ID: 948964546

View in Genome Browser
Species Human (GRCh38)
Location 2:241367327-241367349
Sequence ATTTCTCATTAGCAGTTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 283}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948964541_948964546 -8 Left 948964541 2:241367312-241367334 CCTGCCCAGCCAGCCATTTCTCA 0: 1
1: 0
2: 1
3: 32
4: 383
Right 948964546 2:241367327-241367349 ATTTCTCATTAGCAGTTTGAAGG 0: 1
1: 0
2: 2
3: 28
4: 283
948964540_948964546 -5 Left 948964540 2:241367309-241367331 CCACCTGCCCAGCCAGCCATTTC 0: 1
1: 0
2: 5
3: 38
4: 612
Right 948964546 2:241367327-241367349 ATTTCTCATTAGCAGTTTGAAGG 0: 1
1: 0
2: 2
3: 28
4: 283
948964539_948964546 -4 Left 948964539 2:241367308-241367330 CCCACCTGCCCAGCCAGCCATTT 0: 1
1: 0
2: 4
3: 73
4: 907
Right 948964546 2:241367327-241367349 ATTTCTCATTAGCAGTTTGAAGG 0: 1
1: 0
2: 2
3: 28
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948964546 Original CRISPR ATTTCTCATTAGCAGTTTGA AGG Intronic
901507784 1:9696785-9696807 ATTTCTAAATAACAGTTTTATGG - Intronic
903773803 1:25780482-25780504 ATTTCACATTAGCATATTAAAGG + Intronic
903946794 1:26969091-26969113 TTTTCTCATTGGCAAATTGAGGG - Intergenic
907982308 1:59496019-59496041 AAATGTCATTGGCAGTTTGATGG + Intronic
908190510 1:61698634-61698656 ATTTATAATTAGCACTATGAAGG + Intronic
910688081 1:89938806-89938828 TTTTCTCACTAGCAGTTAGTTGG + Intergenic
913139760 1:115929180-115929202 ATGTATAATTAGCAGTTTCAAGG - Intergenic
916238621 1:162615854-162615876 ATTTTTCTTTAGGAGTTTAATGG + Intergenic
917901764 1:179549770-179549792 ATTTCTCATTATCACTGTGTTGG - Intronic
917902972 1:179561700-179561722 ATTGCTCATTAGCTATTTAATGG + Intronic
918640850 1:186839441-186839463 ATTTCTCATTGGCAAAATGAAGG + Intronic
919383849 1:196894644-196894666 ATTTCTCATCAGAAGTTTATAGG - Intronic
919653530 1:200174830-200174852 ATTTCCTATTAGCTGTTTGCAGG - Exonic
920979456 1:210819624-210819646 ATTTGTATTTAGCTGTTTGATGG + Intronic
921474394 1:215589038-215589060 ATTTTTCATTTCTAGTTTGAAGG + Intronic
924487653 1:244502092-244502114 TTTTCACATGAGCAGATTGAGGG + Intronic
1063947293 10:11190648-11190670 AGCTCTCCTTAGCACTTTGAGGG - Intronic
1064482040 10:15749543-15749565 ATTTTTCATTTGCATTTGGAGGG + Intergenic
1064654890 10:17547100-17547122 ATTTCTCATCACTGGTTTGAAGG + Intergenic
1064691363 10:17922024-17922046 ATTTCTAACAAGCAGTTTGGGGG - Intergenic
1065350376 10:24790350-24790372 ATTTCTCTTTGGAAGTTGGAGGG - Intergenic
1066609560 10:37226794-37226816 ATTTTTCATTAGCAGTATGAGGG + Intronic
1068936599 10:62641052-62641074 AATTCACATTAGCATTTTCAAGG - Intronic
1070121634 10:73583085-73583107 ATTGATCAATATCAGTTTGAGGG - Intronic
1070511413 10:77164418-77164440 ATTTCTAAATGGCAGTTTCAAGG + Intronic
1071202359 10:83234158-83234180 TTTTCTCATTATCATTTTTATGG - Intergenic
1071279044 10:84082896-84082918 ATTTCTAATTAGAAGTTTGATGG + Intergenic
