ID: 948963749

View in Genome Browser
Species Human (GRCh38)
Location 2:241360010-241360032
Sequence GCAGCTGGAGGGAGACAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1262
Summary {0: 1, 1: 0, 2: 8, 3: 125, 4: 1128}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948963749_948963759 17 Left 948963749 2:241360010-241360032 CCTCCCTGTCTCCCTCCAGCTGC 0: 1
1: 0
2: 8
3: 125
4: 1128
Right 948963759 2:241360050-241360072 CCCTCACTTTACTCACTCCAAGG 0: 1
1: 0
2: 0
3: 17
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948963749 Original CRISPR GCAGCTGGAGGGAGACAGGG AGG (reversed) Intronic
900153946 1:1196581-1196603 GCTTCTGCAGGGAGGCAGGGAGG - Exonic
900532032 1:3159169-3159191 GAGGCTGGAGGTACACAGGGCGG + Intronic
900662244 1:3790583-3790605 GCAGCGGGAAGCAGCCAGGGAGG + Intronic
900725832 1:4215932-4215954 GCAGGTGGAGGTAGAGAGGCAGG - Intergenic
900859485 1:5217925-5217947 GCAGCTGGAGGGAGCCTTGCAGG + Intergenic
900974953 1:6011202-6011224 GGAGCAGGAGGGAAACAGGCAGG + Intronic
901059424 1:6465298-6465320 GGAGCTGGAGAGAAAGAGGGAGG - Intronic
901209218 1:7515077-7515099 CCAGGTGGAGGGAGCCGGGGAGG - Intronic
901209231 1:7515115-7515137 CCAGGTGGAGGGAGCCGGGGAGG - Intronic
901209244 1:7515153-7515175 CCAGGTGGAGGGAGCCGGGGAGG - Intronic
901231574 1:7644531-7644553 CCACCCGGAGGGAGCCAGGGTGG - Intronic
901529093 1:9842603-9842625 GCAGCTGGACTCAGAGAGGGCGG - Intergenic
901546358 1:9960806-9960828 GCACCTGGAGCAAGACAAGGAGG + Intronic
901776038 1:11561011-11561033 GCAGGTGGGGAGAAACAGGGTGG + Intergenic
902233411 1:15042749-15042771 CCAGATGGTGAGAGACAGGGAGG - Intronic
902362831 1:15951424-15951446 GCAGCTCGAGGGGGCCAGGAGGG + Intronic
902481026 1:16711961-16711983 GCAGTGGGAGGGAGGGAGGGAGG - Intergenic
902571325 1:17348802-17348824 GCAGGGAGAGGGAGGCAGGGCGG - Intronic
902694776 1:18132903-18132925 GCAGGTGGAGGGAGTGGGGGAGG + Intronic
902801294 1:18831833-18831855 GCCGTGGGAGTGAGACAGGGTGG - Intergenic
902873470 1:19327540-19327562 ACAGATGGAGGGAGGGAGGGAGG - Intronic
903140918 1:21338793-21338815 GCAGCTGGAGGGAGTCAGGCAGG + Intronic
903570113 1:24297958-24297980 GCAGCTGGAGGAGGAGAAGGAGG + Intergenic
904327457 1:29736569-29736591 GCAGTTGTGGGGAAACAGGGAGG - Intergenic
904454103 1:30636575-30636597 GCTGCTGCAGGGAGAGTGGGTGG + Intergenic
904454405 1:30638743-30638765 ACAGGTGGAGGGAGGCAGTGTGG - Intergenic
904858790 1:33519750-33519772 GGCCCTGGAGGGAGAGAGGGAGG + Intronic
904970905 1:34418742-34418764 GCAGTAGGAGTGATACAGGGTGG - Intergenic
905112131 1:35603371-35603393 GGAGCTGCAGAGAGACATGGAGG + Exonic
905112154 1:35603555-35603577 GCAGCTGGAGGATGACTGGGAGG + Intronic
905242547 1:36590133-36590155 GGAGCTGGAGGGAGGGTGGGTGG + Intergenic
905263959 1:36738485-36738507 CCTGCTGGAGGGAGACGGTGGGG + Intergenic
905353056 1:37360682-37360704 GGAGGAGGAGGGAGACAGGCTGG - Intergenic
905797261 1:40822766-40822788 GCAGCTGGTTGGAGAAAGTGTGG + Intronic
906070901 1:43015727-43015749 GCAGATGAAGGGAGAAATGGAGG - Intergenic
906096315 1:43226563-43226585 GCAGCAGAAGGGAGACTGTGTGG - Intronic
906151441 1:43590086-43590108 ACAGCTGGCGCGTGACAGGGTGG - Intronic
906215325 1:44034995-44035017 GCACCTGGAGGGAGGGAGTGGGG + Intergenic
906529154 1:46513252-46513274 GCAGGTGCAGGGAGGCAGGCAGG - Exonic
906545844 1:46618845-46618867 TCAGACGGAGGGAGAGAGGGAGG - Intergenic
906610479 1:47198455-47198477 GAGGCTGGAGGGAGTCAGTGTGG + Intergenic
907193564 1:52668389-52668411 GACGCTGGAAGGAGTCAGGGAGG - Intronic
907277044 1:53322476-53322498 GCAGCAGGAGGGTGAGAGTGTGG + Intronic
907290949 1:53412538-53412560 GCAGCGGGCAGGAGCCAGGGCGG - Intergenic
907305009 1:53508485-53508507 TCAGCTGGAGGAATTCAGGGAGG + Intronic
907494345 1:54833269-54833291 GCAGCTGAACAGAGACAGTGCGG + Intronic
907978241 1:59454638-59454660 TAATCTGGTGGGAGACAGGGAGG - Intronic
908123645 1:61008702-61008724 GCAGCTGGGGTGAGGCAGAGGGG + Intronic
909288732 1:73854911-73854933 AGAGCGGGAGGGAGAGAGGGAGG + Intergenic
909289513 1:73864603-73864625 GAGGCTGGAGGGTGACAGGAGGG + Intergenic
909379538 1:74982482-74982504 GCTGCAGGAGAGAGACAGTGAGG - Intergenic
909879748 1:80859573-80859595 ACAGCTTGTGGGAGGCAGGGTGG + Intergenic
910657895 1:89636705-89636727 GGATCTGGAGGGAAACAGGCAGG - Intronic
910694287 1:89995300-89995322 GCAGCTGGCAGGAGGCGGGGTGG + Intronic
911073669 1:93851971-93851993 GGAGGGGGAGGGAGAGAGGGAGG + Intergenic
911133816 1:94418386-94418408 GCAGCGCGGGGGAGACTGGGAGG - Intergenic
911549697 1:99264268-99264290 GCTGAGGGAGGGTGACAGGGAGG + Exonic
911925790 1:103830777-103830799 GCTGCTTGTGGGAGCCAGGGTGG - Intergenic
912002571 1:104853544-104853566 GCAACTTGAGGAAGACTGGGAGG - Intergenic
912465950 1:109873970-109873992 CCAGCTGGATAGGGACAGGGAGG - Intergenic
912516639 1:110220470-110220492 GCAGAGGGAGGGAGGGAGGGAGG - Intronic
912737642 1:112164394-112164416 GTGGGTGGAGGGAGAGAGGGTGG + Intergenic
912937467 1:114016159-114016181 GGAGCAGGAGGAAGACAGAGAGG + Intergenic
913686333 1:121235495-121235517 CCAACTGGAGGGATATAGGGAGG - Intronic
914038184 1:144023127-144023149 CCAACTGGAGGGATATAGGGAGG - Intergenic
914151268 1:145044815-145044837 CCAACTGGAGGGATATAGGGAGG + Intronic
914314638 1:146498628-146498650 GCACTTGGAGGGAGACAAGGAGG + Intergenic
914499712 1:148234760-148234782 GCACTTGGAGGGAGACAAGGAGG - Intergenic
914521943 1:148425582-148425604 GAAGCTGGTGGGAGTCATGGCGG - Intergenic
914705042 1:150163297-150163319 GCTCCTGTTGGGAGACAGGGAGG - Intronic
914817086 1:151071079-151071101 GCGGCGGGAGGGGGACGGGGAGG + Intronic
915196738 1:154195135-154195157 GAAGCTGGAGGAAGAGAGGCTGG + Intergenic
915701695 1:157802593-157802615 GGTGATGGAGGGAGACAGGCTGG - Exonic
916289271 1:163146651-163146673 GCAGGTGGAGGGGGCCAGTGAGG + Intronic
916415960 1:164592116-164592138 GAAGCTGGAGGGAGGTGGGGAGG + Intronic
916500294 1:165381103-165381125 GCTGCAAGAGGAAGACAGGGAGG - Intergenic
916554815 1:165885106-165885128 ACAGGGGAAGGGAGACAGGGAGG - Intronic
916819714 1:168386599-168386621 GCAGCAGGAGAGAGAGAGGGTGG + Intergenic
916908878 1:169322362-169322384 GCAGTGGGAGGAAGATAGGGAGG + Intronic
916982180 1:170150161-170150183 GCAGTTGGAGGGAGGAAGGAAGG - Intronic
917020721 1:170583374-170583396 GCAGGTGGAGGCAGGCAGGCAGG + Intergenic
917122217 1:171654815-171654837 GGAGGTGGAGGGGGACAGGAAGG - Intergenic
917442173 1:175077757-175077779 GAAGCTGGAGGAAGAGATGGTGG + Exonic
917517730 1:175722039-175722061 ACACCTGGAGGGAGTGAGGGTGG - Intronic
917564378 1:176196935-176196957 CCAGCAGGAGGGAGGGAGGGAGG + Intronic
917889327 1:179419656-179419678 GGAGGGGGAGGGAGACAGAGAGG + Intronic
918215632 1:182390754-182390776 GCAGCTGGAGCGCGACCCGGAGG + Exonic
918318729 1:183345132-183345154 TCAGCTAGGGGGAGACAAGGTGG - Intronic
918446474 1:184622207-184622229 GAAGCTGGAAGGAGGAAGGGAGG + Exonic
919056956 1:192583060-192583082 GAAGAGGGAGGGAGAGAGGGGGG + Intergenic
919752151 1:201044357-201044379 GGAGCTGGAGAGAGCCATGGTGG - Exonic
919787429 1:201268713-201268735 GCTGCTGCAGGGAGGGAGGGCGG + Intergenic
919800956 1:201354348-201354370 GCAGCTGGAGGGCAGCAGAGAGG + Intergenic
919938281 1:202269279-202269301 GCAGCTTCAAGGAGAGAGGGAGG + Intronic
919990976 1:202708761-202708783 GCAGGTGGAAGGGGGCAGGGTGG - Intronic
920032917 1:203048265-203048287 GCAGCTGGAGGGACAGCTGGAGG + Intronic
920048001 1:203146035-203146057 GGAGCTGGAAGGAGGAAGGGAGG - Intronic
920215480 1:204359299-204359321 CCAGCAGGAAGGAGAGAGGGAGG - Intronic
920273945 1:204789963-204789985 GCTGCTGGTGGGTGGCAGGGAGG + Intergenic
920278937 1:204828972-204828994 GGAGCTGGACGGGGACGGGGTGG - Intronic
920284412 1:204869136-204869158 GGGGCTGGAGGGAGCCAGGGTGG + Intronic
920298727 1:204975614-204975636 GGAGCTGGTGGGAGAGAGGGAGG - Intronic
920337833 1:205257096-205257118 CCATCTGGCAGGAGACAGGGAGG - Intronic
920473655 1:206254048-206254070 CCAACTGGAGGGATATAGGGAGG - Intronic
920682876 1:208085885-208085907 GCAGCAGGAGGAAGACAGGCAGG - Intronic
920850282 1:209623761-209623783 GGAGCAGGAGGGAGAGGGGGTGG + Intronic
921049801 1:211502928-211502950 GCAGGTGGACAGAGCCAGGGAGG + Intergenic
921265454 1:213417561-213417583 GCGGCTGGAGGGAGGCAATGTGG + Intergenic
922605395 1:226887015-226887037 GCAGATGGTGGGAAGCAGGGTGG + Intronic
922702102 1:227767230-227767252 GCAGCTGCAGGGAGGGAGGAAGG + Intronic
922775610 1:228213094-228213116 GCAGCGGGAGGGAGAGGGCGGGG - Intronic
922789854 1:228305616-228305638 GCAGTGGGAGGGAAACAAGGTGG - Intronic
922824850 1:228510622-228510644 CCAGCAGGATGGAGTCAGGGCGG - Intergenic
922846739 1:228691417-228691439 GGAGTTGGAGGGAGGGAGGGAGG - Intergenic
923037184 1:230292462-230292484 GCAGGTTGAGAGAGAGAGGGAGG - Intergenic
923037208 1:230292604-230292626 GCAGGTTGAGAGAGAGAGGGAGG - Intergenic
923141063 1:231162095-231162117 GCGGCGGGAGGGAGGCGGGGAGG + Intronic
923276975 1:232405015-232405037 GCAGCCAGAGGGAGGCAGAGTGG - Intronic
923419766 1:233800905-233800927 ACAGCTTGAGGGAGAAGGGGAGG + Intergenic
923419840 1:233801924-233801946 TCACCTGGAGGGGAACAGGGGGG + Intergenic
923433942 1:233950617-233950639 ACATATGGAGGGAGAAAGGGTGG - Intronic
923653677 1:235897253-235897275 GAAGGAGGAGAGAGACAGGGAGG - Intergenic
1062890231 10:1053941-1053963 GCAGAAGGAGAGAGATAGGGAGG + Intronic
1063123984 10:3124177-3124199 GCTACTGGTGGGACACAGGGCGG - Intronic
1063371299 10:5524665-5524687 GCGGCAGGTGGGAGACGGGGAGG + Exonic
1063603924 10:7506671-7506693 GCAGCTGGAGCGAGAGTGTGGGG + Intergenic
1064021828 10:11815133-11815155 GCAGCTGCAGAGAGAAAGCGAGG - Intergenic
1065020062 10:21496105-21496127 GGAGGTGGAGGGAGGCAGGAAGG - Intronic
1065024500 10:21527212-21527234 GCAGCTGGAGGAAGGCGCGGCGG + Intergenic
1065167794 10:22998987-22999009 GCTTCTGTAGGGAGAAAGGGGGG + Intronic
1065870554 10:29952699-29952721 GGAGCAGGAGGGAGAGAGGAGGG + Intergenic
1065872356 10:29966443-29966465 GCAGGTGGAGGGAGAGAGTGAGG - Intergenic
1066047135 10:31603754-31603776 GCAGCGGGAGGGAGGTAGGCTGG - Intergenic
1066362801 10:34747619-34747641 TCAGATGGAGGGAGCCAGGCTGG - Intronic
1067067200 10:43110807-43110829 GCAGCTGGGAGCAGCCAGGGAGG + Intronic
1067087770 10:43251955-43251977 GCAGGAGCAGGCAGACAGGGAGG + Intronic
1067173304 10:43925001-43925023 GCAGCAGGAGGGATTCATGGTGG - Intergenic
1067428226 10:46225337-46225359 GCATGTAGAGGGAGACAGAGGGG - Intergenic
1067549902 10:47226954-47226976 GAGGCTGGAGGCAGCCAGGGAGG + Intergenic
1067833349 10:49622749-49622771 GAAGCTGGAAGGAGAGAGAGAGG + Intronic
1068763092 10:60733680-60733702 GCAGCTCCAGGAAGAGAGGGAGG + Intergenic
1068829189 10:61473416-61473438 AGAACTGGAGTGAGACAGGGAGG - Intergenic
1068945570 10:62725443-62725465 GCAGCTAGAGGCACAGAGGGAGG - Intergenic
1069680907 10:70284266-70284288 GCTTCGGGAGGGAGGCAGGGGGG + Intergenic
1069714414 10:70511420-70511442 GCAGCAGGATCGAGACAGGGAGG + Intronic
1069779009 10:70943237-70943259 GGAACTGAAGGGTGACAGGGAGG + Intergenic
1070154968 10:73827697-73827719 GCAGCTGGAGGGCAACTGTGTGG - Intronic
1070354375 10:75625497-75625519 GGGGTTGGAGGGAGTCAGGGTGG + Intronic
1070768870 10:79070841-79070863 GCAGCGGGAGGGAGGGAGGGAGG - Intronic
1072317818 10:94220927-94220949 GAAGCTGGAGGGAGGCAGCACGG - Intronic
1072550774 10:96475677-96475699 GTCCCTGGAGGGAGACATGGGGG - Intronic
