCTGAGCCTGGGAGGTTGGG + Intergenic
1032677427 7:134144249-134144271 TCACCTCAGCCTGAGTAGCTGGG + Intronic
1033206654 7:139429056-139429078 TCACCTCAGCCTGGGATTACAGG - Intergenic
1034352099 7:150423049-150423071 TCACCGCAGCCTCAAACTTCTGG - Intergenic
1035714379 8:1742773-1742795 TCGCTTGAGCCTGGGACGTCAGG + Intergenic
1036793043 8:11735994-11736016 TCACTTGAGCCTGGGACTTCAGG - Intronic
1037413619 8:18623563-18623585 TCACTGCAGCCTCAGACTTCTGG - Intronic
1037767926 8:21783184-21783206 AGACCTCAGTCTAAGACGTCAGG + Intronic
1038322015 8:26536004-26536026 TCACCTGAGCCTGGGAAGTTGGG - Intronic
1038421983 8:27439369-27439391 TCACGACAGCCAGTGACGTCTGG + Exonic
1038495776 8:28001173-28001195 TCACCTCAGCCTGGGACTACAGG + Intergenic
1038944600 8:32344514-32344536 TCACCTGAGCTTGTGAAGTCGGG - Intronic
1040433121 8:47363451-47363473 CCACCTCAGCCTGAGATTACAGG + Intronic
1041244002 8:55873878-55873900 TCACTTGAGCCTGAGAGGTGAGG + Intergenic
1041487139 8:58391915-58391937 ACACCTCAGCTTTAGACTTCTGG + Intergenic
1042541788 8:69914814-69914836 TCGCCAGAGCCTGAGAGGTCAGG + Intergenic
1042546766 8:69957996-69958018 TCACCTGAGCATGGGAGGTCAGG - Intergenic
1043404194 8:79914253-79914275 TCACCTCAGCATGACACTGCTGG - Intergenic
1043794979 8:84524768-84524790 CCACCTCAGCCTGATATTTCCGG + Intronic
1045081524 8:98630556-98630578 TCACTTGAGCCTGGGAGGTCAGG + Intronic
1046931724 8:119848086-119848108 TCACCTCATCCTGGGACTACAGG + Intronic
1048573547 8:135673742-135673764 TCACCTCAGCCTCAGACCCAGGG - Intergenic
1048578405 8:135710799-135710821 TCACCACAGCCTGGAACGCCTGG + Intergenic
1049833319 8:144716179-144716201 TCACTGCAGCCTCAGACTTCTGG + Intergenic
1051464843 9:17365859-17365881 TCACCTGAGCCTGGGAGGTAGGG + Intronic
1051628072 9:19117243-19117265 TCACCTAAGCCCGAGAGGTCGGG - Intronic
1051644346 9:19252505-19252527 TCACCACAGCCTTAGACTCCTGG - Intronic
1053488184 9:38477830-38477852 TCACTTGAGCCTGGGAGGTCAGG + Intergenic
1055560005 9:77513279-77513301 GCAGCTCTGCCTGGGACGTCAGG + Intronic
1055951614 9:81734734-81734756 TCACCTTAGCCTGGAACTTCAGG - Intergenic
1057668545 9:97067109-97067131 TCACTTGAGCCTGGGAGGTCAGG + Intergenic
1059228151 9:112692367-112692389 TCACCTGAGCCTGGGAGGTTGGG - Intronic
1060140647 9:121206860-121206882 CCACCTCAGCCTGGGACCACAGG + Intronic
1060706694 9:125808579-125808601 TCACTTGAGCCTGGGAGGTCAGG + Intronic
1062629472 9:137457454-137457476 CCACCTCTGCCTGAGACCTCCGG - Exonic
1185514381 X:688140-688162 TCACTTGAGCCGGAGAAGTCGGG + Intergenic
1186997386 X:15138446-15138468 TCACTCCAGCTTGAGACCTCTGG + Intergenic
1188473841 X:30569211-30569233 TCATCCCAGCCTGAGATGACTGG + Intronic
1189685118 X:43555805-43555827 TCACCTGAGCCTGGGAGATCAGG + Intergenic
1189757657 X:44286949-44286971 TCACTGCAGCCTGAGACTCCTGG - Intronic
1190635152 X:52425870-52425892 TCACTTCAGCCTGGGAGGTTAGG + Intergenic
1192171585 X:68858888-68858910 TCACCACAGCCCCAGAAGTCAGG - Intergenic
1193194304 X:78612051-78612073 TTACCTGAGCCTGGGAAGTCGGG - Intergenic
1193508280 X:82370065-82370087 CCACCTAAGCCAGAGACGTCTGG - Intergenic
1193859067 X:86641257-86641279 TCAGCTCTGCCTGACACGTTAGG - Intronic
1193986976 X:88254339-88254361 TCACCTCAGCCTCAAACTGCTGG + Intergenic
1194154632 X:90371886-90371908 TATCCTCAGCCTGAGACAACAGG + Intergenic
1194662395 X:96641381-96641403 TCACCTAAACCTGGGAGGTCAGG - Intergenic
1197193233 X:123672221-123672243 TCGCTTGAGCCTGAGAGGTCAGG - Intronic
1197454692 X:126664787-126664809 TCACTGCAGCCTCAAACGTCTGG + Intergenic
1199622499 X:149713108-149713130 GCACCTCAGTTTGAGACGGCGGG - Intronic
1199857102 X:151768350-151768372 TCACCCCAGCCTGTGTCCTCAGG + Intergenic
1200500984 Y:3948772-3948794 TACCCTCAGCCTGAGACAACAGG + Intergenic
1202599681 Y:26580686-26580708 TCACCTGAGCCTGGGAGGTTGGG - Intergenic