1073066446 10:100762252-100762274 ATTTCTCTCCAGCAGTTTGAGGG + Intronic
1073629023 10:105129445-105129467 ATTTCTCTTTAGAGGTTTCATGG + Intronic
1075690510 10:124390776-124390798 ATATCTCATTAACAATTTGAAGG + Intergenic
1075805855 10:125188299-125188321 GTTTCTTATTTGCAGTTTCAGGG - Intergenic
1075981522 10:126744439-126744461 ATTTTTCTTTAGAATTTTGAAGG + Intergenic
1077525249 11:3060348-3060370 AATCCTCATTATCAGTTTGCTGG - Intergenic
1079827377 11:25214084-25214106 ATTTCTTCGTAGCAGTATGAGGG + Intergenic
1081303092 11:41477729-41477751 TTGTCTCAATGGCAGTTTGAGGG - Intergenic
1085997831 11:81943071-81943093 ATTTCCCTTTTGCACTTTGAAGG + Intergenic
1088393185 11:109338530-109338552 AGGTCTTATTAGCAGCTTGAAGG + Intergenic
1088398243 11:109392501-109392523 GTTTCTGATTACCAGTTAGATGG - Intergenic
1088961725 11:114673839-114673861 TTTCCTCATGAGCAATTTGAGGG - Intergenic
1090614037 11:128498454-128498476 ATTTCCCGTTAGCAGATTGGAGG - Intronic
1093337954 12:17932600-17932622 ATTTCTTATCAGAATTTTGAAGG - Intergenic
1094030362 12:26005072-26005094 AATCCTCATTAGCAGTTTCTTGG + Intronic
1094313638 12:29113984-29114006 ATTTTTCATTAGAAGGTTGATGG + Intergenic
1094406934 12:30126172-30126194 GTTTCTCATTTGCAGTTCCAGGG + Intergenic
1094761611 12:33539769-33539791 ATTTTTCATAAGATGTTTGAAGG - Intergenic
1095468867 12:42515690-42515712 ATTTCTCTTTAGAACTTTGAGGG + Intronic
1095578612 12:43768571-43768593 ACTTCTCATTTCCAGATTGAAGG + Intronic
1095648703 12:44580865-44580887 ATTTCTCAAATGCAGTTGGAAGG + Intronic
1095745041 12:45648572-45648594 TTTTATCATTGGCAATTTGAAGG - Intergenic
1096665810 12:53163433-53163455 ATTTTTCATTAAATGTTTGATGG - Intronic
1099918513 12:88926955-88926977 ATTTCAAATAAGCAGTTAGAAGG - Intergenic
1100003152 12:89861500-89861522 TTTTCTCTTTAGCAGCTTTATGG - Intergenic
1100444360 12:94647557-94647579 AGTTCTCATTGGCATTTTTAGGG + Intronic
1100908591 12:99332075-99332097 ATTTCTCATGAGAGGTTTAAGGG - Intronic
1102777933 12:115537055-115537077 ATTTCTCATAAGGAGTTAGGTGG - Intergenic
1103172506 12:118833699-118833721 ATTTCTAATTAGCATTTTTGTGG + Intergenic
1103412313 12:120721191-120721213 AATTCTAACTAGCAGTCTGAAGG - Exonic
1106601964 13:31195947-31195969 ATTTCTGATTAGAAGTTTCTAGG + Intergenic
1106855250 13:33845013-33845035 ATTTCTCCTTAAATGTTTGAAGG + Intronic
1107594269 13:41946173-41946195 ATTTCTCCTTTGTATTTTGAAGG - Intronic
1108266541 13:48714518-48714540 ATTTCTCAGTTGCAGTTGTAAGG + Intergenic
1108439115 13:50431233-50431255 ATTTCAAATTATCAGTCTGATGG + Intronic
1108666336 13:52635528-52635550 ATTTCTAAGTGGCAGTTTCACGG - Intergenic
1108705197 13:52979154-52979176 ATTTCCCATTAGCAGCTGCAGGG + Intergenic
1108940325 13:55944975-55944997 ATTTGTAATTAGTAGTTTAAGGG - Intergenic
1109549701 13:63877407-63877429 TTTTCTCATTAGGTGTTTAAAGG + Intergenic
1110068747 13:71145230-71145252 ATTCCTCATTTCCAGTGTGATGG - Intergenic
1110164600 13:72424584-72424606 ATTACACATTACCAGTTAGATGG + Intergenic