1072555204 10:96509540-96509562 GCAGGAGGAATGAGACAGGGAGG - Intronic
1072617891 10:97061781-97061803 GGAGTTGGAGGGTCACAGGGTGG + Intronic
1072800346 10:98388448-98388470 GCAGCCAGGGGGAGCCAGGGTGG + Exonic
1072895386 10:99362140-99362162 GCAGCTGGGAGGAGTCAGAGTGG - Intronic
1072978315 10:100078466-100078488 GCAGCTGCAGGGAGACCAAGTGG - Intronic
1073148027 10:101293027-101293049 AGAGCTGGAGAGACACAGGGTGG - Intergenic
1073148836 10:101298127-101298149 GCAGCTGGAGGGAGGCCGAGGGG + Intergenic
1073738685 10:106381651-106381673 ACAGCCAGAGAGAGACAGGGCGG + Intergenic
1073944074 10:108730277-108730299 GGAGGTGGAGGGAGGGAGGGAGG + Intergenic
1074194903 10:111175102-111175124 GCAGATGGAGGGGGAGAAGGAGG + Intergenic
1074506307 10:114073914-114073936 GCAGCTGGGGAGAGAAAGGCAGG + Intergenic
1074765763 10:116698974-116698996 GGAGCTAGAGGGAGAGAAGGAGG - Intronic
1074857655 10:117485329-117485351 GCACCTGGAAGGAGACTGCGGGG + Intergenic
1075035592 10:119064523-119064545 GGAGCAGGAGGAAGACAGAGGGG - Intronic
1075121804 10:119669916-119669938 GGAGCTGGGGGTACACAGGGTGG - Exonic
1075238775 10:120758348-120758370 GCAGCTGTAGGGAGAAAGGATGG - Intergenic
1075252962 10:120898704-120898726 GCAGCAGGAGAGAGCCAGCGAGG - Intronic
1075438907 10:122463928-122463950 GCAGCAGGAGTGAGCCAGGCTGG + Intronic
1075714100 10:124546012-124546034 GCAGAGGGAGGGAGGGAGGGAGG - Intronic
1076130117 10:128008268-128008290 GCACCTGGAGGGAGGGAGGGAGG - Intronic
1076765031 10:132628430-132628452 ACATCTGGAGGGAGAGGGGGCGG - Intronic
1076806792 10:132862796-132862818 GAGGCTGGAGGGGGACGGGGCGG + Intronic
1076821639 10:132942670-132942692 GGAGCTGGCGGGGGGCAGGGCGG - Intronic
1076852884 10:133101699-133101721 GCAGCCTGGTGGAGACAGGGAGG - Intronic
1076876086 10:133216322-133216344 ACGTCTGGAGGGAGACAAGGTGG + Intronic
1077015934 11:399269-399291 GCAGGTGGAGGGGGGCAGGTGGG - Intronic
1077072617 11:682976-682998 GGAGCTGGGGGCAGAAAGGGAGG + Intronic
1077350871 11:2092671-2092693 GCTGCTGGAAGGAGACAGTGGGG - Intergenic
1077386468 11:2271597-2271619 GCAGATGGAGGGAGCCACGGTGG - Intergenic
1077418929 11:2440425-2440447 TCAGCTTGAGGAATACAGGGTGG + Intergenic
1077864971 11:6214656-6214678 GCAGCTGGAGTGACCCTGGGTGG - Intronic
1078355147 11:10627442-10627464 GCTGCTGGTTGGAGACAAGGGGG - Intronic
1078474797 11:11621422-11621444 GAAGCTGGAGGAAGACAAAGGGG - Exonic
1078536119 11:12175854-12175876 GTAGCTGGAAGGAGGCAGGCTGG + Intronic
1078559064 11:12354984-12355006 GCTGCTGGTGGGAGGCAGGCTGG - Intronic
1079714690 11:23730777-23730799 GAAGCTGGAGAGAGGCAGCGAGG + Intergenic
1080557444 11:33430261-33430283 ATAGGTGGAGGGAGAGAGGGAGG - Intergenic
1080762574 11:35266290-35266312 GCAGGTGCAGGGAGAAAGGAAGG - Intronic
1080853488 11:36091482-36091504 GCAGAGGGAGGGAGGGAGGGAGG - Intronic
1081207349 11:40291673-40291695 GTGGGTGGAGGGAGAAAGGGTGG - Intronic
1081522860 11:43899525-43899547 GGAGCTGGAGTGAGACTGGCTGG - Intronic
1081694905 11:45102939-45102961 GCAGATGCAGAGAGACAGGCAGG + Intronic
1081705225 11:45179008-45179030 GCAGTTGGAGGGGGGCAGTGAGG + Intronic
1081814392 11:45930388-45930410 CCAGCTGGAGGCTGCCAGGGCGG + Intronic
1082796480 11:57381508-57381530 GGAGCTGGTGGGAGACAATGGGG + Intergenic
1083763571 11:64831774-64831796 GCTGCTGGAGGCAGGAAGGGAGG - Intronic
1083766339 11:64843275-64843297 GGTGCTGGAGGCAGTCAGGGAGG + Intronic
1083938495 11:65882716-65882738 ACATCTGCAGGGGGACAGGGTGG + Intronic
1083985809 11:66214542-66214564 GAAGATGGAGGGAGGGAGGGAGG - Intronic
1083992840 11:66257630-66257652 CCAGCGGGAGGGGGACGGGGCGG - Intronic
1083997279 11:66278592-66278614 GGAGCTGGAGGGACCCAGGGCGG + Intronic
1084026140 11:66450971-66450993 GCAGCTGGAAGGAATGAGGGAGG + Intronic
1084103104 11:66963107-66963129 GCAGCTGAAGCCAGACAGAGGGG + Intergenic
1084142165 11:67239868-67239890 GTGGTGGGAGGGAGACAGGGCGG + Intronic
1084357891 11:68651729-68651751 GCAGAGGGAGGGAGGGAGGGAGG + Intergenic
1084359086 11:68657928-68657950 GTAACTGGAGAGAGACAGGCTGG + Intergenic
1084362383 11:68677466-68677488 GCAGCTGGGGGGCCACAAGGAGG - Intergenic
1084519993 11:69657196-69657218 GGAGCTGAAGGGAGATAGGAAGG - Intronic
1084553731 11:69863988-69864010 GAAGCCGGAGGGAGCCAGGATGG - Intergenic
1084599694 11:70137496-70137518 TCAGAGAGAGGGAGACAGGGAGG - Intronic
1084740008 11:71133418-71133440 ACAGATGGAGGGAGGGAGGGAGG + Intronic
1084757902 11:71251201-71251223 GCACCCAGAGGGAGAAAGGGTGG - Intronic
1084895407 11:72263734-72263756 GCAGCAGGAGGGAGTGAGGGTGG - Intergenic
1085225528 11:74917209-74917231 GCAGCTTGCAGGAGCCAGGGTGG - Intronic
1085254949 11:75167106-75167128 GCAGCTGGAGGGAGCTGGAGGGG + Intronic
1085300046 11:75452637-75452659 GCTGCTGGAGGGACAGAGGCTGG + Intronic
1085400415 11:76232584-76232606 GAAGGGGCAGGGAGACAGGGAGG - Intergenic
1085412884 11:76301994-76302016 GAAGCTGGAGGGAGAGAAGAGGG - Intergenic
1085472770 11:76768724-76768746 ACAGAGGGAGGGAGAGAGGGTGG - Intergenic
1085544170 11:77301688-77301710 GCAGCCCGAGGGAGGCGGGGCGG + Intergenic
1085612514 11:77964718-77964740 GCAAGTGGAGGGAGGAAGGGAGG + Intronic
1085666662 11:78420225-78420247 GCAGCAAGAGGGACGCAGGGTGG - Intergenic
1085681116 11:78575704-78575726 GGAGCGGGAGAGAGACAGCGAGG - Intergenic
1086144977 11:83541710-83541732 CATGCTGGAGGGAGACAGTGAGG - Exonic
1086455548 11:86955747-86955769 ACAGCTGAAAGGAGACAGGAAGG - Intergenic
1087093977 11:94303013-94303035 GCAGGTGGAGGGAGGGAGGGAGG - Intergenic
1088371140 11:109089803-109089825 GCAGCTGGAGGGAGGAAGGTGGG - Intergenic
1088531706 11:110817772-110817794 ACAGCTGGATGGGGCCAGGGTGG - Intergenic
1089214841 11:116829277-116829299 GCAGCGGGGGGCACACAGGGTGG + Intergenic
1089235024 11:117016369-117016391 GGAGAGGGAGGGAGAGAGGGAGG + Intronic
1089300784 11:117497621-117497643 GCTGCTGGAGGGAAGGAGGGAGG - Intronic
1089305163 11:117521926-117521948 ACAGCTGGGGGGAGGCAGGGAGG - Intronic
1089309028 11:117545699-117545721 GGAGCTGAGGGGAGGCAGGGAGG + Intronic
1089332775 11:117701503-117701525 GCATCTGGAGGTACACAGGCAGG + Intronic
1089375510 11:117991552-117991574 GAAGCTGGAAGGAGGCAGGTGGG - Intronic
1089375859 11:117994173-117994195 GCATGGGGAGGGAGACTGGGAGG + Intronic
1089457126 11:118632176-118632198 ACTGCTGCAGGGAGAGAGGGAGG + Exonic
1089627697 11:119762120-119762142 GCAGCTGGAGAAAGACAGTTTGG - Intergenic
1089729928 11:120513051-120513073 GCCACTGGAGGGAGGCAGGGAGG - Intronic
1089735549 11:120548150-120548172 GCAGCACAAGGGAGACAGCGTGG - Intronic
1090194024 11:124799978-124800000 GCAGCTGGAGGGAGCCGGCACGG - Exonic
1090500315 11:127254626-127254648 GCATCTGGGTGGAGGCAGGGAGG + Intergenic
1090500771 11:127258443-127258465 GCAGATGGTGAGAGGCAGGGTGG - Intergenic
1090714420 11:129417435-129417457 GCAGCTGGATGGAGAGTGGTGGG + Intronic
1090781149 11:130007796-130007818 GAAGCTGGAAGGAGATAGGAAGG + Intergenic
1091092566 11:132786083-132786105 GCAGCTGGAGGTGGAAAGCGGGG - Intronic
1091181302 11:133606868-133606890 CCTGCTGGAGGAAGATAGGGTGG - Intergenic
1091330619 11:134728551-134728573 CCAGCTTGAGGGAGACAGAAGGG + Intergenic
1091396541 12:157006-157028 GCAGCTGAGGGCAGGCAGGGAGG - Exonic
1091460965 12:643144-643166 GCAGCGGCAGGGGGACAGAGCGG - Intronic
1091554634 12:1563368-1563390 GCAGGTGGAGGCAGCCACGGAGG - Intronic
1091695865 12:2627700-2627722 GCAGCTGGAGGCTGCCACGGTGG - Intronic
1092100721 12:5881691-5881713 GGAGCTGGAGGGAGTGATGGGGG - Intronic
1092151430 12:6251559-6251581 GCAGATGCAGGGAGACTGGCTGG - Intergenic
1092238030 12:6821937-6821959 GCAGCTTGAGGGGGAAAGGGAGG - Intronic
1092238064 12:6822016-6822038 GAACCTGGAGGGGGACAGGAGGG + Intronic
1092751786 12:11726011-11726033 GCAACTGGAGGGAGTCAGATGGG - Intronic
1092904274 12:13087877-13087899 GCTCCTGGAGTGAGAGAGGGTGG - Intronic
1092905951 12:13101063-13101085 GCAGCTGGAGTGAATCAGAGGGG + Intronic
1093905788 12:24690631-24690653 GCACCTGGAGGGAAGCAGAGAGG - Intergenic
1094015021 12:25853623-25853645 CCATGTGGAGGGAGACAAGGAGG + Intergenic
1094615094 12:32029302-32029324 AGAGCGGGAGGGAGGCAGGGAGG + Intergenic
1094737871 12:33255720-33255742 GCAGAGGGTGAGAGACAGGGAGG - Intergenic
1095990455 12:48030660-48030682 GCCCCGGGAGGTAGACAGGGAGG - Intergenic
1096179284 12:49541747-49541769 ACAGATGGAAGGAGACAGGTAGG + Exonic
1096190475 12:49614577-49614599 GAAGCAGGAGGGAGAAAAGGAGG + Intronic
1096217977 12:49808975-49808997 GCAGGGGGAGGGAGAGAAGGAGG + Intronic
1096221002 12:49828140-49828162 GCGGCTGGAGGGAGGGACGGAGG + Intronic
1096263176 12:50105343-50105365 ACAGCTGGAGGGAGACAGAGTGG + Intronic
1096521750 12:52188423-52188445 ACTCCTGGAGGGAGACAGGCCGG + Intronic
1096559274 12:52424201-52424223 GCATCTGGAGGGAGGGAGGGAGG + Exonic
1096695420 12:53345415-53345437 ACAGCTGGAGGGGGAGGGGGAGG - Intergenic
1096741288 12:53695766-53695788 GGGGCTGCAGGGAGACAGGTGGG + Intergenic
1097291961 12:57924693-57924715 GCAGCAGGAGAGAGAGAGCGAGG + Intergenic
1097296093 12:57964605-57964627 GCAGGTTGTGGGAGCCAGGGTGG + Intergenic
1097319652 12:58211043-58211065 GAAGCTGGAGGTTGGCAGGGAGG + Intergenic
1097339283 12:58419131-58419153 GGAGCTGGAAGGGGACAGGAAGG - Intergenic
1097361317 12:58661643-58661665 GGAGCAAGAGGGAGAGAGGGCGG - Intronic
1097794138 12:63844317-63844339 ACAGCTGGAGGCAGGAAGGGAGG + Exonic
1100567205 12:95808176-95808198 GCAGCAGGAGAGAGAGAGAGCGG + Intronic
1101345578 12:103883109-103883131 GCAGGTTGTGGGAGACAGGATGG + Intergenic
1101640648 12:106583879-106583901 GCAGCTGGAGGGAGTGGCGGCGG + Intronic
1101879441 12:108616526-108616548 GCAGCTGGAAGGAGCCAGGGTGG - Intergenic
1102481478 12:113226914-113226936 GCCGTTGGAGGGAGCCAGTGGGG - Exonic
1102605284 12:114063799-114063821 TAACCTGGAGGGAGTCAGGGTGG - Intergenic
1102605372 12:114064087-114064109 TAACCTGGAGGGAGTCAGGGTGG - Intergenic
1102605391 12:114064160-114064182 TAACCTGGAGGGAGTCAGGGTGG - Intergenic
1102605400 12:114064196-114064218 TAACCTGGAGGGAGTCAGGGTGG - Intergenic
1102605410 12:114064232-114064254 TAACCTGGAGGGAGTCAGGGTGG - Intergenic
1102605420 12:114064268-114064290 TAACCTGGAGGGAGTCAGGGTGG - Intergenic
1102605439 12:114064340-114064362 TAACCTGGAGGGAGTCAGGGTGG - Intergenic
1102679946 12:114684574-114684596 GAAGGGGGAGGGAGAGAGGGAGG + Intergenic
1103046011 12:117735112-117735134 GCAGCTTGAGTCAGAGAGGGCGG - Intronic
1103059558 12:117847702-117847724 GGAGCTGGAGCCAGACAGGTGGG - Intronic
1103228638 12:119309229-119309251 GCAGCTGGAGGCAGAAGGAGGGG + Intergenic
1103356610 12:120326107-120326129 GCAGCTGGCAGGGGTCAGGGAGG - Intronic
1103437235 12:120936432-120936454 GCAGAGGGAGGGAGGCAGGAAGG - Intergenic
1103575339 12:121873249-121873271 CCAGCTGTAGGGAGACTGGTTGG + Intergenic
1103923178 12:124410093-124410115 GCAGCTGGAGGCACTGAGGGAGG - Intronic
1104073760 12:125371363-125371385 ACAGCTGGGAAGAGACAGGGAGG + Intronic
1104134091 12:125921213-125921235 GCAGGTGGATGGAGTCGGGGAGG - Intergenic
1104481433 12:129111266-129111288 GGAGATGGGGGGAGGCAGGGAGG + Intronic
1104595017 12:130115070-130115092 GGAACTGGAGGGAGAGAGGGAGG - Intergenic
1104652307 12:130544463-130544485 GCAGGGAGAGGGAGAGAGGGAGG - Intronic
1104769495 12:131352250-131352272 GGAGCTGCAGGGAGACCTGGTGG - Intergenic
1105274021 13:18904401-18904423 GTAGATGGAGGGCGACAGGAAGG - Intergenic
1105686883 13:22792916-22792938 GGATGTGGAGGGAGAAAGGGAGG + Intergenic
