ID: 948965056

View in Genome Browser
Species Human (GRCh38)
Location 2:241372753-241372775
Sequence CTCTCTTGCCTCTGCTGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 285}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948965048_948965056 3 Left 948965048 2:241372727-241372749 CCTAGGGTTGGTGTGGCAGCCCT 0: 1
1: 0
2: 0
3: 13
4: 188
Right 948965056 2:241372753-241372775 CTCTCTTGCCTCTGCTGGGTGGG 0: 1
1: 0
2: 3
3: 28
4: 285
948965045_948965056 18 Left 948965045 2:241372712-241372734 CCAGGGAGTGGGCAGCCTAGGGT 0: 1
1: 0
2: 1
3: 27
4: 244
Right 948965056 2:241372753-241372775 CTCTCTTGCCTCTGCTGGGTGGG 0: 1
1: 0
2: 3
3: 28
4: 285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948965056 Original CRISPR CTCTCTTGCCTCTGCTGGGT GGG Intronic
900096935 1:943626-943648 TCCTCTTGGCTCTGCTGGGCTGG + Intronic
900477461 1:2882610-2882632 CTATGAGGCCTCTGCTGGGTTGG + Intergenic
901047354 1:6405220-6405242 GGCTCCGGCCTCTGCTGGGTGGG - Intergenic
901531218 1:9853724-9853746 CTCACTTGCATCTGGTGGGAAGG - Intronic
901722065 1:11207131-11207153 CTCTGTTGCCTGTGCTGGAGTGG + Intronic
902092171 1:13912308-13912330 TTATCTGGCCTCTGCTGAGTTGG + Intergenic
903587215 1:24425186-24425208 CTCTCCAGCTTGTGCTGGGTGGG + Intronic
903912985 1:26742106-26742128 ATGTCTTTCCTCTACTGGGTGGG - Intronic
904334103 1:29785820-29785842 CTCTCAGGCCCCTGCTGGGGAGG + Intergenic
904400134 1:30250983-30251005 CTCTTTTCCCTCTACTGGCTTGG + Intergenic
904582170 1:31552517-31552539 GTCTGGTGCCTCTGCTGGGATGG + Intergenic
904625845 1:31801608-31801630 CTCCCTTGCCTCAGGTGGGGTGG - Intronic
904774948 1:32900960-32900982 CTCTCTTGCCTTTCCTGCGGAGG - Intronic
905445427 1:38025673-38025695 GTCTCTTGCCCCTGCTGGGTGGG + Intergenic
905603886 1:39279202-39279224 GTCCCTTGAATCTGCTGGGTAGG + Intronic
906191768 1:43903564-43903586 CTCTCTTCCCCCTGCAGGGCTGG - Intronic
907634217 1:56117232-56117254 CTCTCTTGCCTCTGCTTTCCTGG - Intergenic
909712532 1:78668236-78668258 GAATCTTGCCTGTGCTGGGTAGG + Intergenic
910392293 1:86757544-86757566 CTCCCTTGCCTCTGCTGATGAGG + Intergenic
910430015 1:87151260-87151282 CTCTCCTTTCTCTACTGGGTAGG + Intronic
911724025 1:101222458-101222480 CAGTCCTGGCTCTGCTGGGTTGG - Intergenic
912450269 1:109763977-109763999 CTCTTTGGACTCTGGTGGGTGGG + Exonic
915601207 1:156924265-156924287 CACTCGCGCCTCTGCTGGGTTGG - Intronic
920277224 1:204815396-204815418 CTCTATTGATTCTTCTGGGTGGG - Intergenic
920600686 1:207321430-207321452 CACTCTCTCCACTGCTGGGTGGG - Intergenic
922093288 1:222418332-222418354 TTTTCTTGCCTCTCCTGGCTTGG + Intergenic
922749790 1:228064984-228065006 CTCTCTGGACCATGCTGGGTCGG + Intergenic
923398138 1:233588041-233588063 CTCCCCTCCCTCAGCTGGGTGGG + Intergenic
924730919 1:246710900-246710922 GTGGGTTGCCTCTGCTGGGTTGG - Intergenic