1111177240 13:84611399-84611421 ATTTCTCACTAAAATTTTGATGG + Intergenic
1111519770 13:89385493-89385515 ATGTGTCATTAGGAGTTAGAGGG - Intergenic
1113290095 13:108896016-108896038 ATTTCTCATTAGCAGTGTTGGGG + Intronic
1113771178 13:112909969-112909991 ATTTCTCAGGAACAGTTTTAAGG - Intronic
1115488366 14:33934998-33935020 ATTTCTACTTAGCAGCTGGAGGG - Intronic
1115922832 14:38395744-38395766 AGTTCTCCATAGCAGTTTGCTGG + Intergenic
1116034477 14:39611573-39611595 ATTTCTGATTAGCTGAATGAAGG + Intergenic
1119247773 14:73127718-73127740 GTTTCTGATTAGCCTTTTGAAGG - Intergenic
1120734408 14:88037057-88037079 CTTTCTCATTAGCAGATAAAAGG - Intergenic
1120901929 14:89583005-89583027 ATTTCTCATTGGCCTGTTGATGG + Intronic
1122388406 14:101364277-101364299 ATATCTCACTAGCCGTTTGCTGG - Intergenic
1122533996 14:102449426-102449448 AGTTAGCATTAGCAGTTTGATGG + Intronic
1123155277 14:106218815-106218837 ATTTCTCTTTAACAGCATGAGGG + Intergenic
1123215452 14:106805130-106805152 TTATCTCATTACCAGTGTGATGG - Intergenic
1123897827 15:24846293-24846315 ATTTTTCATTATCAGTATAAAGG + Intronic
1124213335 15:27782676-27782698 ATGTCGCATTAGCACTATGAGGG - Intronic
1126430877 15:48582967-48582989 ATAGCACATTAGAAGTTTGATGG - Intronic
1126936157 15:53710725-53710747 TTTTCTCATTAACAACTTGATGG + Intronic
1127564947 15:60178138-60178160 TTTTCTCCTCAGCACTTTGAAGG - Intergenic
1127960857 15:63889471-63889493 ATTTCACATTATCAGATTAACGG + Intergenic
1129302738 15:74635352-74635374 CTCCCTCCTTAGCAGTTTGATGG - Intronic
1130857190 15:87850928-87850950 ATGTCTCAGCAGAAGTTTGAGGG + Intergenic
1131795764 15:96014983-96015005 ATTTACCATTAGCAATTTGCTGG + Intergenic
1131957007 15:97747612-97747634 ATTTCTCATTGGGAGCTTGGGGG - Intergenic
1132837410 16:1961068-1961090 ATTTCTCATAAGCCCTTTGGAGG - Intronic
1134284722 16:12850681-12850703 ATTTTTTGTGAGCAGTTTGAGGG - Intergenic
1135748431 16:25036986-25037008 ATTTCTCCTTAGCATCTTGTTGG + Intergenic
1137870139 16:51942079-51942101 CTTTTTCATTAGCATTCTGATGG + Intergenic
1139215155 16:65120660-65120682 ATTTCTTAATAGCAGTGTGATGG + Intronic
1140201097 16:72895347-72895369 CTTTCTCATTAGTAATTTGTGGG - Intronic
1141248112 16:82329733-82329755 ATTTCTCCTCAGCAGAATGAGGG + Intergenic
1141375003 16:83522663-83522685 ATTTCTCATCAGCAGGTGGGCGG + Intronic
1141612517 16:85190745-85190767 TTTTTACATTAGCAATTTGAGGG + Intergenic
1149342206 17:55698780-55698802 ATTTCTTATTAGCAGGTTTTAGG - Intergenic
1151062294 17:71109880-71109902 ATTGCGCAATAGCTGTTTGAAGG - Intergenic
1151330479 17:73403766-73403788 ATTTCTGTTTAGTATTTTGAGGG - Intronic
1153029250 18:698548-698570 ATTTTTCATAAGTAATTTGAAGG + Intronic
1155377137 18:25172380-25172402 ATCTCATATTAGCAATTTGAGGG - Intronic
1155700263 18:28734471-28734493 GTTTTTCAAAAGCAGTTTGAAGG - Intergenic
1156474559 18:37397481-37397503 TTTTCTCATCTGCAGATTGAAGG + Intronic