1105835899 13:24211826-24211848 CCAGCTGGAGGACGACAGGCAGG - Intronic
1105844949 13:24286195-24286217 TCAGCTGAAAGGAGACAGTGGGG - Exonic
1106070995 13:26410780-26410802 GCATGTGTAGGGAGGCAGGGAGG - Intergenic
1106110301 13:26771324-26771346 GCAGCTGGAGGAAGCCAGCAGGG - Intergenic
1106121768 13:26865662-26865684 GGAGCAGGAGGGAGCAAGGGAGG - Intergenic
1106151961 13:27113167-27113189 GAAGCTGCAGTGAGCCAGGGAGG + Intronic
1106179954 13:27362062-27362084 GCAACAACAGGGAGACAGGGAGG - Intergenic
1107449798 13:40497987-40498009 GCAGCAGGAGGGGCGCAGGGTGG - Intergenic
1107727958 13:43318962-43318984 CAACCTGGAGGGAGAGAGGGAGG + Intronic
1108728365 13:53205316-53205338 GAAGATGGAGAGTGACAGGGAGG - Intergenic
1108756035 13:53503404-53503426 GTAGGTGGAAGGAGAAAGGGAGG - Intergenic
1109693776 13:65927281-65927303 GGAGCTGAAAGGGGACAGGGTGG + Intergenic
1110171197 13:72502715-72502737 ACAGAGGGAGGGAGAGAGGGAGG + Intergenic
1111119126 13:83823501-83823523 TGAGCTGGCGGGAGCCAGGGAGG + Intergenic
1111501514 13:89127610-89127632 GCAGCAGGAAGGAGAAAGGATGG + Intergenic
1112138125 13:96606568-96606590 GCTGGAGGAGGGAGAGAGGGAGG + Intronic
1112309410 13:98304755-98304777 GTAGTTGAAGAGAGACAGGGAGG - Intronic
1112506830 13:99980751-99980773 CGAGCTGGAGGGAGGGAGGGAGG + Intergenic
1113031477 13:105998067-105998089 GCAGCTGGAGGTAGCCTGAGGGG + Intergenic
1113864731 13:113513377-113513399 GAAGCAGCAGGGAGACAGAGGGG + Intronic
1113947848 13:114054512-114054534 GCCGCTGCAGGGAGAAGGGGTGG - Intronic
1113963551 13:114139202-114139224 GGAGGTGGATGTAGACAGGGTGG + Intergenic
1113963583 13:114139343-114139365 GGAGGTGGATGTAGACAGGGTGG + Intergenic
1114042381 14:18691136-18691158 GAAGCTGTAGGAAGACGGGGAGG - Intergenic
1114318331 14:21526311-21526333 GAAGCTGGAGTGAGAAAGCGGGG + Intronic
1114457462 14:22865492-22865514 GAAGCTGGAGGAACAAAGGGAGG + Intergenic
1114522118 14:23346480-23346502 GCAGCAGGGAGGAGGCAGGGTGG + Exonic
1114565879 14:23632418-23632440 GCAGCTGGGAGGAAAGAGGGAGG + Intronic
1115443843 14:33466717-33466739 GGAGCAGGAGGAAGAGAGGGAGG + Intronic
1115477893 14:33833976-33833998 GCTGCTCGATGGAGACCGGGTGG + Intergenic
1115662681 14:35512475-35512497 GCAGCTGGAGACAGAGATGGAGG - Intergenic
1117481880 14:56154481-56154503 GCAGCAGGAGAGAGAATGGGGGG - Intronic
1118449771 14:65889574-65889596 GAAGATGGAGGGACACAGAGAGG - Intergenic
1118663286 14:68038436-68038458 GCATCTTGAGGGAGAAAGGTAGG - Intronic
1118723851 14:68612862-68612884 GAAGGGGGAGGGAGAGAGGGAGG + Intronic
1118920523 14:70145765-70145787 GCAGCTGGAGGGCCAAAGGTAGG - Intronic
1119762034 14:77158377-77158399 CCCGCTGGAGTGAGAAAGGGAGG + Intronic
1120371209 14:83638965-83638987 GCAGCAGGAGAGAGAGAGAGAGG - Intergenic
1120416276 14:84221828-84221850 AAAGAGGGAGGGAGACAGGGAGG + Intergenic
1120856762 14:89219254-89219276 GAAGCAGGAGGGAGACAGAAGGG - Intronic
1121104412 14:91271141-91271163 GCAGAGGGAGGGGCACAGGGAGG + Intergenic
1121111082 14:91313601-91313623 GCAGCTGGAGCGTGAGAAGGAGG - Exonic
1121279251 14:92687590-92687612 TCACCTGGAGGGAGGGAGGGAGG + Intronic
1121553003 14:94816261-94816283 GAAGCTGGAGGAAGCCAGGAAGG + Intergenic
1121703903 14:95976793-95976815 GCAGCTGCATGGAGACATGATGG - Intergenic
1121730277 14:96182017-96182039 GAAGCTGGGGGGAGACCTGGGGG - Intergenic
1121784793 14:96649356-96649378 GCAGCTGCAGGCAGGCAGGCAGG + Intergenic
1121796808 14:96742242-96742264 GGAGAGGGAGGGAGACAGGTAGG - Intergenic
1121870104 14:97399596-97399618 GCAGCAGGAGAGAGAGAGAGAGG + Intergenic
1121974040 14:98385828-98385850 GCAGCTGAAGGCAGCCAGGGAGG + Intergenic
1122287113 14:100658645-100658667 GCAGCTGCAGAGAGGGAGGGAGG - Intergenic
1122297671 14:100714385-100714407 CCATGTGGAGGGAGACAGGGTGG + Intergenic
1122361601 14:101170333-101170355 GCAGCTGGAGGGAGGAGGTGAGG - Intergenic
1122447558 14:101781066-101781088 GTAGCTGGAGGGAGACGGCTAGG - Intronic
1122460379 14:101889547-101889569 CCATCTGGAGGGAGACAGGCTGG + Intronic
1122913726 14:104846206-104846228 GCTGCTGGTGGGTGACAGGCAGG + Intergenic
1122931910 14:104937000-104937022 CCAGCTGGAGGGAGGGAGGGAGG + Exonic
1122939092 14:104973292-104973314 GCTGCTGGCGGGGGCCAGGGAGG + Intronic
1123193892 14:106598085-106598107 GCAGCAGGAGAGAGAGAGAGGGG - Intergenic
1202921516 14_KI270723v1_random:33389-33411 ACAGAGGGAGGGAGGCAGGGAGG + Intergenic
1123917688 15:25048963-25048985 AGACATGGAGGGAGACAGGGAGG - Intergenic
1123961391 15:25405187-25405209 GCAGTTGTAGGGAAATAGGGAGG - Intronic
1124248766 15:28094382-28094404 GCAGCTGGCGGGAGAGGGGTAGG + Intronic
1124362678 15:29049631-29049653 TGAGCTGGAGGCAGTCAGGGTGG - Intronic
1124368843 15:29091870-29091892 GATGCTGGAGGGACTCAGGGAGG + Intronic
1124465855 15:29939386-29939408 GCAGCTGGAGGTGGAAATGGAGG - Intronic
1124725453 15:32152462-32152484 GCACATGCAGGGACACAGGGAGG + Intronic
1124967656 15:34448443-34448465 CCGGGTGGAGGGAGGCAGGGCGG + Intergenic
1125200073 15:37095435-37095457 GGAGCTCTAGGGAGAGAGGGAGG - Intronic
1125512627 15:40300997-40301019 GCAGCAGGAGAGAGGGAGGGTGG + Intronic
1125720684 15:41843781-41843803 GCAGCTGGACGGAGACCTGCAGG + Exonic
1125745933 15:41997132-41997154 GCAGCTGGAGGAAGACCTGCAGG - Exonic
1125753753 15:42048531-42048553 GCAGCTGGAGAAAGACCAGGGGG + Intronic
1127196483 15:56591464-56591486 GCAGCAGGAGGAAGAGAGTGAGG + Intergenic
1127369208 15:58321401-58321423 GGAGCTGGAGGGAGAGAGAATGG + Intronic
1127466723 15:59250919-59250941 GCAGGTGGAGGGAGACACGTGGG + Intronic
1128220586 15:65965546-65965568 GGGGCTGGAGGGAGCCAGTGAGG + Intronic
1128288681 15:66460165-66460187 AAAGATGGAGGGAGACAGAGTGG + Intronic
1128733594 15:70036946-70036968 GCAGGTGGAGGGAGGGAGGAAGG - Intergenic
1128905375 15:71463363-71463385 GCTGCTGGAAGGGGGCAGGGAGG - Intronic
1129656161 15:77526952-77526974 GCATGTGGAGGGGGAGAGGGAGG + Intergenic
1129712163 15:77825948-77825970 GCAGGGAGAGGGAGAGAGGGAGG + Intergenic
1129749236 15:78049016-78049038 GGAGTTGGAGGAAGACAGGGTGG + Intronic
1129942387 15:79509806-79509828 GAAGTTGGAGGAAGACAGGAGGG - Intergenic
1130561975 15:84965883-84965905 TAAGCTGGAGGGAGGCGGGGAGG + Intergenic
1130603438 15:85293933-85293955 GGAGCAGGAGGGAGACAGCGGGG + Intergenic
1130821619 15:87502135-87502157 GGAGGTGGAGGGTGAGAGGGAGG - Intergenic
1130846745 15:87754865-87754887 GAAGGTGGAAGGGGACAGGGTGG - Intergenic
1130880626 15:88052727-88052749 GGAGGTGGAGGGTGTCAGGGAGG + Intronic
1130898471 15:88189029-88189051 CCAGACGGAGGGAGACAGTGGGG + Intronic
1130963660 15:88681760-88681782 CCGGCTGGAGAGAGAGAGGGCGG - Intergenic
1131161823 15:90110362-90110384 AGAGATGGAGGGAGAGAGGGAGG + Intergenic
1131262641 15:90895703-90895725 GCAGCAGCAGGGACACAGAGAGG - Exonic
1131379256 15:91950178-91950200 GCAGCTGGAATGAGGTAGGGAGG + Intronic
1131402343 15:92135163-92135185 AAAGCTGGAGGGAGAGATGGAGG + Intronic
1131641570 15:94299018-94299040 GGAGGGGGAGGGAGAGAGGGAGG - Intronic
1131653389 15:94427476-94427498 GGGGCTGGAGGGAGACAGCAAGG + Intronic
1132179184 15:99738918-99738940 GCAGCAGGAGAGAGAGAGTGAGG - Intergenic
1132312665 15:100868543-100868565 TAAGATGGAGGGAGACAGGTGGG + Intergenic
1132558970 16:584839-584861 GCAGCTGGAGGGGGAGTTGGGGG - Intergenic
1132590646 16:724952-724974 GCAGCTGCAGGGAGCCCGAGAGG - Exonic
1132598899 16:765253-765275 CCAGCAGGAGGCAGCCAGGGCGG + Exonic
1132603100 16:782612-782634 GGCCCAGGAGGGAGACAGGGAGG + Intronic
1132752747 16:1466302-1466324 GAAGGTGGAGGGAGAGATGGGGG - Intronic
1132756738 16:1488928-1488950 GCGGCTGGAGGGAGACTGCTGGG - Intronic
1132827892 16:1914079-1914101 GCAGCCACAGGGAGACTGGGAGG + Intronic
1132858145 16:2056637-2056659 GCACCTGCAGGGAGACCTGGTGG - Exonic
1132863415 16:2082448-2082470 GCAGCTGGACTGGTACAGGGAGG - Exonic
1132996756 16:2827438-2827460 GCAGATGGAGGGTGGGAGGGGGG + Intergenic
1133035340 16:3031054-3031076 GGAGCTGGAGGGGGACGTGGAGG - Exonic
1133047592 16:3097497-3097519 GGAGGTGGATGGGGACAGGGTGG + Intronic
1133467006 16:6037001-6037023 GGAGGTGGGGGGAGACAGGGAGG + Intronic
1134079859 16:11317214-11317236 ACAGCTGGAAGGAGGCAGGGCGG + Intronic
1134099295 16:11440405-11440427 GCAGATGGAGGGACAGAGAGTGG - Intronic
1134112641 16:11524741-11524763 GTGGCTGGAGGGAGGGAGGGAGG - Intergenic
1134361057 16:13531595-13531617 GCAGCTAGAGGGAGAAAGGGAGG - Intergenic
1135457779 16:22613591-22613613 GCAGCTGCAGAAAGACAGAGTGG - Intergenic
1135534627 16:23283807-23283829 AGGGCTGGAGGGACACAGGGAGG + Intronic
1135573272 16:23565842-23565864 GCAGGGGGAGGGGGGCAGGGAGG - Intronic
1135657803 16:24266887-24266909 GAAGCTGGAGAGAGAGAGGATGG + Intronic
1136138573 16:28274045-28274067 GGGGCTGGCGGGAGAGAGGGAGG + Intergenic
1136276760 16:29183385-29183407 GCGGTTGCACGGAGACAGGGCGG - Intergenic
1136349833 16:29699559-29699581 GCAGCTGCAGGGAGGCCAGGAGG + Intergenic
1136477056 16:30520021-30520043 GGATCTGGTGGGAGCCAGGGAGG + Intronic
1136580797 16:31149786-31149808 GCTGGGGGAGGGAGTCAGGGAGG - Intronic
1137067608 16:35864551-35864573 GCAGAGGGATGGAGACAGGTTGG - Intergenic
1137358527 16:47791182-47791204 GCAGCAGGAGAGAGAAGGGGAGG + Intergenic
1137574443 16:49589593-49589615 GCAGCGAGAGGGAGAAGGGGAGG + Intronic
1137587980 16:49675556-49675578 GCAGCTGGAGGGGGGTGGGGTGG - Intronic
1137775236 16:51048669-51048691 GCATCTTGTGGGAGACATGGAGG + Intergenic
1138747966 16:59385720-59385742 GCAGCAGGCGGGAGACTAGGGGG - Intergenic
1139508239 16:67410310-67410332 GCAGCTGGAGGTAGCCAGGTGGG - Intronic
1139521312 16:67484091-67484113 AAACCTGGAGGGAGAAAGGGAGG - Intergenic
1139656216 16:68388600-68388622 GCAGCTGGTGGGGGACAGTTTGG - Intronic
1139802840 16:69538000-69538022 ACAACTGGAGGGAGGCAGGATGG + Intergenic
1139949237 16:70661118-70661140 CCAGCTGCAGGGGGACAGGCTGG - Intergenic
1140035359 16:71367599-71367621 GCAGCTGATGGCAGACAGTGAGG - Intronic
1140074482 16:71684727-71684749 GCAGATGGAGGGGGACAAGGAGG - Intronic
1140131546 16:72166312-72166334 GCAGCTGGAGAGAGAGAGTGAGG - Intronic
1140223358 16:73059183-73059205 GGAGGTGGAGGGAGGCAGAGGGG + Intronic
1140686477 16:77438314-77438336 GCAGAGGGAGGGAGGGAGGGAGG + Intergenic
1140697257 16:77547426-77547448 ATGGATGGAGGGAGACAGGGAGG + Intergenic
1141125505 16:81398031-81398053 GGAGCTGGGGGGTGACAAGGTGG - Intergenic
1141265797 16:82495815-82495837 GCTGCTGTATGGAGAAAGGGTGG + Intergenic
1141309552 16:82900112-82900134 GCAGCTGCAAGGACACTGGGTGG - Intronic
1141760586 16:86026251-86026273 GCAGGCAGAGGGAGACAGGGCGG + Intergenic
1141777411 16:86133679-86133701 GCACCAGGAGGGATACAAGGGGG - Intergenic
1141964426 16:87432410-87432432 GCAGCAGGAGGAAGAAAGGCAGG - Intronic
1142067656 16:88072050-88072072 GCACCTGGAGGGAGACACACGGG - Exonic
1142186584 16:88697722-88697744 CCTGCTGGAGGGAGGCAGGAAGG - Intronic
1142418187 16:89954380-89954402 GGTGCTGGTGGGAGTCAGGGTGG + Intronic
1142426037 16:90002850-90002872 GCAGAGGGAGGGAGGCAGGCAGG - Intergenic
1142597204 17:1035530-1035552 GCAGGTGGGGGTAGAAAGGGTGG - Intronic
1142683320 17:1562592-1562614 GCAGCGGGCGGGAGGCCGGGCGG - Exonic
1142755515 17:2014240-2014262 GGATCTGGAGGGGCACAGGGTGG + Intronic
1143133213 17:4694198-4694220 AAAGCTGGAGGCAGCCAGGGAGG + Intronic
1143161459 17:4874492-4874514 GCAGCAGAAGGAAGACATGGGGG + Intronic
1143389584 17:6552364-6552386 GCAGAGGGAGGGGCACAGGGAGG + Intronic