1063915262 10:10875633-10875655 CTTTCCTGCCTGTGCTGGGGTGG + Intergenic
1064010018 10:11728135-11728157 CTCTCGTGTCCCTGCTGGGGTGG + Intergenic
1064031141 10:11883681-11883703 CTCCTTTGCCTGGGCTGGGTTGG - Intergenic
1064318256 10:14277806-14277828 CTCTCTGGGCCCTGCTGAGTGGG - Intronic
1065698969 10:28406146-28406168 CTCTCTGGCCTCTGGAGAGTGGG + Intergenic
1066044456 10:31583578-31583600 CTGTCCTGGCTCTGCAGGGTGGG + Intergenic
1067841029 10:49679665-49679687 CTCCCTTGCCTCTGCGGCGGCGG + Exonic
1069017501 10:63446589-63446611 CTTTCTTGCCTCTCCTTGGAAGG - Intronic
1069276455 10:66596445-66596467 CTGGCTTGACTCTGCTGGATTGG + Intronic
1069871026 10:71533099-71533121 TGTTCTGGCCTCTGCTGGGTGGG + Intronic
1070039987 10:72767656-72767678 CTCTCTTGTCTCTGCGTGTTAGG + Intronic
1074272941 10:111972643-111972665 CTCTCTTGCCTCTGACTGATGGG + Intergenic
1076598370 10:131639805-131639827 GACTGTTGCCCCTGCTGGGTAGG - Intergenic
1077227972 11:1446649-1446671 CTCTGGAGCCTCTGCTGGGTGGG + Intronic
1077231889 11:1461416-1461438 CTCCCTTGCCTCATCTGGGGCGG + Exonic
1077870559 11:6258933-6258955 CTCTTTTGCCTGCGCTGGGCCGG + Intergenic
1079450148 11:20593871-20593893 ATCTCTTAGCTCTGCTGGGGTGG - Intergenic
1081664101 11:44906497-44906519 TTCCCAGGCCTCTGCTGGGTGGG + Intronic
1081862367 11:46340564-46340586 CTCTCTTGCCTCAGCAGGAGAGG + Intronic
1082788122 11:57328514-57328536 CTCCCTTGCCCCTTTTGGGTGGG - Intronic
1082813223 11:57491421-57491443 CTCTCTGGCCTCCGCTGGAAGGG - Intronic
1083230575 11:61315589-61315611 CTGTCTTGCCTTTGGTGGGTAGG - Intronic
1085053284 11:73390641-73390663 CTCTCCTGCCTGTCCTGGGAGGG + Intronic
1085413635 11:76306325-76306347 CACACTGGCCTCTGCTTGGTAGG + Intergenic
1089128581 11:116194411-116194433 CTCTCTTCCTTCCTCTGGGTGGG + Intergenic
1090077155 11:123586754-123586776 CTGCCTTGCCTCTGCTGGGCTGG + Intronic
1090201554 11:124861428-124861450 TTCTCTGGCCCCTGCTGGCTGGG + Intergenic
1090228508 11:125085583-125085605 CTCTGGGGCCTCTGCTGGCTGGG + Exonic
1090634061 11:128678114-128678136 CTCCCTTGCAACTGCTGGGTAGG - Intergenic
1091705404 12:2690085-2690107 CTGCCTTGCTTCTGCTGGGAAGG - Intronic
1092721721 12:11447713-11447735 CACTCTTGCATCTGCTAGCTGGG + Intronic
1094800076 12:34022791-34022813 CTCTCAGGCCTCTCCTGGGGTGG - Intronic
1095468146 12:42509516-42509538 GTCTGTGGTCTCTGCTGGGTGGG + Intronic
1097020143 12:56015016-56015038 CACTCTTGCCTCTCCTGCATGGG + Intronic
1098486364 12:71026198-71026220 CTCTTTTGCCTCTTCTGCCTAGG + Intergenic
1098731474 12:74040765-74040787 CTCTTTTACCTCTACTGTGTTGG + Intergenic
1098987441 12:77027985-77028007 CTCTCTTGTTTCTTCTGAGTGGG - Exonic
1099934298 12:89107362-89107384 CACTGTAGCCTCTGCTGCGTGGG + Intergenic
1100616580 12:96235768-96235790 TTCCCTTTCCCCTGCTGGGTGGG - Intronic