1157660666 18:49439542-49439564 ATTTCTCTTTAGCAGTATGCTGG - Intronic
1157951534 18:52043668-52043690 ATCTCAGATTAGCTGTTTGATGG - Intergenic
1158990356 18:62862468-62862490 ATTTTTCATTAGAAATTTGAAGG + Intronic
1159153277 18:64548468-64548490 ATATCACATTAGCAGAATGAAGG - Intergenic
1159798694 18:72870428-72870450 ATTTCTCAATCACAGTTTGAAGG + Intergenic
1160029632 18:75247569-75247591 AGTTCTCATAAGCAGAATGAGGG - Intronic
1163075335 19:14885985-14886007 ATTCCTCTCTAGCAGGTTGATGG + Intergenic
1163711605 19:18850537-18850559 ATTTATTACTAACAGTTTGAAGG + Intronic
1163857730 19:19718441-19718463 GTTTCTCCTTTTCAGTTTGACGG - Intronic
1165676743 19:37732389-37732411 ATTTTGCATTAGTAATTTGATGG - Intergenic
1165765166 19:38345982-38346004 TTTTCACATTACCAGTTTGCCGG - Intronic
1167927643 19:52834460-52834482 GTTTCTGATTAGCCTTTTGAAGG - Intronic
1168428125 19:56255984-56256006 ATATCTCATTAAAAGTTTCATGG - Intronic
1168666042 19:58205639-58205661 ATTTAGAATTAGCATTTTGAAGG + Intronic
925654332 2:6129157-6129179 ATTTTTCATTATCAGTATTAGGG + Intergenic
925801946 2:7610169-7610191 ATTTCTCATTTGCAGTTCTGGGG + Intergenic
927629073 2:24755355-24755377 ATTGCTTATTAGCATTTTAAAGG + Intronic
930583422 2:53241568-53241590 ATTTTTCCTTAGCTCTTTGAAGG + Intergenic
931012435 2:57932276-57932298 ATTTCTCTTTAGATGTCTGATGG + Intronic
931251465 2:60534469-60534491 TTTTATTGTTAGCAGTTTGATGG - Intronic
933239039 2:79898621-79898643 ATTTCTCATTAGGAGAATGAAGG + Intronic
934035053 2:88082276-88082298 ATTTCTAATAAGCAGATTCAAGG - Intronic
935219617 2:101001450-101001472 ATTTCTCCCCAGCATTTTGAAGG - Intergenic
936396741 2:112137498-112137520 ATTTTGCTATAGCAGTTTGAAGG + Intergenic
937197130 2:120168019-120168041 ATTTCTCATTTGCAGTTCTTAGG + Intronic
937488157 2:122337680-122337702 ATGTGTCATTAGCATCTTGAGGG - Intergenic
938416880 2:131110717-131110739 ATTTTCCGTTAGCATTTTGAAGG + Intronic
938649589 2:133368681-133368703 CTTAATCATTAGCACTTTGAAGG - Intronic
939176988 2:138760240-138760262 ATTGCTCATTAGTAGTTGGCGGG - Intronic
939537791 2:143454024-143454046 ATTACTTATCAGCATTTTGATGG + Intronic
939891175 2:147738094-147738116 ATTTCTCACTAGCAGGGTGGGGG - Intergenic
940602491 2:155879798-155879820 ATATCTCATCAACAGTATGAAGG + Intergenic
941619730 2:167763318-167763340 TTCTCTAATTAGCAGTTGGAAGG + Intergenic
942259763 2:174147680-174147702 AATTCTCATTAGCATTTGGTCGG - Intronic
943990062 2:194677498-194677520 ATTTCTAAATAGAAGTTTGTAGG - Intergenic
944161876 2:196670949-196670971 CTTCCTCATTAGCCGTTTGATGG + Intronic
944189680 2:196989419-196989441 AGTTCTCACTTGCATTTTGAAGG + Intronic
944279436 2:197878193-197878215 ATTTCTCATTGTCTGTTTGCAGG - Intronic
945601452 2:211870862-211870884 ATTTCTCATTTTCAGTATAAGGG + Intronic
946887131 2:224232778-224232800 ATATGTCATTGGTAGTTTGATGG + Intergenic
948278311 2:236727172-236727194 ATTTCTCTTTATCAGGTTGAGGG + Intergenic
948444806 2:238024177-238024199 ATTTCTGGGTAGCATTTTGATGG + Intronic