1143474038 17:7192875-7192897 AAAGCTGGAGGGAGGCAGTGGGG + Intronic
1143496970 17:7317980-7318002 GCAGCTGGAGGGTGCCACTGTGG - Intronic
1143612302 17:8025727-8025749 GCATCTGGGGCAAGACAGGGTGG + Intergenic
1143681721 17:8480778-8480800 ACAGCTGGAGAGAGGCAGGCAGG - Intronic
1143712519 17:8744352-8744374 GCAGGGGGAGGGTGACGGGGTGG + Intronic
1144146424 17:12403778-12403800 GCAGCTGGTGGGAGTGTGGGGGG - Intergenic
1144468628 17:15517179-15517201 TCAGTTGGGGGGTGACAGGGAGG - Intronic
1144659243 17:17057738-17057760 GCAGCGGGTGGGGGTCAGGGTGG - Intronic
1144836666 17:18159916-18159938 ACAGCTGAAGGGGGGCAGGGAGG - Exonic
1144873385 17:18383600-18383622 GCAGCGGCAGGGCGGCAGGGCGG + Intronic
1145989500 17:29070430-29070452 GAAGATGGAAGGAGTCAGGGTGG + Intergenic
1146111207 17:30091288-30091310 CCAGCTGGAGAGAGGGAGGGAGG + Intronic
1146185991 17:30724570-30724592 ATGGCTGGAGGGAGACAAGGCGG + Intergenic
1146459560 17:33034721-33034743 GCAGCCAGAGGGAGAAAAGGGGG - Intronic
1146643808 17:34563042-34563064 ACAGCAGGAGGCCGACAGGGTGG - Intergenic
1147015479 17:37489036-37489058 GCAGGTGAAGGGAGACACGTGGG - Intergenic
1147061213 17:37880037-37880059 AGAGAGGGAGGGAGACAGGGAGG + Intergenic
1147120959 17:38334839-38334861 TCAGCTGTGGGGAGACAGGGAGG + Exonic
1147134924 17:38428956-38428978 ACAGCTGGAGGGAGAGGGGGTGG + Intronic
1147381644 17:40059889-40059911 AGAGATGGAGGGAGAGAGGGAGG + Intronic
1147403988 17:40197629-40197651 ACAGAGGGAGGGAGAGAGGGAGG + Intergenic
1147671546 17:42179846-42179868 GGAGCTGGAGGGAGACAGCTCGG - Intronic
1147845251 17:43400053-43400075 GCGGCTGGAGGAAGCCAAGGTGG + Exonic
1148135549 17:45289463-45289485 GAAGCTGGGGAGAGACAGTGCGG - Intronic
1148344885 17:46896701-46896723 GCAGATGGAGGGAAATAGGCAGG - Intergenic
1148442223 17:47717304-47717326 GCAGCTGGAGGCAGCCAATGAGG + Intergenic
1148716857 17:49722176-49722198 GAGACTGGAGGAAGACAGGGAGG - Intronic
1148747148 17:49924745-49924767 ACAGATTGAGGGAGGCAGGGAGG + Intergenic
1149596519 17:57867648-57867670 GCAGCCAGAGGGAAACAGGGAGG - Intronic
1149867648 17:60159584-60159606 GTGGGTGGAGGGGGACAGGGTGG - Intronic
1149987969 17:61362504-61362526 GCAGGTGGAGGGGGACAGGTAGG - Intronic
1150428926 17:65100592-65100614 GGAGGTGGAGGGAGAGGGGGTGG - Intergenic
1150649609 17:67001321-67001343 GGAGCTGGAGGGAGCCATGTGGG - Intronic
1150655768 17:67038487-67038509 GCAGGTGAAGGGAGGCAAGGGGG - Intergenic
1150747831 17:67830614-67830636 GCAGATTGAGGGAGGGAGGGAGG + Intronic
1151203592 17:72488184-72488206 GCGGCTGGGGGAAGAAAGGGTGG - Intergenic
1151451467 17:74200678-74200700 GCTGCTGGAGGGAGGAGGGGAGG + Intergenic
1151548102 17:74805737-74805759 GGAGCTGGAGGAAGCAAGGGAGG - Intronic
1151572013 17:74931158-74931180 GTAGCTGGGGGGAGAAAGGGTGG + Intronic
1151868073 17:76818061-76818083 GGAGCAGGAGGAAGAGAGGGGGG + Intergenic
1151953025 17:77365706-77365728 GCAGGTGGAAGGAAAGAGGGTGG - Intronic
1151954370 17:77373220-77373242 GCAGCCAGTGCGAGACAGGGAGG + Intronic
1152267968 17:79307189-79307211 CCAGCTGGATGGCAACAGGGCGG - Intronic
1152312322 17:79558767-79558789 GGAGCAGGAGGGAGAGAGGAGGG + Intergenic
1152343368 17:79737498-79737520 GGGGCTGGAGGGAGCGAGGGTGG + Intronic
1152432548 17:80257324-80257346 GCACTTGGAGGGAGGGAGGGAGG + Intergenic
1152511396 17:80791909-80791931 GAAACTGGATGGCGACAGGGGGG - Intronic
1152563383 17:81089627-81089649 GCAGGCGGAGGGGGAGAGGGAGG + Intronic
1152587090 17:81193963-81193985 GCAGCTGGAGCGGGAGAAGGAGG - Exonic
1152594891 17:81233266-81233288 GCAGCCAGAGAGAGACAGTGGGG + Intronic
1152609314 17:81307822-81307844 GCAGCAGGAAGGAGAAAGGAGGG - Intergenic
1152801172 17:82331268-82331290 GGAGCTGGGGGGAGACCGGGAGG + Intronic
1152926236 17:83089038-83089060 GAAGAGGGAGGGAGAAAGGGAGG + Intronic
1153626403 18:7025655-7025677 GGAGGTGGAGGGATACAGAGAGG - Intronic
1154078015 18:11224277-11224299 GCAGCTGGCTGTAGACATGGTGG - Intergenic
1154347200 18:13551962-13551984 GGAGCAAGAGGGTGACAGGGAGG + Intronic
1155337791 18:24783191-24783213 GCAGGAGGAGGGAGACTGGGGGG - Intergenic
1155520852 18:26667628-26667650 GAGGAAGGAGGGAGACAGGGAGG + Intergenic
1155630538 18:27887529-27887551 GAAGGAGGAGGGAGGCAGGGAGG - Intergenic
1156463572 18:37334997-37335019 GCAGAGGGAGGGAGGGAGGGAGG - Intronic
1156479462 18:37427022-37427044 GCAGCAGCAGGGACACGGGGGGG + Intronic
1156674483 18:39511484-39511506 CAAGCTGTAGGGAGACAGGAAGG + Intergenic
1157191979 18:45589308-45589330 AAAGCTGGAGAGAGAAAGGGGGG + Intronic
1157342866 18:46794893-46794915 GCAGCAGGATGGAGGAAGGGAGG - Intergenic
1157446912 18:47753119-47753141 GCAGGTGGAGGGATAGAGGCGGG - Intergenic
1157522453 18:48354801-48354823 GCAGAGGAAGGGAGACAGAGGGG + Intronic
1157931994 18:51833435-51833457 GCAGCAGGGGGAAGACAGTGTGG + Intergenic
1158931481 18:62328197-62328219 GCAGAGGAAGGGAGAGAGGGAGG + Intronic
1159010896 18:63057893-63057915 GCAGCTGGAGGGCGCGAGGTGGG - Intergenic
1159019943 18:63135243-63135265 GCAAGTTGAGGGAGGCAGGGAGG - Intronic
1160174112 18:76579183-76579205 GAAGCAGGATGGAGACTGGGGGG - Intergenic
1160317319 18:77859768-77859790 GAGGCTGGAGGGAGGCAGGTAGG + Intergenic
1160436928 18:78858942-78858964 GCAGTGGGAGGGAGGGAGGGAGG + Intergenic
1160589291 18:79933713-79933735 GAAGCAGGAGGGAGACAGGAAGG - Intronic
1160671827 19:368795-368817 GAGGCTGGAGGGAGCCAGGGAGG - Intronic
1160747648 19:719509-719531 GCGGCTGCCGGGAGCCAGGGAGG + Intronic
1160863179 19:1246111-1246133 GGAGCAGGAGGCAGTCAGGGTGG + Intergenic
1160900114 19:1423784-1423806 GCAGCCGGAGGGGGACCGGGAGG - Intronic
1161032468 19:2064517-2064539 GCAGGTGGAGAGAAACAGGAGGG + Intergenic
1161063591 19:2227118-2227140 ACAGTTGGAGGTAGGCAGGGCGG + Exonic
1161267176 19:3369744-3369766 CCAGCGGGAGGGAGGCAGGGAGG - Intronic
1161378792 19:3953629-3953651 GCAGCTGCAGGGGGGCGGGGGGG + Intergenic
1161403769 19:4080867-4080889 GGAGGTGGAGGGAGAGAGGGAGG + Intergenic
1161513879 19:4685767-4685789 GCAGCCTGCGGGAGACAGGGCGG + Exonic
1161644506 19:5444729-5444751 GGAGCAAGGGGGAGACAGGGAGG - Intergenic
1161849807 19:6732430-6732452 GCAGCTGGGGGGAGGCAGGCAGG - Intronic
1161850496 19:6735759-6735781 GGACAGGGAGGGAGACAGGGTGG - Intronic
1162060146 19:8089956-8089978 GCAGCTGGACGGAGAGGGGGAGG + Exonic
1162133206 19:8539979-8540001 GAAGCTGGATGGAGACAAGAAGG - Exonic
1162301989 19:9849514-9849536 GCACCTGGGGGGACACGGGGCGG - Exonic
1162320189 19:9967075-9967097 GGAGATGGACAGAGACAGGGAGG + Intronic
1162738984 19:12763226-12763248 TGAGCTGGAGGAAGCCAGGGTGG + Exonic
1162818146 19:13208262-13208284 GGAGGGGGAGTGAGACAGGGAGG + Intronic
1162820968 19:13223508-13223530 TCATCTGGGTGGAGACAGGGCGG - Intronic
1162930841 19:13956728-13956750 GCTGCTGGAGGCAGCCATGGTGG - Intronic
1162972786 19:14191161-14191183 ATGGCTGGAGGGAGACAAGGCGG - Intronic
1163311512 19:16517698-16517720 TGAGCCAGAGGGAGACAGGGTGG + Intronic
1163358520 19:16830113-16830135 GGATCTGGGGGGAGGCAGGGAGG + Intronic
1163442069 19:17327391-17327413 GCAGCTGGGAGGCGAGAGGGCGG - Intronic
1163586756 19:18168555-18168577 CCGTCTGGAGGGAGGCAGGGAGG + Intronic
1163628017 19:18402054-18402076 GCAGGTGGTGGGGGACAGGCAGG + Intergenic
1163691102 19:18738967-18738989 GCGGCTGGAGGGAGTGAGGCTGG + Intronic
1163721383 19:18899775-18899797 ACAGGTGGAGGGAGAGAGAGAGG + Intronic
1163810431 19:19428313-19428335 GCAGCTGCTGGGAGCCTGGGTGG + Intronic
1164731024 19:30504503-30504525 GCAGGAGGAGGGAGGAAGGGAGG - Intronic
1165008399 19:32824747-32824769 CAAGCTGGAGGAAGAAAGGGCGG - Intronic
1165110237 19:33498051-33498073 GCTGCGGGAGGGACACAGCGGGG - Intronic
1165135515 19:33665961-33665983 GCAGCTGGAGGCCGAAAGGCAGG + Intronic
1165161868 19:33821024-33821046 GCATCAGGAGGGAGGGAGGGAGG + Intergenic
1165684039 19:37802600-37802622 GCAGCTTAAGGGAGCCAGGGTGG - Intronic
1165775765 19:38403495-38403517 GGAGCGGGAGGGTGGCAGGGGGG + Intronic
1165918750 19:39278511-39278533 GCAGCTGGGGGTAGACCAGGTGG + Intergenic
1166052511 19:40268682-40268704 ACAGCTGGAGGGAGAGCAGGGGG + Intronic
1166231768 19:41428716-41428738 ACAGCTGGAGGAAGAGAGTGGGG + Exonic
1166302680 19:41921333-41921355 GAAGCAGGAGTGAGACACGGAGG + Intronic
1166403998 19:42506199-42506221 GTAGATGGAGGGAGACAAGAAGG + Intergenic
1166524981 19:43504958-43504980 GGGGCTCGAGGGAGACTGGGAGG - Intergenic
1166607625 19:44159265-44159287 GCAGATGGATGGAGCCTGGGAGG - Exonic
1166792101 19:45404604-45404626 GCAGCTTGAGGCTGGCAGGGTGG + Intronic
1166863217 19:45821488-45821510 GCAGCAGGCGGGAGGAAGGGTGG + Intronic
1167108570 19:47445765-47445787 GCAGCAGGAGGGAAGCAGGTTGG + Intronic
1167209820 19:48127229-48127251 GCAGCTGAGGGGTGACGGGGTGG - Intronic
1167295264 19:48645873-48645895 GGAGCTAGAGGGAGACTGGAGGG - Exonic
1167494055 19:49807720-49807742 GCGGGTGGAGGGAAACAGGCAGG + Intronic
1167571371 19:50290955-50290977 GAAGCTGGAGGGAGAGCTGGAGG + Exonic
1167740740 19:51323643-51323665 GCAGCTGCAGGGAGAATGAGTGG - Exonic
1167837457 19:52085745-52085767 GGAGCAGGAAGGACACAGGGAGG + Intronic
1168072201 19:53959488-53959510 GGAGCTGGAGGACGAGAGGGAGG - Intergenic
1168309403 19:55452916-55452938 GCTGCAGGAGGGAGAAAGCGGGG - Intergenic
1168421671 19:56208114-56208136 GGACCTGGAGGAAGACAGGGAGG + Exonic
1168513023 19:56988467-56988489 GCAGCTGGAGGGCGGAAAGGTGG - Intergenic
1168691503 19:58380464-58380486 GCAGCGCGAGGGCGCCAGGGAGG + Intronic
924961913 2:43367-43389 TCAGGTGGAGGGAGACATGAGGG + Intronic
925180512 2:1814235-1814257 TCAGTTGGATGGGGACAGGGCGG - Intronic
925423759 2:3732095-3732117 CGAGATGGAGGGAAACAGGGAGG + Intronic
925507707 2:4586782-4586804 GAAGAGGGAGGGAGAGAGGGAGG - Intergenic
925513489 2:4653527-4653549 TCTGCTGGAGGTAGACAGAGAGG - Intergenic
925693510 2:6549583-6549605 GAAGCAGGAGGAAGAGAGGGAGG - Intergenic
925809603 2:7686177-7686199 GCAGCCGAAGGTGGACAGGGTGG + Intergenic
925856452 2:8134073-8134095 GAAGCTGGCGGGAGGCAGGAGGG - Intergenic
925944285 2:8846404-8846426 GCTGATGGAGGGAAACAGGAAGG + Intergenic
925944587 2:8849356-8849378 GAAGCTGGAGCCAGCCAGGGAGG + Intergenic
926128401 2:10285776-10285798 GCAGCTGGGCGGACCCAGGGAGG - Intergenic
926165661 2:10521142-10521164 GAGGCTGGAGGGAGGGAGGGAGG + Intergenic
926226197 2:10968534-10968556 GCAGATGCAAGGAGAGAGGGAGG - Intergenic
926236004 2:11044499-11044521 GGAGCAGGAGGAAGACAGAGTGG - Intergenic
926638094 2:15205778-15205800 GCAGCAGGAGAGAGAGGGGGTGG - Intronic
926684954 2:15691227-15691249 GCTGCTGCAGGGAGACCCGGCGG + Intronic
926731559 2:16039418-16039440 GAGGAGGGAGGGAGACAGGGAGG - Intergenic
926731566 2:16039437-16039459 GAGGAGGGAGGGAGACAGGGAGG - Intergenic
927444746 2:23149335-23149357 GCAGCTGCAGGGAGGGAGGGTGG - Intergenic
928214753 2:29351998-29352020 GCAGCTGGAAGAAGAGAGAGTGG - Intronic
928556002 2:32425872-32425894 GCAGCTGGCTGGTGCCAGGGCGG - Intronic
929043973 2:37772968-37772990 ACTGCTGGAGGGACACAGGTGGG + Intergenic
929277971 2:40045744-40045766 GTAGCTGGAGGGAGAAATGGAGG - Intergenic
929811793 2:45195019-45195041 GCAGCTGAAGTGAGAGATGGTGG + Intergenic
929819625 2:45262760-45262782 GGAGGTGGAGGTGGACAGGGAGG - Intergenic
930210608 2:48633361-48633383 GCAGCTGAAGGGAGATGCGGTGG + Intronic
930920608 2:56748907-56748929 GCAGCAGAAAGGAGACATGGGGG + Intergenic
931348854 2:61470878-61470900 GCAGCGGGAGGGGGAGAGGAGGG + Intergenic