1103033252 12:117634909-117634931 CTCCCTAACCTCTGCTGGGTGGG - Intronic
1103290646 12:119843425-119843447 CAGTCTTGCCTCTGCTGTGTGGG - Intronic
1103525454 12:121564934-121564956 TTCTCCTGCCTCAGCTGGATAGG + Intronic
1104828105 12:131729084-131729106 CCCCATTGCCTCTGCTGAGTGGG - Intronic
1105782687 13:23717982-23718004 TTCTCTTGCCTCTGCTTTGTGGG + Intergenic
1110089795 13:71431474-71431496 CTTCCTTCCCTCTGCTGGCTGGG + Intergenic
1110286337 13:73753992-73754014 CTCTCTCTCCTCTCCTGAGTGGG - Intronic
1110467165 13:75815094-75815116 CTCTCTGGCTGCTGTTGGGTAGG + Intronic
1111221046 13:85205724-85205746 CTGGGTTGCCTCTGCTGGCTTGG - Intergenic
1112243866 13:97710339-97710361 GGCTCTTGACTCTGCTGGCTGGG - Intergenic
1112262489 13:97889978-97890000 CTCTCCTGACCCTGCTGGCTGGG - Intergenic
1112315855 13:98361520-98361542 CTCTCTTGCCACTGCCAGGGTGG - Intronic
1113014533 13:105813329-105813351 CTCTCTGGGATCTGCTGGCTTGG + Intergenic
1113182149 13:107641774-107641796 CTCGCTTGCTCCTGCTGAGTTGG - Intronic
1113935246 13:113990503-113990525 GACTCTGGCCTCTGCTGTGTCGG + Intronic
1115049072 14:29034052-29034074 ATGTCTTGTCTTTGCTGGGTTGG - Intergenic
1117760108 14:59018337-59018359 CTCCGTTGTCTCTGCAGGGTGGG + Intergenic
1118348797 14:64959015-64959037 CTCCCTTGCCTCTGCTGGCCAGG - Intronic
1118387906 14:65271918-65271940 CTCACTTACCTCTCCTGGGACGG - Intergenic
1118458097 14:65962926-65962948 CTTTCTTGCCTCATCTGAGTTGG - Intronic
1118590201 14:67395346-67395368 CTCTCCTGCCTGTGTTGGGTGGG - Intronic
1121287553 14:92748279-92748301 CCCTGTGGCCTCTGCTTGGTGGG - Intronic
1121682136 14:95802476-95802498 CTCTCATGCTTCTGCTACGTTGG - Intergenic
1122390764 14:101381297-101381319 CTCTTTTACTTCTGCTGGTTTGG - Intergenic
1123971637 15:25513362-25513384 GTCTGGTGCTTCTGCTGGGTGGG + Intergenic
1124158659 15:27250109-27250131 CTCTGTCGCCTCTGCTGGACTGG + Intronic
1124172224 15:27386340-27386362 CTCTCTAGCCTCTTCTAAGTTGG + Intronic
1124234424 15:27975541-27975563 CTATCTTGTCTCTGCTGACTTGG + Intronic
1127455867 15:59155585-59155607 CTCACTGGCCTCAGCTAGGTTGG - Intronic
1128636490 15:69305698-69305720 CTCTCCCTCCTCTGCTTGGTGGG - Intronic
1129352922 15:74967641-74967663 GTCTAGTGCCTCTGCTGGGGTGG + Intronic
1129650615 15:77485153-77485175 CTCACCTGCCTCTGGTGGCTGGG + Exonic
1130260666 15:82351915-82351937 CTCCCTTGCACCTGCTGGGAAGG - Intergenic
1130280572 15:82517092-82517114 CTCCCTTGCACCTGCTGGGGAGG + Intergenic
1130295049 15:82640969-82640991 CACTCTTACCTCTGCTGTGTTGG - Intronic
1130471943 15:84233275-84233297 CTCCCTTGCACCTGCTGGGGAGG + Intergenic
1130479437 15:84347846-84347868 CTCCCTTGCACCTGCTGGGGAGG + Intergenic
1130492333 15:84440283-84440305 CTCCCTTGCACCTGCTGGGGAGG - Intergenic
1130594239 15:85237912-85237934 CTCCCTTGCACCTGCTGGGAAGG + Intergenic