948964546 2:241367327-241367349 ATTTCTCATTAGCAGTTTGAAGG + Intronic
1169007146 20:2217213-2217235 ATTTCTGATTTGCTGGTTGAGGG + Intergenic
1169237980 20:3947670-3947692 ATTTCTCTTTAGCAATCTGTTGG + Intronic
1169601499 20:7266085-7266107 CTTTCTAACTAGCAGTTTCAAGG + Intergenic
1169867155 20:10214447-10214469 TTTTCTCATTAGCAACTTCAGGG - Intergenic
1173025464 20:39303725-39303747 ATTTCTCACTCTTAGTTTGATGG + Intergenic
1173034156 20:39392678-39392700 TTTTCTCATTTGTAGTATGAAGG - Intergenic
1173699717 20:45058030-45058052 ACTTATATTTAGCAGTTTGAAGG + Intronic
1175324319 20:58111985-58112007 ATTTTTCAATAGAAGTTAGATGG + Intergenic
1175630636 20:60532995-60533017 ATTTCTCATTATCATTTTGTGGG + Intergenic
1176350409 21:5789904-5789926 AAATTTCATTGGCAGTTTGATGG + Intergenic
1176357223 21:5910488-5910510 AAATTTCATTGGCAGTTTGATGG + Intergenic
1176544730 21:8187974-8187996 AAATTTCATTGGCAGTTTGATGG + Intergenic
1176563681 21:8371019-8371041 AAATTTCATTGGCAGTTTGATGG + Intergenic
1176904765 21:14486335-14486357 ATTGTTCATTTGCAGTTTCATGG + Intronic
1177094367 21:16813401-16813423 GTTATTTATTAGCAGTTTGAAGG - Intergenic
1177996425 21:28105171-28105193 AATTCTCACTACCATTTTGATGG - Intergenic
1179132126 21:38647164-38647186 TTTTCTCATTATCAGTTTTCAGG + Intronic
1179355661 21:40656326-40656348 TTTTCACATTAGGATTTTGAAGG - Intronic
1183498484 22:38163901-38163923 GTTTCTGATAAGCAGTTTTATGG + Intronic
1203249599 22_KI270733v1_random:104211-104233 AAATTTCATTGGCAGTTTGATGG + Intergenic
950204200 3:11065449-11065471 AATTTCCATTTGCAGTTTGAAGG + Intergenic
952850158 3:37721448-37721470 ATTTTGCATTAGCAGTTACATGG + Intronic
954859851 3:53678507-53678529 ATTTATCTTTAGAAGTTTAAGGG + Intronic
956756582 3:72393929-72393951 TTTTCTCATTATCAGAATGAAGG + Intronic
957154354 3:76528690-76528712 GTTTCTCATTAGCATATAGATGG + Intronic
957429118 3:80078536-80078558 ATTTTTCACTAGAAGTTTAATGG + Intergenic
957984669 3:87558505-87558527 ATTTCTCCTTTGCCCTTTGAAGG + Intergenic
958194597 3:90227820-90227842 ATTTCTCATTTTGAATTTGAAGG + Intergenic
958449290 3:94253596-94253618 ATTTTTCATGGGCAGTTGGAGGG + Intergenic
959360703 3:105387381-105387403 TTTTCTCTTTAGATGTTTGAAGG + Intronic
961527899 3:127519006-127519028 AGGTCTCATTACCAGTCTGAAGG - Intergenic
964099968 3:152977535-152977557 ATGACTCATTAGCCCTTTGAAGG - Intergenic
964606799 3:158569140-158569162 AATCCTCATTAGCAGTTTTATGG - Intergenic
964723474 3:159790984-159791006 ATTTCTCAGAAGCGGTTTTAGGG - Intronic
966431620 3:179837299-179837321 CATTCTGATTTGCAGTTTGAAGG - Intronic
966531125 3:180981628-180981650 AGTCCTCATTAGAAGTTTGTGGG - Exonic
970239874 4:13997629-13997651 ATTACTCTTTAGAAGTGTGAAGG - Intergenic
970537730 4:17046337-17046359 ATATCTCAAAGGCAGTTTGATGG - Intergenic
974404505 4:61448649-61448671 ATATATCATTAGAAGTTTAAGGG + Intronic
975944539 4:79689372-79689394 ATATCACATTAGAAGTTTAAAGG - Intergenic