931773350 2:65518263-65518285 GGATCTGGAAGGTGACAGGGAGG + Intergenic
932126694 2:69151367-69151389 GTAGCTGTAGGGAGGCAGGGTGG + Intronic
932211769 2:69937413-69937435 GGAGCACAAGGGAGACAGGGAGG - Intronic
932409784 2:71538846-71538868 GCATCTGCAGGCTGACAGGGAGG - Intronic
932704144 2:74010262-74010284 GCATCTGGAAGGTGACGGGGAGG - Intronic
933254735 2:80068143-80068165 GCAGATGGAAGGAGAGAGGCAGG + Intronic
933486152 2:82926494-82926516 GCAGCTGGGCTGGGACAGGGTGG + Intergenic
933638638 2:84735037-84735059 GCAGATGGAGGGAGGCAGCAAGG - Intronic
933747079 2:85579188-85579210 GGGGCTGGAGGAAAACAGGGAGG + Intronic
934713450 2:96529944-96529966 GCAGCTGGGGTGAGGGAGGGGGG + Intergenic
934770999 2:96907570-96907592 GTGGGTGGAGGGGGACAGGGCGG - Intronic
935212401 2:100949843-100949865 GCAGCGGGAGGGAAACAGTGTGG - Intronic
935269701 2:101423347-101423369 GCAGCATGAGTGACACAGGGAGG - Intronic
935580349 2:104750743-104750765 GCAGCAGGGTGAAGACAGGGAGG - Intergenic
935637707 2:105262364-105262386 AGAGCTGGAGAGAGACAGTGAGG - Intergenic
935792381 2:106604971-106604993 GCAGCAGGAGAGAGAAAAGGGGG + Intergenic
935809194 2:106780092-106780114 ACAGCTTGTGGGAGCCAGGGTGG - Intergenic
935925595 2:108065196-108065218 GCAGCTGGATGGGAACAGGCAGG + Intergenic
935979558 2:108613547-108613569 GCAGCTTGAGCTAGCCAGGGTGG - Intronic
936359384 2:111783405-111783427 GCAGCAAGAGAGAGACAGAGAGG - Intronic
936439123 2:112534912-112534934 GCAGAAGGAGGGAAAGAGGGAGG + Exonic
936462155 2:112721920-112721942 GGAGCTGGAGGGAGCAGGGGTGG + Intronic
936581765 2:113706303-113706325 GCAGCTGGAGGCAAAGAAGGAGG - Intronic
937045366 2:118848359-118848381 GGAGGGGGAGTGAGACAGGGAGG + Intergenic
937097490 2:119245242-119245264 TCAGCAGGAGGGACAAAGGGTGG + Intronic
937150818 2:119684347-119684369 GCATCTGACGTGAGACAGGGAGG - Intronic
937230912 2:120397653-120397675 GCAGCTTGTGGGAGGCAGGTGGG - Intergenic
937298751 2:120825738-120825760 GCACCAGGAGGGGGACATGGAGG - Intronic
937305452 2:120867799-120867821 GGAGCTGGAGGGAAGGAGGGAGG + Intronic
937617905 2:123947999-123948021 GCAGCAGGAGAGAGAGAGTGAGG + Intergenic
937855031 2:126666105-126666127 GCAGCTGCTGGGACACAGGTGGG - Intronic
938318493 2:130346147-130346169 GCAGCACGAGGTACACAGGGTGG - Intronic
940200165 2:151141521-151141543 TAAGCCTGAGGGAGACAGGGTGG - Intergenic
940274368 2:151923531-151923553 GGAGCTGGAGGAAGCCTGGGTGG + Intronic
940739314 2:157489025-157489047 GCAGCTGGAGGAAGAGGAGGAGG + Intergenic
941256934 2:163243731-163243753 ACAGCAGGAGGAAGAGAGGGAGG + Intergenic
941294195 2:163715503-163715525 GCGGCTGGAGTGAAGCAGGGTGG - Intronic
941384749 2:164840692-164840714 GCGGGTGGAGGGCGACAGGAGGG - Intronic
941404788 2:165074777-165074799 GCAGCTGGAGGCAGACAGACAGG + Intergenic
941888248 2:170551916-170551938 GCAGCAGGAGAGAGAGAAGGGGG - Intronic
943051262 2:182916063-182916085 GCAGGAGCAGGGAGACGGGGAGG - Intronic
943330765 2:186556324-186556346 ACAGAGGGAGGGAGAAAGGGAGG - Intergenic
943363589 2:186948640-186948662 GCAACTGGAGGGAGATGGGAAGG + Intergenic
943667738 2:190628023-190628045 GCAGCTGGAGGGACTGCGGGGGG - Intergenic
943676729 2:190722923-190722945 GCAGCAGGAGGGAAAGAGTGTGG - Intergenic
944875903 2:203963996-203964018 GCCGCTGCAAGGAGACATGGTGG + Intergenic
945213843 2:207412559-207412581 GCAGCTGGAGAAAGATAGTGGGG + Intergenic
945328886 2:208516200-208516222 GCAGCAAGAGGGAGAAAAGGAGG + Intronic
945744673 2:213705477-213705499 GGAGCTGGAGGTAGAAAGGGTGG + Intronic
946023421 2:216657258-216657280 GCAGCGGGGCGGAGGCAGGGAGG + Intronic
946042547 2:216794987-216795009 GGAGTTGGAGGAAGAGAGGGTGG + Intergenic
946061981 2:216950368-216950390 CAAGCTGGAGGGGGACAGGCTGG + Intergenic
946202805 2:218080758-218080780 GCAGCAGGTGGGAGGGAGGGAGG - Intronic
946311902 2:218886682-218886704 CCAGCTGGAGGGGGAGCGGGTGG - Intronic
946540185 2:220675879-220675901 GGAGCAAGAGAGAGACAGGGAGG + Intergenic
947826263 2:233107804-233107826 GCGGGTGGTTGGAGACAGGGTGG + Intronic
947878845 2:233486932-233486954 GCTGCTGGAGAGAAACAGGAGGG + Intronic
947903238 2:233740067-233740089 GCAGCAGGCGAGAGACAGAGAGG - Intronic
948158221 2:235801678-235801700 GCAGCTGGATTGAGAGAAGGTGG + Intronic
948563150 2:238867152-238867174 GCAGCTGGAGGGAAGGAGGCTGG + Intronic
948566643 2:238891531-238891553 GGAGCTGGAGGGTGAGAGGACGG + Intronic
948846414 2:240684790-240684812 GCAGATGCAGGGAGACTGTGGGG - Intergenic
948847448 2:240689943-240689965 GCAGATGCAGGGAGACTGTGGGG + Intergenic
948963749 2:241360010-241360032 GCAGCTGGAGGGAGACAGGGAGG - Intronic
948995468 2:241576133-241576155 GCAGCGGGAGGAGGAGAGGGAGG - Intergenic
949049259 2:241888469-241888491 GCAGCAAGAGGGAGAATGGGAGG - Intergenic
949049284 2:241888545-241888567 GCAGCAAGAGGGAGAATGGGAGG - Intergenic
949049308 2:241888620-241888642 GCAGCAAGAGGGAGAATGGGAGG - Intergenic
949049333 2:241888696-241888718 GCAGCAAGAGGGAGAATGGGAGG - Intergenic
949079775 2:242087991-242088013 GCGGCTGGAGGGAGAGAGGCAGG - Intergenic
1168928635 20:1603486-1603508 GGAGTAGGAAGGAGACAGGGTGG + Intronic
1168962075 20:1876798-1876820 GCAGACGGAGGGAGAGGGGGAGG - Intergenic
1168978204 20:1983681-1983703 GGAACTGGAGGCAGGCAGGGAGG - Intronic
1169204076 20:3730387-3730409 GGAGCAGGAGGGAGACGGGAGGG + Intergenic
1169247881 20:4038189-4038211 GCAGCTTGGAGAAGACAGGGGGG + Intergenic
1169418877 20:5443100-5443122 GGAGCAGGAGGAAGACAGAGAGG - Intergenic
1170032202 20:11955463-11955485 ACAGCTGGAGGGGGCCAGAGAGG - Intergenic
1170036398 20:11994411-11994433 TCAGCAGGAATGAGACAGGGTGG + Intergenic
1170607309 20:17883743-17883765 GCAGCTGAGTGGAGAGAGGGAGG - Intergenic
1170731932 20:18983541-18983563 GCAGCAAGAGGCAGGCAGGGTGG - Intergenic
1171209912 20:23309261-23309283 GGAGGAGGAGGGAGACAGAGAGG - Intergenic
1171209924 20:23309296-23309318 GGAGGAGGAGGGAGACAGGAGGG - Intergenic
1171360991 20:24586217-24586239 GTAGCTGGAGGGGCACAGTGGGG + Intronic
1172292125 20:33784099-33784121 GGTGCTGGAGGGAGATGGGGAGG - Intronic
1173037648 20:39428085-39428107 GGAGGGGGAGGGAGAAAGGGAGG - Intergenic
1173308370 20:41873189-41873211 GCTGCTGGAGAGAGGGAGGGAGG + Intergenic
1173502889 20:43566456-43566478 GCAGCTCTGGGGGGACAGGGAGG - Exonic
1173913779 20:46690889-46690911 GTAGGGGGAGGGAGATAGGGAGG - Intergenic
1173951458 20:46996850-46996872 GGAGCAGGAGGAAGAGAGGGGGG + Intronic
1174174273 20:48635261-48635283 GAAGCTGGAGGGAGATGGGTGGG - Intronic
1174268190 20:49347255-49347277 GCAGGTGGAGGGAGAGAAAGTGG - Intergenic
1174289876 20:49500492-49500514 GGAGCAGGAGGGAGGCAGTGTGG - Intergenic
1174297754 20:49561151-49561173 GCAGAGGGAGGTAGAGAGGGAGG - Intronic
1174455453 20:50645609-50645631 GCAGCTGGAGGGAGCGGGGATGG - Intronic
1174993075 20:55534851-55534873 AAAGCTGAAGGGAGAGAGGGCGG - Intergenic
1175216838 20:57395688-57395710 GCAGCTCCAGGGAGGCAGCGGGG + Intronic
1175387618 20:58607502-58607524 GCACCTGGAGGGCTCCAGGGAGG + Intergenic
1175514643 20:59561247-59561269 TCAGCTGGAGGGACAGAGGGTGG + Intergenic
1175520701 20:59600839-59600861 GAATCTGGGTGGAGACAGGGAGG + Intronic
1175637578 20:60598636-60598658 GCAGCTGGCGAGAGACAGGCTGG - Intergenic
1175705988 20:61177112-61177134 GGAGCTGGAGGGAGGGAGGGAGG + Intergenic
1175781051 20:61682306-61682328 ACAGATGGAAGGAGAGAGGGAGG + Intronic
1175968364 20:62671292-62671314 GCAGCTGCAGAGAGCCAGAGCGG - Intronic
1176087253 20:63303804-63303826 ACACCTGGAGGGAGGGAGGGAGG - Intronic
1176087266 20:63303844-63303866 ACACCTGGAGGGAGGAAGGGAGG - Intronic
1176087309 20:63304004-63304026 ACACCTGGAGGGAGGAAGGGAGG - Intronic
1176087355 20:63304164-63304186 ACACCTGGAGGGAGGAAGGGAGG - Intronic
1176087367 20:63304204-63304226 ACACCTGGAGGGAGGAAGGGAGG - Intronic
1176087379 20:63304244-63304266 GCACCTGGAGGGAGGAAGGGAGG - Intronic
1176087392 20:63304284-63304306 ACACCTGGAGGGAGGAAGGGAGG - Intronic
1176087415 20:63304364-63304386 ACACCTGGAGGGAGGAAGGGAGG - Intronic
1176087428 20:63304404-63304426 ACACCTGGAGGGAGGAAGGGAGG - Intronic
1176087441 20:63304444-63304466 ACACCTGGAGGGAGGAAGGGAGG - Intronic
1176087464 20:63304524-63304546 ACACCTGGAGGGAGGAAGGGAGG - Intronic
1176087476 20:63304564-63304586 ACACCTGGAGGGAGGAAGGGAGG - Intronic
1176087487 20:63304604-63304626 GCAGCTGGAGGGAGGAAGGGAGG - Intronic
1176087499 20:63304644-63304666 ACACCTGGAGGGAGGAAGGGAGG - Intronic
1176162169 20:63653480-63653502 GCGGCGGGAGAGAGAGAGGGAGG + Intergenic
1176233646 20:64044150-64044172 GCAGTTCCAGCGAGACAGGGAGG + Intronic
1176259163 20:64170152-64170174 GGAGATGAAGGGAGATAGGGAGG - Intronic
1176975118 21:15312249-15312271 GCAGCAGGAGAGAGAGAGCGTGG - Intergenic
1177803097 21:25847637-25847659 GCAGCAGGAGAGAGAGAGAGAGG - Intergenic
1177906033 21:26972345-26972367 CCAGCTGGAAGGAGAAAAGGGGG - Intergenic
1178228631 21:30754551-30754573 GGAGCTGGAGGGGGAAAGGGAGG - Intergenic
1178305833 21:31489492-31489514 AGAGAGGGAGGGAGACAGGGAGG + Intronic
1178511876 21:33212147-33212169 GCAGCTGGAGGCAGATGTGGGGG - Intergenic
1178531100 21:33376947-33376969 GGCGCTGGAGGAAGACAAGGTGG - Intergenic
1178727012 21:35062120-35062142 GAGGGTGAAGGGAGACAGGGAGG - Intronic
1178770895 21:35503012-35503034 GGATTTGGAGGGAGACACGGAGG - Intronic
1178833683 21:36078050-36078072 GCATCTGGTGGGACACACGGAGG + Intronic
1179008026 21:37531637-37531659 CCAGCTGGAGGGAGGCAGGCAGG - Intergenic
1179028677 21:37701289-37701311 GAACCTTGAAGGAGACAGGGAGG + Intronic
1179176343 21:39010766-39010788 GGAGCTGGAGGGAGGCCTGGGGG - Intergenic
1179396484 21:41044955-41044977 GCAGCTGGAAGGAGCCAGAGGGG + Intergenic
1179421237 21:41238395-41238417 GCAGGAGGAGGGAGGCAGGCAGG + Intronic
1179421736 21:41241797-41241819 GCTGCGGGAGGGCGACAGAGAGG - Exonic
1179956062 21:44739407-44739429 GCAGGTGGATGGACAGAGGGAGG - Intergenic
1180110325 21:45644275-45644297 GCGGCTGGAGGGCGGCGGGGCGG + Intronic
1180182162 21:46122965-46122987 GCAGCTGGGCAGAGGCAGGGAGG + Intronic
1180186874 21:46144578-46144600 GGAGAGGGAGGGAGAGAGGGAGG - Intronic
1180709845 22:17832218-17832240 GCAGGCGGAGAGAGACAGGAGGG + Intronic
1180715620 22:17870214-17870236 GCACCTGGTGGGAGATCGGGTGG - Intronic
1180921347 22:19523116-19523138 GATGCTGGAGTGAGACCGGGAGG + Exonic
1181045371 22:20211757-20211779 GCACCTGGAATGAGACAGAGGGG - Intergenic
1181088328 22:20455264-20455286 GGAGCTGGAGGGAGATGGGAGGG - Intronic
1181237621 22:21457171-21457193 GCTGCTGGAGGAAGACAAGGTGG + Intergenic
1181634000 22:24166023-24166045 GCACCTGGAGGAGGCCAGGGAGG + Intronic
1181731865 22:24853196-24853218 GGATCTGGAGTGAGACAGAGTGG - Intronic
1181747501 22:24966054-24966076 GCAGCTAGTGGCAGGCAGGGAGG + Intronic
1181877392 22:25950405-25950427 GCAGCTGGAGGAAGCCAAGAAGG + Exonic
1182024692 22:27108883-27108905 GGAGCTCGAGGCAGCCAGGGTGG - Intergenic
1182100697 22:27655584-27655606 GTAGATGAAGGGAGGCAGGGAGG + Intergenic
1182235370 22:28871084-28871106 GCAGCAGGAGGAAGAGAGAGAGG - Intergenic
1182331721 22:29555717-29555739 GCAGGGGGAGGGAGGCAGGCAGG + Exonic
1182445198 22:30385986-30386008 CCAGCTGCAGGGAGACAAGGAGG + Exonic
1182452879 22:30431677-30431699 GCATCTGGTGGTAGACAGTGGGG - Intergenic
1182556986 22:31134477-31134499 GCAGCAGGAGAGAGGCAGGTGGG - Exonic
1182860573 22:33556083-33556105 GAAGTTGGAGGGAGTCAGGAGGG - Intronic