976398127 4:84579853-84579875 ATTCCTCATTAGGAGTTAGAAGG + Intergenic
976456289 4:85250587-85250609 ATTTCTGATTAATAGTATGAAGG + Intergenic
977113701 4:92994085-92994107 ATATGTCCTTTGCAGTTTGAAGG + Intronic
979263577 4:118675364-118675386 TTTTCTCATTAACATTTTCATGG - Intergenic
979712802 4:123800359-123800381 ATTTCTTGTTACCAGTTTGTTGG + Intergenic
980221598 4:129924272-129924294 ATTTCTCTTTAGAACTTTCAGGG + Intergenic
980345169 4:131606007-131606029 ATTTTTCATTATCTCTTTGAAGG + Intergenic
980887288 4:138777075-138777097 ATTTTTCTTCAGCATTTTGAAGG - Intergenic
980903479 4:138927280-138927302 ATGTCTCTTTAGCAGTTTCCTGG - Intergenic
981147918 4:141347646-141347668 ATTTCTCCTTACAAGTTTGAAGG - Intergenic
983564481 4:169134917-169134939 ATTTCTCAATAAGAGTTTCATGG + Intronic
983780016 4:171658391-171658413 ATATCTCACTAGGAGGTTGACGG + Intergenic
984404411 4:179308626-179308648 TTTTTTCTTCAGCAGTTTGAAGG - Intergenic
984598933 4:181704390-181704412 AATTCTCTTTACCAGGTTGAGGG + Intergenic
985877539 5:2611537-2611559 ACTTCTCATTTTCAGTTTGTGGG + Intergenic
986937850 5:12913403-12913425 ATTCCTTACTAGCAGTTTAATGG + Intergenic
986983130 5:13472051-13472073 ATTTCTAAATAGTAGTTTGTAGG + Intergenic
987928957 5:24378281-24378303 ATTTTTGATTTGCATTTTGAAGG - Intergenic
988031166 5:25764672-25764694 ATTTCCTATTAGCATTTTTATGG + Intergenic
993100474 5:83532549-83532571 ATTTCTTAATATCAGTTTGAAGG - Intronic
993336959 5:86671623-86671645 ATTTCTAATTAGTACTTTAAGGG + Intergenic
993467200 5:88264001-88264023 ATTTGACATGCGCAGTTTGAAGG - Intronic
993566245 5:89479193-89479215 ATTTCTTAGTAGAAGTTGGAAGG - Intergenic
993931213 5:93943499-93943521 ATTTTTCATAAGCAGCTAGATGG + Intronic
994204033 5:97012685-97012707 TTTCTTCATTAGCAGTTTTAAGG + Intronic
995585079 5:113640338-113640360 ATTTCCCATTGGAACTTTGAGGG - Intergenic
995949959 5:117699626-117699648 ATTTCTCTTCAGAATTTTGACGG + Intergenic
996828733 5:127715855-127715877 TTTCCTCCTTTGCAGTTTGAAGG + Intergenic
998606533 5:143640918-143640940 ACTACTCATTAGCAGGTGGAGGG + Intergenic
999503726 5:152173377-152173399 ATTTTTCCTTAGAATTTTGAAGG + Intergenic
1001808212 5:174607276-174607298 TTTTCTCAATAACACTTTGAGGG - Intergenic
1001893291 5:175357197-175357219 ATTTTTCTTTAGAATTTTGAAGG - Intergenic
1002573419 5:180157307-180157329 ATTTCTTTTTAGCACTTGGATGG - Intronic
1002953699 6:1841498-1841520 ATTTCTAATTAGCAGTGACATGG - Intronic
1003388718 6:5693512-5693534 ATTTATCCTTAGCAGTTGCAAGG + Intronic
1004899248 6:20179173-20179195 TTTTCTCAGTAGCACATTGAGGG - Intronic
1005232599 6:23721194-23721216 ATTTATGATTAGCACTTTGTAGG - Intergenic
1008720621 6:54345887-54345909 ATTTTTAATTAGCACCTTGAGGG + Intronic
1009028888 6:58033404-58033426 TTTTTTCATTTGCAGCTTGAAGG + Intergenic
1009204423 6:60784778-60784800 TTTTTTCATTTGCAGCTTGAAGG + Intergenic
1009554268 6:65141748-65141770 ATTTCTCATCAGAAGTTCGGGGG + Intronic
1009831945 6:68949292-68949314 ATTTCTCAAATGCAGCTTGACGG - Intronic
1010910613 6:81550668-81550690 ATTTATTATTAGAAATTTGAGGG - Intronic
1012104820 6:95143676-95143698 ATTTCTCATTGGAAGCTTCAAGG - Intergenic
1012220687 6:96645577-96645599 ATTACTCATTACCTTTTTGAAGG + Intergenic
1013002434 6:106037238-106037260 ATTTCTCATCAGGAATTTTAGGG - Intergenic
1013209779 6:107976277-107976299 CTTACTGATTAGCAATTTGAAGG - Intergenic
1014696851 6:124632560-124632582 AGTACTCATTATCAGTTTTAAGG - Intronic
1014922080 6:127225177-127225199 TTTTCTCATCAGAAGTATGAGGG - Intergenic
1015057046 6:128916155-128916177 AATTTTCAATAGCAGTTTAATGG + Intronic
1018423376 6:163659479-163659501 ATTTCCCATTAACACTGTGAGGG + Intergenic
1018813033 6:167311442-167311464 ATCTTTCATTAGCTGTCTGAGGG - Intronic
1020806578 7:12797285-12797307 ATTTCAGATTAGCAGTTTTATGG - Intergenic
1022366582 7:29725974-29725996 GATTATCATTAGTAGTTTGATGG + Intergenic
1023267846 7:38427019-38427041 ATTTTTCATTATCATTTTGTAGG + Intronic
1024808743 7:53182221-53182243 CTTTCTCAGTAGGAGTTGGAAGG - Intergenic
1025034354 7:55583995-55584017 CTTTCTCATAAGAAGTTTGGGGG + Intergenic
1027727258 7:81823136-81823158 CTTTCTCCTTACCAGTATGAAGG + Intergenic
1027812523 7:82922830-82922852 ATGTCTCTCTAGCAGTATGATGG - Intronic
1027812571 7:82923524-82923546 ATTGCACATTTACAGTTTGAAGG - Intronic
1028672087 7:93412861-93412883 ATTTCACATTAGCATTTTTGTGG - Intergenic
1028769376 7:94598929-94598951 ATTTCTGAATAGCACTGTGATGG + Exonic
1029908818 7:104121903-104121925 ATTTCTCACAAGCACTTTAATGG + Intergenic
1029910383 7:104139455-104139477 ATTTCCCATTACCATTTTAAAGG + Intronic
1030115407 7:106058918-106058940 ATTTATCATTAGCTGTGAGATGG + Intergenic
1031903365 7:127434432-127434454 ATTTCTTTATAGCAGTGTGATGG - Intergenic
1032696022 7:134337097-134337119 TTTTCTCATCAGCAGGTTTATGG - Intergenic
1032917321 7:136506731-136506753 ACTTCTCATTAGTTGTTTGATGG + Intergenic
1032927151 7:136620129-136620151 ATTTCAATTTAGCATTTTGATGG - Intergenic
1033715848 7:144001303-144001325 ATTTCTCATTAACTGAATGAAGG - Intergenic
1035612827 8:979593-979615 ATTTCTCATTATCAGGTAAAGGG + Intergenic
1035868081 8:3106548-3106570 AGTTCCCAGTTGCAGTTTGAGGG - Exonic
1036512366 8:9412598-9412620 ATTTCCCATTAGTATTTGGAGGG - Intergenic
1037054675 8:14424405-14424427 ATTTCTAATTAGCACATAGATGG - Intronic
1037115393 8:15219764-15219786 ATGTCTCATTATGAATTTGAAGG + Intronic
1038734102 8:30153874-30153896 TTTCCTCATTAACAGTTTCATGG - Intronic
1039212133 8:35229473-35229495 ATTTCTCCTCAGCTGTTTGATGG + Intergenic
1039321734 8:36439400-36439422 TTCTCTCATTAGCACTGTGAAGG + Intergenic
1039671878 8:39610454-39610476 ATTTCAGATTATCATTTTGAAGG + Intronic
1041455898 8:58059366-58059388 CTTTCCCATTAGCAGTGTGTGGG + Intronic
1041538859 8:58960001-58960023 TTATTTCATTCGCAGTTTGACGG - Exonic
1041673066 8:60512263-60512285 AGTTCTTATTAACAGGTTGAAGG + Intergenic