1183162460 22:36124005-36124027 GCACCAGGAAGGAGCCAGGGAGG - Intergenic
1183180755 22:36258141-36258163 ACAGCTGGGGGGGGACGGGGTGG - Intronic
1183197484 22:36363438-36363460 GTAGCTGGAGGGAGAGACAGAGG + Intronic
1183224035 22:36537023-36537045 CCAGCTAGAGAGAGCCAGGGTGG + Intergenic
1183325331 22:37188298-37188320 GGGGATGGAGGGAGAGAGGGCGG + Intronic
1183478702 22:38051018-38051040 ACAGGCTGAGGGAGACAGGGGGG - Intergenic
1183516382 22:38269187-38269209 GGAGGAGGAGGGAGAGAGGGAGG - Intronic
1183543285 22:38442094-38442116 GCAGGTGGCTGGGGACAGGGTGG + Intronic
1183667444 22:39253869-39253891 GCAGCTGGAGAGAGGAAAGGAGG + Intergenic
1183831942 22:40422899-40422921 GCAGGTGGAGCAAGTCAGGGAGG + Intronic
1183865607 22:40701888-40701910 GCAGGTGGAGAGAGGCAGAGGGG - Intergenic
1184116458 22:42425559-42425581 GCAGGAGGCGGCAGACAGGGAGG - Intronic
1184130089 22:42512472-42512494 CCAGCTGGAGGAAGGAAGGGCGG + Exonic
1184148748 22:42626623-42626645 GCAGCTGCGGGGAGGCAGGGTGG + Intronic
1184225608 22:43127528-43127550 GCCGGAGGAGGGATACAGGGAGG + Intronic
1184635448 22:45825100-45825122 GCAGCTTGTGGGAGCCAGGTAGG + Intronic
1184636498 22:45836409-45836431 GCAGGAGGCAGGAGACAGGGAGG - Intronic
1184761493 22:46547265-46547287 GCAGCTGGAGGGCAGCAGGAAGG + Intergenic
1184825471 22:46947695-46947717 GAAGAGGGAGGGAGAAAGGGAGG - Intronic
1184981476 22:48099022-48099044 GCAACGGCAGGGAGACATGGAGG - Intergenic
1185284852 22:49995607-49995629 GCAGCTGGAGAGAGACGTAGGGG + Exonic
1203296096 22_KI270736v1_random:44363-44385 ACTGCTGGAGGGACACAGGTGGG + Intergenic
949295066 3:2511717-2511739 GGAGCTGTAGGGAGAAAGAGGGG - Intronic
950094016 3:10317698-10317720 ACAGCAGGAGGAAGACAGGTGGG + Intronic
950530676 3:13550694-13550716 CCAGCAGGAGGAAGAGAGGGAGG + Intronic
950686915 3:14625125-14625147 GCAGGGGGAGGAAGAGAGGGAGG + Intergenic
952820768 3:37483752-37483774 GGAGCTGGGGGGAGACAGGTGGG + Intronic
952858775 3:37794991-37795013 GAGGGAGGAGGGAGACAGGGTGG - Intronic
953066428 3:39476118-39476140 GGAGCAGGAGAGAGAGAGGGAGG + Intronic
953917786 3:46931606-46931628 GCCCCTGGAGGGAGGCAGAGAGG + Intronic
954010521 3:47632865-47632887 GCAGCCAGAGAGAGATAGGGAGG + Intronic
954145310 3:48631540-48631562 CCAGCTGGAGGGGGGCTGGGAGG - Intronic
954330130 3:49885423-49885445 GCAGCTGGATGGAGAAAGCTGGG + Intergenic
954460894 3:50626282-50626304 GGAGCTGGTGGGAGTCTGGGAGG + Intronic
954758975 3:52860565-52860587 GCAGCTGGAGGGAGCCTGCTGGG - Intronic
954776776 3:53026595-53026617 GCAGCTGTGGGGGCACAGGGAGG - Intronic
955081994 3:55666302-55666324 GCAGGTGGAGGTACAGAGGGAGG - Intronic
955125859 3:56111417-56111439 GGAGCTGGTGAGAGAGAGGGGGG - Intronic
955332602 3:58060048-58060070 GCAGCTGTAAGGATTCAGGGGGG + Intronic
955354989 3:58223765-58223787 GCAGCAGGAGGGGAACAGGTGGG + Intergenic
955356741 3:58237992-58238014 GCCGCTGCAGGGAGACACTGGGG - Intronic
955799084 3:62667794-62667816 GGGGGTGGGGGGAGACAGGGAGG + Intronic
956023490 3:64957434-64957456 ACTGCTGGAGGGAGAAAGAGAGG + Intergenic
956732887 3:72213233-72213255 GTAGCAGGAGGAAGAGAGGGAGG + Intergenic
957416963 3:79917555-79917577 GGAGTGGGAGGGAGAGAGGGAGG + Intergenic
957416970 3:79917577-79917599 GTAGTGGGAGGGAGAGAGGGAGG + Intergenic
957590162 3:82186262-82186284 GCAGCTGGACGATGACAGGGAGG - Intergenic
957733097 3:84168169-84168191 GCAGCTTGTGGGAGCCAGGGTGG - Intergenic
957734674 3:84190036-84190058 GCTGCTGCAGGGAGACATGATGG + Intergenic
958567342 3:95830985-95831007 GCAGCTGGAGAGAGAGAGAGGGG + Intergenic
958888493 3:99755988-99756010 GCACATGAATGGAGACAGGGAGG + Intronic
959811517 3:110625651-110625673 GCAGCTGGAGGGGGACTGGAAGG + Intergenic
959920076 3:111859785-111859807 GCTCACGGAGGGAGACAGGGTGG + Intronic
959932393 3:111998816-111998838 TCAGCGGGAGGGAGGCAGGCGGG + Exonic
960479235 3:118168868-118168890 GGAGCAGGAGGGAGAGAGAGAGG - Intergenic
960584821 3:119311045-119311067 GGAGCTGGAGGCAGACAGAGGGG - Intronic
960595118 3:119401332-119401354 GCAGATGGACCCAGACAGGGGGG - Intronic
960811275 3:121629673-121629695 GCAACTGGAGGGGGAGAGTGCGG - Exonic
960991462 3:123314319-123314341 GGAGCTGGAAGGAGAGAGGAGGG + Exonic
961012169 3:123443686-123443708 GAAGCTGGGGAAAGACAGGGTGG + Intronic
961080870 3:124026370-124026392 GGAGCTGAAGGGAGAGAGAGGGG - Intergenic
961331883 3:126147357-126147379 GCAGCAGGCTGGAGACAGGGTGG + Intronic
961376824 3:126472773-126472795 GCAGTTGGAGGGTGTCAGGGAGG - Intronic
961458978 3:127038328-127038350 GAGGCTGGTGGGAGACAGGTGGG - Intergenic
961645201 3:128389126-128389148 GAGGCTGGAGGGAGGCAGGCAGG + Intronic
961670443 3:128524518-128524540 GGAGCTGGAGGGACTCAGTGGGG - Intergenic
962848183 3:139288890-139288912 GCCCCTGGAGGGAGAGGGGGAGG + Intronic
962970747 3:140399857-140399879 ACAGGGGGAGGGAGGCAGGGAGG - Intronic
962991034 3:140577794-140577816 GCAGTAGGAGAGAGACAGGGAGG - Intergenic
963280845 3:143383673-143383695 TCAGCTGGAGTGGGGCAGGGTGG + Intronic
963511612 3:146254781-146254803 AGAGCTGGAGTGAGACAGAGAGG - Intergenic
963662773 3:148148662-148148684 GTCGATGGAGGGGGACAGGGAGG - Intergenic
963702107 3:148639271-148639293 GCAGCTAGATGGAGGAAGGGTGG + Intergenic
963946122 3:151147193-151147215 ACAGGTGGGGGGAGACAGAGAGG - Intronic
964612882 3:158632450-158632472 GCAGGGGGAGGGGGACTGGGTGG + Intergenic
965013903 3:163131553-163131575 GCAGCAGGAGGCAGAGTGGGGGG + Intergenic
965100314 3:164289639-164289661 GCAGCTGGAGAGAGAATGAGTGG + Intergenic
965212116 3:165804545-165804567 GCAACTGGAGGGAGGTAGAGAGG + Intronic
965286521 3:166826178-166826200 GCCGCTGCAGGGAGACATGATGG + Intergenic
966519721 3:180859993-180860015 GAAGAGGGAGGGAGAGAGGGAGG + Intronic
966914937 3:184579458-184579480 GCAACTGGAGGGAGAAGAGGTGG - Exonic
967245257 3:187480143-187480165 CCAACTGGAGGGAAATAGGGTGG + Intergenic
967303739 3:188041212-188041234 GCAGATGGAGGGACAGAGAGTGG - Intergenic
967386127 3:188912736-188912758 GGGGCAGGAGGGAGAGAGGGGGG + Intergenic
967419849 3:189260810-189260832 GCAGGTGGAGGGAGGAAGGAGGG + Intronic
967492659 3:190111488-190111510 GCAGCTGCAGAAAGATAGGGTGG + Intronic
967624407 3:191668354-191668376 GCAGCTGCACGGAGACATGATGG + Intergenic
967925294 3:194640932-194640954 AGAGCAGGAGGGAGACAGAGGGG + Exonic
968228209 3:196989138-196989160 GCAGCTGGAGCTGGAGAGGGAGG + Intronic
968448952 4:666224-666246 GCAGCTGGGGAGAGGCGGGGAGG - Intronic
968830552 4:2931271-2931293 GCGGCTGGTGGGAGACATCGAGG + Exonic
968943689 4:3652566-3652588 GCAGCTGGTGGGTCAGAGGGAGG + Intergenic
968985427 4:3872045-3872067 GCAGCGTGCGGGAGACAGAGGGG + Intergenic
969028323 4:4191911-4191933 GAAGGGAGAGGGAGACAGGGAGG + Intronic
969143478 4:5100344-5100366 GCAGCTGGGGGGAGGAAGGAAGG - Intronic
969594614 4:8142033-8142055 GCAGCTGGAGGGAGGTGGGCTGG - Intronic
969725821 4:8917560-8917582 GGAGCTGGAGTGTGGCAGGGAGG - Intergenic
970820562 4:20206698-20206720 TTTGCTGGAGGGAGAAAGGGAGG - Intergenic
970990964 4:22212659-22212681 GTAGGTAGAGGGAGAAAGGGAGG + Intergenic
971142904 4:23944398-23944420 GAAGCTGGAGGGAGACAAGAAGG - Intergenic
971385466 4:26137463-26137485 GCAGCTGGCAGGGCACAGGGAGG - Intergenic
972242728 4:37210796-37210818 GGAGCAAGAGGGAGACAGAGGGG + Intergenic
972296659 4:37745692-37745714 GGAGCAGGAGGGAGAGAGAGAGG + Intergenic
972370297 4:38417071-38417093 GGAGCAGGAGGAAGACAGCGAGG + Intergenic
972374409 4:38457066-38457088 GCAGGTGCAGTGAGACAGGCTGG - Intergenic
972543233 4:40057037-40057059 GCGGCGGGTGGGAGGCAGGGAGG + Intronic
972569233 4:40295447-40295469 GGAGCTGGAGGCAGAGATGGAGG - Intergenic
972590693 4:40483405-40483427 GCAGAGGGAGCGAGACAGGCAGG + Intronic
972709277 4:41578241-41578263 GCAGCAGGAGAGAGAGAAGGGGG + Intronic
973362555 4:49178450-49178472 GAAGCTGGTGGGAGCCAGGAAGG - Intergenic
973968925 4:56191412-56191434 AGAGAGGGAGGGAGACAGGGAGG - Intronic
974163224 4:58166935-58166957 GCTGCTTAGGGGAGACAGGGAGG - Intergenic
975541308 4:75514674-75514696 GCCACCGGAGGGAGAGAGGGAGG - Exonic
976410322 4:84705938-84705960 AACGTTGGAGGGAGACAGGGCGG - Intronic
977870323 4:102082891-102082913 GGAGATGGAGGGAGGGAGGGTGG - Intergenic
979197174 4:117933637-117933659 GCAAATGGATGGAGACAGTGAGG - Intergenic
979374633 4:119931781-119931803 ACAGTTGGAAGGAGCCAGGGTGG - Intergenic
979469015 4:121072659-121072681 GCAGCGGGAGGGAGAGAAGGAGG - Intronic
980875643 4:138659421-138659443 GAAGCAGGAGGGAGACAGGCGGG + Intergenic
980879781 4:138698203-138698225 GCAGCAGAAGGGGGACAGAGGGG - Intergenic
982161272 4:152572392-152572414 GCATCTGGAAGGAGACAGAAAGG + Intergenic
982215260 4:153077314-153077336 GTAGAGGGAGAGAGACAGGGAGG - Intergenic
982236345 4:153254400-153254422 TCAGCTGGATGGAAACAGTGGGG + Intronic
982782755 4:159508122-159508144 GCAGCAGGAGGGACAGAGGTGGG + Intergenic
984312899 4:178086197-178086219 ACAGAGGCAGGGAGACAGGGAGG - Intergenic
984339991 4:178444905-178444927 GAAGTGGGAGGGAGAGAGGGAGG + Intergenic
984842448 4:184080828-184080850 GAAGCAGGAGGCAGGCAGGGAGG - Intergenic
984947724 4:184983068-184983090 GGGGATGGAGGAAGACAGGGAGG - Intergenic
985202088 4:187494339-187494361 GGAGCAGGAGGAAGAGAGGGAGG - Intergenic
985372614 4:189302055-189302077 GCAGGTGCAGGCAGGCAGGGTGG - Intergenic
985534626 5:457070-457092 GCAGCAGGCAGGAGGCAGGGGGG + Intronic
985781590 5:1874478-1874500 GGAGTTGGAGGGAGACGGTGAGG + Intergenic
985873908 5:2580963-2580985 GGAGATGGAGGGAGGGAGGGAGG - Intergenic
985913500 5:2900713-2900735 GCAGCTGGAGAGGGAGAAGGTGG - Intergenic
985968074 5:3352845-3352867 GCAGATGGAGGCAGAGATGGGGG - Intergenic
985997423 5:3604761-3604783 GAAGCTGGAGTGAGGGAGGGAGG + Intergenic
986252925 5:6077401-6077423 GCATCTGGAAGGTGACAGGAAGG + Intergenic
986285297 5:6354490-6354512 GAGGCTGGAGGGAGACAGGCTGG + Intergenic
986311390 5:6553460-6553482 ACAGAGGGAGGGAGAGAGGGAGG + Intergenic
986346133 5:6837126-6837148 GGAGCTGGCTGGAGTCAGGGAGG + Intergenic
986501701 5:8407672-8407694 CCAGCTGGCGGGTGGCAGGGGGG + Intergenic
986538865 5:8822367-8822389 GCAGCAGGAGAGAGAGAGAGAGG - Intergenic
986828919 5:11552932-11552954 GCATCTGAAGGAAGACAGAGTGG + Intronic
987249136 5:16080683-16080705 TCAGCTGGATGGAGGCAGGATGG - Intronic
987286712 5:16465068-16465090 GCAGCAGGAGGAGGACAGCGAGG - Exonic
988389490 5:30609386-30609408 GCAGCAGGAGAGAGAAAGAGAGG + Intergenic
988455981 5:31387724-31387746 GGAGCAGGAGGAAGAGAGGGCGG + Intergenic
989445386 5:41522577-41522599 GCAGCAGGAGGGAGAGAGTGTGG + Intergenic
989637744 5:43555116-43555138 ACAACTGGAAGGAGACAGAGTGG + Intronic
989814937 5:45724466-45724488 GGAGATGGAGGGAGAGAGGGAGG - Intergenic
990997250 5:61745186-61745208 ACAGGCGGAGGGAGACAGAGAGG + Intronic
991418933 5:66421159-66421181 TCTGCTGGAGGGACAGAGGGAGG + Intergenic
992249941 5:74866491-74866513 GGGGCTGGAGGGAGGCAGGGCGG - Intronic
992640935 5:78767907-78767929 CCAGCTGGGAGGAGACAGGAAGG - Intronic
992645668 5:78808804-78808826 GATGCTGGAGGGACACAGGATGG + Intronic
992663669 5:78985170-78985192 GCAGCGGGAGGACGACGGGGAGG + Exonic
992753567 5:79883389-79883411 ACAGCTTGTGGGAGCCAGGGTGG - Intergenic
992966145 5:82002642-82002664 GAAGGTGGAGGGAGAGAGGAGGG + Intronic
993526655 5:88973650-88973672 AAAGATGGAGGGAGAGAGGGAGG + Intergenic
993613646 5:90084429-90084451 GTAGGTGCAGGCAGACAGGGAGG + Intergenic
994042460 5:95274360-95274382 GCAGATGGAAGGAGACAGTGTGG - Intronic
994082190 5:95719226-95719248 GCAACTGGAGAGAGACAGACGGG + Intronic
994149509 5:96432254-96432276 GAAGCTGGGGGGAGAAATGGTGG - Intronic
995815116 5:116158504-116158526 TCAGCCTGAGGGAGAAAGGGGGG - Intronic
996416628 5:123217745-123217767 GAAGAGGGAGGGAGAAAGGGAGG + Intergenic
996418260 5:123233418-123233440 ACAGATGGAGAGAGAAAGGGGGG + Intergenic
996882665 5:128317692-128317714 GAAGTTGGAAGGTGACAGGGAGG - Intronic
997767910 5:136523871-136523893 GCAGCAGGAGAGAGAGAGAGGGG + Intergenic
998065915 5:139158540-139158562 GCAGGTGGAGGGAGCAGGGGTGG - Intronic
998112983 5:139516365-139516387 ACAGCTGGAGGGGGACTGGAAGG + Intergenic
998511132 5:142714862-142714884 ACAGCAGGAGAGAGACAGGAAGG - Intergenic
999277136 5:150338891-150338913 GCAGCTGGGGATAGACAGGGTGG - Intronic
999390538 5:151186390-151186412 GGAGGGGGAGGGAGATAGGGAGG + Intronic
999428575 5:151507216-151507238 GCAGCTGGCGGGAGTCTGGGGGG + Exonic
999717066 5:154369840-154369862 GCAGCAGAAGGGAAGCAGGGAGG - Intronic
999758552 5:154682950-154682972 GGAGCTGGAGGGAGGCGGAGGGG - Intergenic
999913647 5:156233730-156233752 GCAGCTAGAGCCAGGCAGGGTGG + Intronic
1000359565 5:160434502-160434524 GTAGTTGGAGGCAGAGAGGGTGG + Intergenic
1000552318 5:162682360-162682382 GAAGCAGGAGGAAGAGAGGGAGG + Intergenic
1000808387 5:165827230-165827252 GCAGCTTGCGGGAGTCAGAGTGG - Intergenic
1001067087 5:168544139-168544161 GGAGCTGGAGGAAGACAGGGAGG - Intergenic
1001396501 5:171422185-171422207 GGAGCTGGAGGGAGGGAGTGTGG + Intronic
1001596252 5:172900784-172900806 GCGGCTGGAGAGAGGGAGGGAGG + Intronic
1001862526 5:175070055-175070077 GGAGCAGGAGGGAGACAAGGGGG + Intergenic
1002017438 5:176336071-176336093 GGAGAGGGAGGGAGGCAGGGAGG + Intronic
1002058136 5:176610236-176610258 GCGGCCGGAGGGAGCGAGGGAGG + Intergenic
1002194457 5:177494678-177494700 GTGGCTGGAGAGAGGCAGGGAGG + Intronic
1002453230 5:179331391-179331413 GAAGCTGGAGGGAGAGGAGGGGG + Intronic
1002459127 5:179364286-179364308 GGAGAGGGAGGGAGACACGGAGG + Intergenic
1002522618 5:179800050-179800072 GCAGCTGGAGGATGACATCGTGG - Exonic
1002567171 5:180118701-180118723 GGTGCTGGAAGGAGACAGGGAGG + Exonic
1002589853 5:180282978-180283000 GAAGCTGGAGAGAGAAAAGGAGG + Intronic
1002702128 5:181131516-181131538 GCAGCTGGAGTGGGGCAGGCTGG + Intergenic
1002800472 6:517119-517141 CCAGTTGGGGGTAGACAGGGTGG + Intronic
1004335850 6:14763804-14763826 CCAGCCTGTGGGAGACAGGGTGG - Intergenic
1004924434 6:20403586-20403608 GGCGCTGGAGGGGGAGAGGGGGG + Intronic
1005440994 6:25868522-25868544 CCATCTGGTTGGAGACAGGGAGG + Intronic
1005477355 6:26220610-26220632 GCACTTGGAGGGAAGCAGGGAGG - Intergenic
1005507972 6:26486449-26486471 GCAGCAGGAGAGAGAGAGGGAGG + Intergenic
1005511183 6:26512970-26512992 GGAGCTGGAGGGAAAAAGGAAGG - Intergenic
1005672659 6:28122930-28122952 GCAGAAGCAGGGAGACAGGTTGG - Intergenic
1006099413 6:31676834-31676856 GTGGCTGGAGGGAGGCAAGGAGG + Exonic
1006153530 6:32001887-32001909 AGGGCTGGGGGGAGACAGGGAGG + Intronic
1006159838 6:32034624-32034646 AGGGCTGGGGGGAGACAGGGAGG + Intronic
1006183225 6:32166383-32166405 TCATCTGGAGGGAGAGCGGGGGG + Intronic
1006184972 6:32176259-32176281 GCAGCTGGAGCCAGAGATGGGGG - Intronic
1006299369 6:33185535-33185557 GCTGCAGCAGAGAGACAGGGAGG + Intronic
1006342217 6:33452968-33452990 GGAGCTGGCGGGAGGGAGGGAGG - Exonic
1006373583 6:33659668-33659690 GGAGGTGGAGGGAGGCTGGGGGG - Intronic
1006378407 6:33684301-33684323 GTAGCTGGAGGGAGGCAGTGTGG + Intronic
1006385866 6:33730617-33730639 CCAGCAGGTGGAAGACAGGGTGG - Intronic
1006443859 6:34068142-34068164 CGTGCTGGAGGGAGACGGGGGGG + Intronic
1007177971 6:39909348-39909370 GGAGCGGGAGAGGGACAGGGCGG + Intronic
1007293097 6:40801816-40801838 GTGGCAGGAGGGAGACTGGGAGG + Intergenic
1007344914 6:41222341-41222363 GAAGCAGGAGGGAGACCTGGTGG + Intergenic
1007484112 6:42168779-42168801 GAAGCTGGAGGAAGACTGGAGGG - Intronic
1007505102 6:42329469-42329491 GCAGCTGGAGGGTGGGAGGTTGG - Intronic
1007578225 6:42939507-42939529 GCAGCAGGAGAGAGGGAGGGAGG - Intergenic
1007615790 6:43179281-43179303 GCCGCAGGAGGGAGGCGGGGAGG + Exonic
1007777814 6:44233559-44233581 GGGGCAGGAGGCAGACAGGGAGG - Exonic
1009421564 6:63470095-63470117 ACAGAGGGAGGGAGAGAGGGAGG + Intergenic
1009536325 6:64891372-64891394 GCAGGTGGAGGGAGGAAAGGAGG - Intronic
1010155084 6:72783177-72783199 GCAGCTGTAGAGAGAGATGGTGG + Intronic
1010368282 6:75078021-75078043 GCAGCAGGGAGGATACAGGGAGG + Intergenic
1010386363 6:75284849-75284871 CCAGAGGGAGGGAGAGAGGGAGG + Exonic
1011441069 6:87387906-87387928 GCAGCTGGAGGGCCGCAGAGAGG + Intronic
1011518544 6:88179525-88179547 GCAGGAGTAGGGGGACAGGGTGG - Intergenic
1011534437 6:88360802-88360824 GAGGCAGGTGGGAGACAGGGAGG - Intergenic
1011544635 6:88469858-88469880 GCAGCTGGAGAGAGAATGGAGGG - Intergenic
1011745491 6:90403886-90403908 GGAGCTGGTAGGAGACTGGGAGG - Intergenic
1012098148 6:94993014-94993036 CCAGCTAGAGGGAGACAAAGCGG - Intergenic
1012311605 6:97732160-97732182 GTAGCTGTAGGGAAACAGTGCGG + Intergenic
1012981090 6:105831111-105831133 GCAGCTGGAGGAGGAGAAGGGGG + Intergenic
1013040160 6:106425241-106425263 AGAGCTGGAAGGAGAGAGGGTGG - Intergenic
1013056830 6:106591021-106591043 CCAGCTGGAGGGATACAGCAGGG + Intronic
1013170494 6:107633927-107633949 GTGGCTGGACGGAGACAGGAGGG - Exonic
1013292025 6:108728129-108728151 GGAGCTGGAGGGGGACTTGGAGG + Intergenic
1013643080 6:112107210-112107232 GAAGCCTGAGGGAGAGAGGGAGG - Intergenic
1013900370 6:115148501-115148523 GTGGCAGGAGGGAGAAAGGGAGG + Intergenic
1013961735 6:115909030-115909052 GCAGCTGGAGAGAGACAGGAAGG + Intergenic
1016235986 6:141867340-141867362 GCAGCATGAAGGAAACAGGGAGG + Intergenic
1016272082 6:142301598-142301620 CCAGCTGGGAGGGGACAGGGCGG - Intergenic
1016324410 6:142883184-142883206 GCACATGGAGAGAGAAAGGGGGG + Intronic
1016899911 6:149091222-149091244 CCTGCAGGAGGGAAACAGGGAGG - Intergenic
1016981654 6:149860404-149860426 ACAGCAGGAGGGAGGGAGGGAGG - Intronic
1017381141 6:153831573-153831595 GGTGCTGGAGGGAGACAGAGAGG + Intergenic
1017416768 6:154229070-154229092 GGGGCTGGAGGCAGACATGGGGG - Intronic
1017446336 6:154510293-154510315 GCAGCTGGAGGGAGAGGGCCGGG - Exonic
1017739306 6:157392795-157392817 GTCTCTAGAGGGAGACAGGGAGG - Intronic
1017739716 6:157396067-157396089 ATATCTAGAGGGAGACAGGGAGG - Intronic
1018414468 6:163589314-163589336 GCAGCTGGAGGAAAATAAGGAGG + Intergenic
1018473962 6:164122254-164122276 GCTGCTGGAGGGAGCCCAGGGGG + Intergenic
1018559820 6:165090272-165090294 GGAAGTGCAGGGAGACAGGGAGG - Intergenic
1019158123 6:170052568-170052590 AGAGATGGAGGGAGAGAGGGAGG - Intergenic
1019158144 6:170052638-170052660 GGAGAGGGAGGGAGAGAGGGAGG - Intergenic
1019158152 6:170052660-170052682 GGAGAGGGAGGGAGAGAGGGAGG - Intergenic
1019158160 6:170052682-170052704 AGAGATGGAGGGAGATAGGGAGG - Intergenic
1019158186 6:170052762-170052784 GGAGGGGGAGGGAGAGAGGGAGG - Intergenic
1019158237 6:170052863-170052885 GGAGGGGGAGGGAGAGAGGGAGG - Intergenic
1019232976 6:170584395-170584417 GCAGCAGGAAGGAGAGCGGGCGG + Exonic
1019327606 7:446004-446026 GAAGGAGGAGGGAGAGAGGGAGG + Intergenic
1019345085 7:525730-525752 GGGGCTGGAGGAGGACAGGGAGG + Intergenic
1019359036 7:595338-595360 GCAGGTGGAGGCAGACGGAGTGG - Intronic
1019404924 7:877956-877978 CCAGGAGGAGGGAGGCAGGGAGG - Intronic
1019420059 7:946567-946589 GCACCAGGAGGGAGAGAGGGTGG - Intronic
1019473324 7:1232652-1232674 GGAGCCGGAGGGAGGGAGGGAGG - Intergenic
1019494441 7:1331246-1331268 GCAGCTCCAGGGAGACCGGGGGG - Intergenic
1019587280 7:1812493-1812515 GCAGTGGGAGGGAGGGAGGGAGG + Intergenic
1019613980 7:1950625-1950647 GCAGCTGGGGGCAGACATTGAGG - Intronic
1019740451 7:2670405-2670427 GCAGGTGGAGGCAGAGTGGGAGG + Intergenic
1019743650 7:2688066-2688088 GCAGCTGGAGGGAGTGGGGCAGG + Intronic
1019744515 7:2692183-2692205 GCTCCTGGAGGAAGACAGGTGGG + Intronic
1019767977 7:2865414-2865436 GTAGCTGTAGGGTGTCAGGGAGG + Intergenic
1019991831 7:4697180-4697202 GCATCTGGAGGAAAAGAGGGAGG + Intronic
1020115846 7:5475939-5475961 TCAGCGGGACGGGGACAGGGAGG + Intronic
1020188077 7:5974032-5974054 GCAGCTGGGGTGAGGAAGGGAGG - Intronic
1020209330 7:6146780-6146802 GCAGCTGCAGGGAGAGGTGGTGG + Intronic
1020275893 7:6624177-6624199 GCAGCTGGGGGGAGAGGGGCAGG - Exonic
1020294841 7:6750737-6750759 GCAGCTGGGGTGAGGAAGGGAGG + Intergenic
1020616094 7:10464527-10464549 GGAGCAGGAGGAAGAGAGGGTGG - Intergenic
1020626812 7:10591275-10591297 GAAGCGGGAGGGAGAGAGGGGGG + Intergenic
1020678479 7:11207762-11207784 GCAGCTAGAGGGAGAGATGCTGG - Intergenic
1021839132 7:24708012-24708034 ACAGCTGTAGGGAGAAAAGGAGG + Intronic
1022091473 7:27110467-27110489 GGCGCTGGAGGGAGACTGGAGGG + Exonic
1022359872 7:29647574-29647596 GTAGCTGGAGTGATGCAGGGAGG - Intergenic
1022368675 7:29750236-29750258 GTAGCTGGAGTGATGCAGGGAGG - Intergenic
1022546939 7:31198649-31198671 GCAGCAGAAGGGAGCCTGGGAGG - Intergenic
1022830812 7:34064619-34064641 CCAGCTGGAGGGGCACTGGGAGG + Intronic
1022977806 7:35575005-35575027 GCAGGTGGAGGGAGGACGGGAGG - Intergenic
1022993207 7:35728619-35728641 GGAGCTGGAGGGACAGAGGGAGG + Intergenic
1023267058 7:38417792-38417814 GCAGATGGAGGGTGAGAGGGAGG + Intronic
1023384012 7:39636832-39636854 GGAGCAGGAGAGAGACACGGGGG + Intronic
1023560664 7:41470284-41470306 GCAGCTACAGTCAGACAGGGAGG - Intergenic
1023882865 7:44330301-44330323 GCAGCAGGATAGAGAAAGGGAGG + Intronic
1024064214 7:45719127-45719149 GTCTCTGGAGGCAGACAGGGTGG + Exonic
1024532753 7:50406979-50407001 GCAGCTGGAATGAGATAAGGGGG - Intergenic
1024713957 7:52053294-52053316 GCATCTGGAGGGAGGGAGGGAGG - Intergenic
1024957035 7:54933262-54933284 GCAGCTGGTGGCAGAGAGGGAGG + Intergenic
1025106352 7:56174776-56174798 ACGGCTGCAGGGAGCCAGGGCGG + Intergenic
1025295414 7:57772315-57772337 GCAGCTGCACGGCGGCAGGGGGG - Intergenic
1026530070 7:71189534-71189556 GCAGTTGGAGGGAGGAAGGCAGG + Intronic
1026551569 7:71373363-71373385 GCTGGTGAAGGGAGGCAGGGAGG + Intronic
1026793813 7:73352852-73352874 GCAGCAAGAGGCAGACAGAGGGG + Intronic
1026865994 7:73824395-73824417 GGAGCCGGAGGGAGTCGGGGAGG + Intronic
1027627438 7:80563668-80563690 GCAGTTGGAGGGGGAGCGGGTGG + Intronic
1028478407 7:91276494-91276516 GCAGGAGGAGTGAGAGAGGGAGG - Intergenic
1028700413 7:93772273-93772295 GGAGCTGGAGTGGGAGAGGGAGG + Intronic
1029050851 7:97685483-97685505 GCAGCTGAAGGGAGCTAGGAAGG - Intergenic
1029373787 7:100166197-100166219 GCACCTGGAGGGAGAGTTGGGGG + Intronic
1029543095 7:101196103-101196125 GCAGGGAGAGGGAGACAGGTGGG + Intronic
1029737410 7:102472490-102472512 GGAGCTGGAGGCAGACGTGGGGG + Exonic
1030877750 7:114836380-114836402 GAATCAGGAGGGAGAGAGGGAGG - Intergenic
1031754315 7:125618605-125618627 GCCGCTGGAGGGGGAGAGGCTGG + Intergenic
1032191590 7:129768994-129769016 GCACCTGCTGGGACACAGGGAGG - Intergenic
1032240149 7:130153773-130153795 TCAGGTGGAGGGAGGCAGGGTGG - Intergenic
1032928417 7:136636818-136636840 GGAGAGGGAGGGAGACAGAGAGG + Intergenic
1033265827 7:139886220-139886242 GCAGCTTGAGGGTGAGATGGAGG - Intronic
1033683941 7:143621952-143621974 GAAGCAGGAGGGAGAGAGGAAGG + Intronic
1033687117 7:143701141-143701163 GAAGCAGGAGGGAGAGAGGAAGG + Intronic
1033700671 7:143835686-143835708 GAAGCAGGAGGGAGAGAGGAAGG - Intergenic