1042340338 8:67672159-67672181 ATTTTTCATTATCAGTTTAATGG + Intronic
1042457861 8:69026354-69026376 ATGTAGCATAAGCAGTTTGAGGG + Intergenic
1042771166 8:72384086-72384108 AGTTCTCATTACAGGTTTGATGG - Intergenic
1042792592 8:72624943-72624965 ATTTCTCACTAGCTGTTGGCTGG - Intronic
1043178657 8:77055022-77055044 ATATAACATTACCAGTTTGAGGG + Intergenic
1043465884 8:80506912-80506934 ATTTTTCATTAGCAACTTGGGGG + Intronic
1044630439 8:94273142-94273164 TTTTCTCATTGGCAATTTGAAGG - Intergenic
1044884057 8:96757400-96757422 ATTTCTTATTAGTAATTTGAAGG + Intronic
1046149045 8:110199690-110199712 ATTACTCAACAGCAGTTTTATGG - Intergenic
1046909817 8:119613176-119613198 ATTTCTCATACGTAGTTTAATGG - Intronic
1047344618 8:124015013-124015035 ATTTCTCACTAGCTGTTGGTTGG + Intronic
1052233264 9:26180482-26180504 ATTTCTCATTGGCAGTGGGAAGG + Intergenic
1052590412 9:30485807-30485829 ATTTCACTTTAAAAGTTTGATGG + Intergenic
1053729920 9:41043355-41043377 ATTTTTCTTCAGAAGTTTGAGGG - Intergenic
1054698579 9:68388712-68388734 ATTTTTCTTCAGAAGTTTGAGGG + Intronic
1058216958 9:102246458-102246480 ATTTCTCCTAATCAGTTTCAAGG - Intergenic
1060120641 9:120986464-120986486 ATTTCTCAAGAAAAGTTTGAGGG + Intronic
1203465993 Un_GL000220v1:87472-87494 AAATTTCATTGGCAGTTTGATGG + Intergenic
1186835343 X:13431804-13431826 ATTTTTCAAAGGCAGTTTGAGGG + Intergenic
1187304383 X:18082065-18082087 GTTTCTCAATAGCATTTTGCTGG + Intergenic
1188727504 X:33604139-33604161 ATTTCCCACTCCCAGTTTGAAGG - Intergenic
1189026932 X:37405026-37405048 ATTGCTCATTAGCATTTTAAAGG + Intronic
1189047497 X:37609194-37609216 ATTTCTTTTTAGCAGGTGGAAGG - Intronic
1189060218 X:37745818-37745840 ATTTCTCATTGGGACTTTCAGGG - Intronic
1189128847 X:38477732-38477754 ATTTCTCATTAGGATATTCAGGG + Intronic
1189230573 X:39449557-39449579 GTTTCTCATGACCTGTTTGATGG - Intergenic
1189371954 X:40435730-40435752 ATTTCTCATGGACATTTTGATGG + Intergenic
1192923922 X:75735972-75735994 AATTCAAAATAGCAGTTTGAAGG - Intergenic
1192947423 X:75981405-75981427 AATTCAAAATAGCAGTTTGAAGG - Intergenic
1193927931 X:87513032-87513054 GATTCTGATTAGCAGTTTTAAGG - Intergenic
1194880321 X:99242783-99242805 ATTTTTATTTAGCATTTTGAGGG - Intergenic
1194935797 X:99946943-99946965 ATTTGTCATTAACAGTCAGAGGG - Intergenic
1196211206 X:112997660-112997682 ATTACACATTTGCATTTTGATGG - Intergenic
1196925315 X:120628546-120628568 ATTTCTCAATATCAGTTTAATGG + Intronic
1197808223 X:130417280-130417302 ATTTCTCATTACCTGTTGCAGGG + Intergenic
1198221648 X:134608021-134608043 ATTTTTCTTTTGCAGCTTGAAGG - Intronic
1198424476 X:136502351-136502373 ATTTCTCATTTGCAGAATGAAGG - Intronic
1198575787 X:138009042-138009064 ATTTCTGAGCAGCAATTTGATGG + Intergenic
1198868753 X:141153971-141153993 ATGTCTCAGTAGAAGTTCGAAGG + Intergenic
1201639535 Y:16164570-16164592 AGTTCTCAAGAGCAGTTGGAGGG - Intergenic
1201663278 Y:16420754-16420776 AGTTCTCAAGAGCAGTTGGAGGG + Intergenic