1033874290 7:145795238-145795260 AAAGATGGAGGGAGAGAGGGAGG + Intergenic
1034398413 7:150845640-150845662 GCAGCTGGAGGGAGGAATGTGGG + Intronic
1034520306 7:151614319-151614341 GCAGCAGCAGGGTGGCAGGGAGG + Intronic
1034671124 7:152859195-152859217 GCAACTGGTGAGAGACCGGGTGG + Intergenic
1034876653 7:154730302-154730324 GGAGCTGCAGGGACCCAGGGAGG + Intronic
1035048488 7:155984439-155984461 GCAGCTGGAGTGGGACAGCCAGG - Intergenic
1035158726 7:156935429-156935451 TGAGCTGGTGTGAGACAGGGAGG + Intergenic
1035259906 7:157654342-157654364 GGTGCTGGTGGGAGTCAGGGTGG - Intronic
1035537826 8:406276-406298 GCGGCTGGAGGGAGAGAGGCAGG - Intergenic
1035754751 8:2022908-2022930 GCAGACAGAGGGAGGCAGGGAGG - Intergenic
1035854265 8:2957449-2957471 GCCTCTGGAGGGAGCCAGGGAGG - Intronic
1035864213 8:3064371-3064393 GCAGCAGGAGGGAGAGAGCTAGG - Intronic
1036642509 8:10593096-10593118 TCAGCTGGTAGGAGCCAGGGAGG + Intergenic
1036963754 8:13273741-13273763 GGGGAGGGAGGGAGACAGGGAGG + Intronic
1037169432 8:15873949-15873971 GGAGAAGGAGGGAGGCAGGGAGG - Intergenic
1037596939 8:20362052-20362074 GCAGTTAGAGGGAGTCAGGGAGG + Intergenic
1037686172 8:21141442-21141464 GGAGATGGAGGGGGACATGGGGG + Intergenic
1037780831 8:21867981-21868003 TCAGCTGGATAGAGACAGGCTGG + Intergenic
1037880762 8:22572388-22572410 GCTGCGCGAGGGGGACAGGGTGG + Exonic
1038704419 8:29880484-29880506 GCAGCAGGAGGGACAGAGGGAGG + Intergenic
1039672124 8:39613044-39613066 GCAGCAACAGGGAGACATGGTGG - Intronic
1039880108 8:41620307-41620329 GCTGCTGCAGGGAGGCACGGGGG + Intronic
1040017205 8:42709251-42709273 GGCTCTGCAGGGAGACAGGGTGG + Intronic
1040284990 8:46094976-46094998 GCAGCTGTGGGGACACAGGCGGG + Intergenic
1040436948 8:47399926-47399948 GCCGCTGGAGGGAGGCAGTTCGG + Intronic
1040450651 8:47542843-47542865 GGTTCTGGAGGGTGACAGGGTGG - Intronic
1040592890 8:48811436-48811458 GAAGGTGGAGGAAGAAAGGGAGG + Intergenic
1041661039 8:60401431-60401453 GCAGCAGGAGGGAGACTCTGAGG + Intergenic
1042021314 8:64373238-64373260 GCAGAGGGAGGGAGGCAGGGAGG + Intergenic
1042033699 8:64506855-64506877 GCAGCAAGAGGGAGAGAAGGAGG - Intergenic
1043040760 8:75259478-75259500 GCTGTTGGAGGGAGGCACGGTGG + Intergenic
1043463767 8:80486161-80486183 ACCGCTGGAGGGGGAAAGGGTGG - Intronic
1043755601 8:84000184-84000206 GCAGCTGGAGGGGGAAAGCTGGG + Intergenic
1044396357 8:91717526-91717548 GGAGCTGGAGGGAGGAAGGAAGG + Intergenic
1044999228 8:97865790-97865812 TCTACTTGAGGGAGACAGGGAGG + Intergenic
1045305456 8:100952816-100952838 GCGGCGGGAGGGAGGCCGGGAGG - Intronic
1045489386 8:102656843-102656865 CCAGCTGGTGGGAGGCAGGCTGG + Intergenic
1045558899 8:103241596-103241618 TCAGCTGGAGGGAGAGGGGCAGG + Intergenic
1045987673 8:108267849-108267871 GGAGCTGGAAGGAGAAAGGGAGG + Intronic
1046787479 8:118283732-118283754 GCAGATGGAGGGAAACAGAATGG + Intronic
1047767696 8:128002926-128002948 AGAGAGGGAGGGAGACAGGGAGG - Intergenic
1047987111 8:130246533-130246555 GCCGCTGGAGAGAGAGAGAGTGG - Intronic
1048163439 8:132041153-132041175 GCAGCTGTAGGAAGGCCGGGAGG + Exonic
1048546985 8:135396460-135396482 ACAGCTGGAGGAAGATCGGGAGG + Intergenic
1048975747 8:139672220-139672242 GCAGCTGGATGAAGTCAGGTGGG - Intronic
1048981252 8:139704219-139704241 GCTGCGGGAGGGAGGGAGGGAGG - Intergenic
1048984952 8:139730324-139730346 GCAGATGCAGGGAGGCAGGGAGG + Exonic
1049014525 8:139910197-139910219 GCAGCTGGAGGAAGAGCGGCGGG - Exonic
1049090436 8:140510514-140510536 GCAGCTGGGAGGAGAGAGGCAGG - Intergenic
1049174710 8:141184770-141184792 ACAGAGGGAGGGAGGCAGGGAGG - Intronic
1049447366 8:142637431-142637453 TGAGCTGGAGGGAGACAGTGAGG + Intergenic
1049470006 8:142771009-142771031 GCACAGGGAGGGAGACAGGCAGG - Intronic
1049530407 8:143151693-143151715 TCCCCTTGAGGGAGACAGGGAGG - Intergenic
1049642252 8:143720981-143721003 GAACCTGCAGGGAGCCAGGGAGG - Exonic
1049667435 8:143852510-143852532 GCAGCCGGCTGGAGACTGGGAGG - Intergenic
1049766369 8:144357118-144357140 CCAGCTGCGGGGAGACAGAGGGG + Exonic
1049935305 9:496009-496031 CCAGCTGGAAGGGGTCAGGGTGG + Intronic
1050294667 9:4193699-4193721 TGAGCTGGAGGGAGGCTGGGAGG + Intronic
1050499114 9:6276259-6276281 GAAGACGGAGGGAGAGAGGGAGG + Intergenic
1050610285 9:7344931-7344953 GAAGGTGGAGAGAGACAGAGAGG + Intergenic
1050694039 9:8259728-8259750 GGAGCTGGAGTGATACTGGGGGG - Intergenic
1051472261 9:17457991-17458013 TCAGCTGGAGGGAGGCATGGGGG - Intronic
1052287866 9:26807172-26807194 GCAGGTGGAGGTAGGCAGGGTGG - Intergenic
1052763951 9:32621230-32621252 GGAGGAGGAGGGAGAGAGGGAGG + Intergenic
1053083544 9:35197757-35197779 GGAGCAGGAGGGAGAGAAGGTGG - Intronic
1053807846 9:41821607-41821629 GTAGGGGGTGGGAGACAGGGAGG - Intergenic
1053840064 9:42183501-42183523 GCAGCAGGAGGGGGAGGGGGAGG - Intergenic
1054097119 9:60914249-60914271 GCAGCAGGAGGGGGAGAGGGAGG - Intergenic
1054118525 9:61189878-61189900 GCAGCAGGAGGGGGAGAGGGAGG - Intergenic
1054589232 9:66992686-66992708 GCAGCAGGAGGGGGAGAGGGAGG + Intergenic
1054622746 9:67365821-67365843 GTAGGGGGTGGGAGACAGGGAGG + Intergenic
1055152965 9:73025205-73025227 ACAGTTGGCTGGAGACAGGGTGG - Intronic
1055676418 9:78666915-78666937 GGAGATGGAGGAAGAAAGGGTGG + Intergenic
1055723433 9:79201025-79201047 GCTGCTGCAGGGAGACACAGGGG - Intergenic
1056355012 9:85791539-85791561 GGAGTGGGAGGGAGACAGGGGGG + Intergenic
1056674750 9:88665857-88665879 GAAGCAGGAGGGAGAGAGAGAGG + Intergenic
1056731066 9:89167112-89167134 CCAGCAGGAGGGAGGGAGGGAGG + Intronic
1056814204 9:89789827-89789849 GCAGCAGGAAGGAGAAAGAGAGG + Intergenic
1056823434 9:89860434-89860456 GCAGCTGGTGGTGGACAGGCAGG + Intergenic
1056832804 9:89930388-89930410 GCAGCGGGAAGGACACCGGGCGG + Intergenic
1056968380 9:91182995-91183017 GGAGCAGGAGGGAGGCAGAGTGG - Intergenic
1057083243 9:92188302-92188324 GCAGATGGAGGGACAGTGGGTGG + Intergenic
1057142753 9:92737498-92737520 GCAGCGCGTGGGAGACTGGGTGG + Intronic
1057165476 9:92921788-92921810 GAAGAAGGAGGAAGACAGGGAGG - Intergenic
1057201815 9:93144543-93144565 GCAACTGGAGGGAGAGAGGCAGG + Intergenic
1057210584 9:93199015-93199037 CCAGCTGGAGGGGGCCAGGCTGG - Intronic
1057697060 9:97330701-97330723 GAAGCTGGAGGAAGAGAAGGAGG + Exonic
1057791670 9:98128716-98128738 ACACCTGAAGGCAGACAGGGAGG + Exonic
1058368468 9:104236067-104236089 GGAGAGGGAGGGAGAGAGGGAGG + Intergenic
1059348993 9:113651223-113651245 ACAGCTGCGGAGAGACAGGGAGG - Intergenic
1059465730 9:114467618-114467640 GCAGGTGCTGGGGGACAGGGTGG + Intronic
1059472223 9:114514322-114514344 GGAGCAGGAGGGAGAGAGAGGGG + Intergenic
1059539025 9:115112462-115112484 GCTGCTGTGGAGAGACAGGGAGG - Intronic
1059727918 9:117027544-117027566 GGAGGTGGGGGGAGAGAGGGAGG - Intronic
1059814920 9:117901368-117901390 GAAGAGGGAGGGAGAAAGGGAGG + Intergenic
1059863242 9:118487541-118487563 GCAGCTGCATGGAGACATGATGG + Intergenic
1060018511 9:120108097-120108119 TCAGTTGGAGGGACACAGGGTGG + Intergenic
1060039166 9:120284811-120284833 GAATATGGAAGGAGACAGGGAGG + Intergenic
1060221016 9:121764152-121764174 GCAGCGGGAGTGAGACTGGCAGG + Intronic
1060505088 9:124191776-124191798 GCAGCAGGAGGCAGCCAGTGGGG + Intergenic
1060821705 9:126665168-126665190 GGAGCTGGAGGAAGCCAGAGAGG - Intronic
1061039521 9:128131849-128131871 GCAGCTGGCGGTGGACAGGCAGG - Intergenic
1061305491 9:129730357-129730379 GTTGCTACAGGGAGACAGGGAGG - Intergenic
1061493875 9:130960874-130960896 GCTGCTGGAGGGGGAATGGGAGG - Intergenic
1061887365 9:133598588-133598610 GCTGCTGGTGGGAGAGAGGGAGG + Intergenic
1061890365 9:133616039-133616061 GCAGCTTCTGGGAGACCGGGAGG + Intergenic
1061967545 9:134024928-134024950 GGAGCTGGAGGAAGACGTGGAGG - Intergenic
1062079922 9:134618406-134618428 GGAGCTGGAGGAAGCCAAGGAGG - Intergenic
1062158393 9:135066708-135066730 GCAGTTGGAGGGACACATGCAGG + Intergenic
1062227363 9:135460278-135460300 CCAGGTGCAGGGAGACAGGTGGG + Intergenic
1062267470 9:135693859-135693881 GGAGCTTGAGGCAGACAGGTGGG + Intronic
1062275176 9:135727123-135727145 GAAGAGGGAGGGAGAGAGGGAGG - Intronic
1062509830 9:136898761-136898783 GCAACTCCAGGGAGCCAGGGGGG - Exonic
1062680741 9:137778559-137778581 GAGGCTGGAGGCAGACAGAGGGG - Intronic
1062724900 9:138066477-138066499 GCAGGAGGAGAGAGACAGAGGGG + Intronic
1186005462 X:5065997-5066019 AGAGCAGGAGGAAGACAGGGAGG + Intergenic
1186103318 X:6179730-6179752 GCAGCTGGAAAGAGACAGACTGG + Intronic
1186375519 X:8995132-8995154 ATAGCTGTAGGGAGAGAGGGTGG - Intergenic
1186496241 X:10014897-10014919 GGAGCGGGAGGGAGAGAGCGAGG + Intergenic
1186714485 X:12235993-12236015 ACAGGTGGAGGGAGATAGGCCGG - Intronic
1186720775 X:12301178-12301200 CCAGCTGTAGTGAGTCAGGGAGG - Intronic
1187236093 X:17468964-17468986 GCAGGTGGACAGAGACAGGAAGG - Intronic
1187259945 X:17676235-17676257 GGAGCTGGAGTGGGACAGGCAGG - Intronic
1188204247 X:27333075-27333097 GCAGGTGGAGGGAGAAACAGGGG + Intergenic
1189204041 X:39222459-39222481 GCAGCTGCAGGGAGGGAGAGGGG - Intergenic
1189208991 X:39266931-39266953 CCAGCTGGAGGGATTCAGGGAGG - Intergenic
1189288104 X:39866435-39866457 GGAGGTGGAGGGAGAGAGGAAGG + Intergenic
1190179278 X:48177675-48177697 GGGGCTGGAAGGAAACAGGGTGG + Intergenic
1190491887 X:50990628-50990650 GCAGCTGAGGGCAGAGAGGGAGG - Intergenic
1190501275 X:51081052-51081074 GCAGCTGAGGGCAGAGAGGGAGG + Intergenic
1190598530 X:52068221-52068243 GCAGCTGCAGGGGGAGGGGGCGG + Exonic
1190610294 X:52185852-52185874 GCAGCTGCAGGGGGAGGGGGCGG - Exonic
1190628721 X:52364273-52364295 GCAGCTGCAGAAAGACATGGTGG + Intergenic
1190708264 X:53048467-53048489 GGAGGAGGAGGGAGGCAGGGAGG - Intergenic
1190713743 X:53087561-53087583 GGAGATGGAGGGAGGCAGGAAGG - Intronic
1192176216 X:68887179-68887201 GGAGAAGGAGGGAGACAGAGAGG - Intergenic
1192732396 X:73814269-73814291 GCAGCTGGTGGGAGAAAGTATGG + Intergenic
1193007960 X:76642404-76642426 GCTGTTGGAGGGAGGCATGGTGG - Intergenic
1195112761 X:101664154-101664176 GAAGGTGGAGGAGGACAGGGAGG + Intergenic
1195293438 X:103451386-103451408 GAAGCTGGAGGGAGACAGGTAGG - Intergenic
1195497400 X:105552608-105552630 GCAGATGGAGGAAGACAGAGAGG - Intronic
1195923178 X:110002644-110002666 GCAGGGGGAGGAAGACGGGGAGG + Intronic
1196992427 X:121344868-121344890 GCCGCTGCATGGAGACATGGTGG + Intergenic
1197634789 X:128902759-128902781 GAAGCGGGAGGGAGATAGGGAGG + Intergenic
1197893167 X:131285804-131285826 GCTACTGGAAGGAGACAGGCTGG - Exonic
1198457924 X:136835658-136835680 GCTGCTTGAGGGAGGGAGGGAGG + Intergenic
1199146853 X:144379123-144379145 ACAGCTGGGGGGAGGCAGTGGGG + Intergenic
1199533680 X:148878024-148878046 GAAGCTGAAGGGAGACTGAGAGG + Intronic
1200115649 X:153768670-153768692 GCAGCTATGGGGAGACAGGAAGG - Intronic
1200126342 X:153816567-153816589 GGAGCTGAAGGGAGAGACGGTGG + Intronic
1200337947 X:155369844-155369866 GGAGAAGGAGGGAGAGAGGGAGG + Intergenic
1200348523 X:155471382-155471404 GGAGAAGGAGGGAGAGAGGGAGG - Intergenic
1200756438 Y:6994742-6994764 GCACATGGAGGGAGACAGTGGGG + Intronic
1200802251 Y:7397609-7397631 GCAGCTGGAGGGGAAGATGGGGG - Intergenic
1201438507 Y:13985212-13985234 GTGTCAGGAGGGAGACAGGGGGG - Intergenic
1201446066 Y:14057496-14057518 GTGTCAGGAGGGAGACAGGGGGG + Intergenic
1201859356 Y:18578675-18578697 GCAGCTTGAGAGAGAAAGTGAGG - Intronic
1201873965 Y:18741706-18741728 GCAGCTTGAGAGAGAAAGTGAGG + Intronic