1130997338 15:88911308-88911330 ATCCCTTGACTCTGGTGGGTCGG + Intronic
1131022727 15:89113042-89113064 CTCTTTTGCTTCTGCTGCTTTGG + Intronic
1131107544 15:89745131-89745153 CCCTGCTGCCTCTGCTGGGCCGG - Intergenic
1131283385 15:91038782-91038804 CTCCCTTGCATCTGCTGGGAAGG - Intergenic
1132085838 15:98907696-98907718 CTTTCTTGCCTCTCCAGGGATGG + Intronic
1132411519 15:101581765-101581787 CTGTCTTCCCTCTGCTCTGTTGG - Intergenic
1132594140 16:740598-740620 CTCTGCTGCCTCCTCTGGGTTGG + Intronic
1132729648 16:1355118-1355140 GTCTCCCGCCTCTGCGGGGTCGG + Intronic
1132729675 16:1355214-1355236 CTCTCCTGCGTCTGTGGGGTCGG + Intronic
1132748585 16:1447117-1447139 CCCGCCTGCCTCTGCTGTGTGGG - Intronic
1132770487 16:1559617-1559639 AGCTCTTTCCTCTGCTGTGTGGG - Intronic
1132863956 16:2084623-2084645 CTCTCTTGCCCCTGCGTGATGGG - Exonic
1133902873 16:9993804-9993826 ATCTCTTGCCTCTGTTGACTTGG - Intronic
1135234646 16:20743804-20743826 CTCTCTCTCTTCTGCTGGCTGGG + Intronic
1135481990 16:22828306-22828328 GTCACTTGCCTTTTCTGGGTTGG - Intronic
1136061293 16:27728385-27728407 CTCTCCTTCCCCTGCTGGCTGGG - Intronic
1136522494 16:30805926-30805948 CTCTCCTGCCTCTTCTGGAAGGG + Intergenic
1137557556 16:49481834-49481856 TTCCCTTGCCTCTGCTTGCTTGG - Intergenic
1138197640 16:55063471-55063493 TTCACATGCCTCTGCTGGTTGGG - Intergenic
1138405308 16:56788207-56788229 CTCTCTCTCCTCTCCTGGGAGGG - Intronic
1139326012 16:66152934-66152956 CTCTCTTGCCTGTGTTTGGGGGG - Intergenic
1139847815 16:69933034-69933056 CTCTCCAGGCTCTGCTTGGTGGG + Intronic
1140470125 16:75209189-75209211 CTCTGTAGCCTTTGCGGGGTTGG - Intergenic
1142219814 16:88848628-88848650 CTCCCCTGACACTGCTGGGTCGG + Intronic
1142428085 16:90011353-90011375 CTCCCTTGGCTCTGCTGGGGAGG - Intronic
1143097894 17:4488226-4488248 CTCTCGTGCCTCTGCTGGAGGGG + Intergenic
1143860356 17:9886064-9886086 TGCTCTTGCCTCTGCCTGGTGGG - Intronic
1144838021 17:18167735-18167757 CCCTCCTGCCTCAGCTGGGGTGG + Intronic
1144850112 17:18239945-18239967 TGCTCTTGCTTCTGCTGGGCTGG + Intronic
1145994951 17:29099801-29099823 CTGCCTTTCCTCTGCTGGGCTGG - Intronic
1146379176 17:32315881-32315903 CTGTCTTGACTTTGCTTGGTTGG + Intronic
1148236662 17:45973746-45973768 CCCTCCTGCCTCTGCTGTGAAGG + Intronic
1148821765 17:50364073-50364095 CTCTCCTGCCTCTGCAGGCCTGG - Intergenic
1149572446 17:57682848-57682870 CTCACTCGCCTCTGCTTGGGAGG - Exonic
1150969622 17:70012223-70012245 CTGTCTTGTCTATCCTGGGTAGG + Intergenic
1151669664 17:75565113-75565135 CCCTCTTGCCTCAGCGGGGTGGG - Intronic
1152034832 17:77865678-77865700 CCCTCTTGCCTCTCCTGCATGGG + Intergenic
1152092856 17:78256678-78256700 CTCTCTTCCTTCAGCTTGGTGGG + Intergenic
1152112432 17:78364730-78364752 TTATCTTCCCTCTGCTGGGGGGG + Intergenic
1152659292 17:81535006-81535028 CCCTCACGCCTCTCCTGGGTAGG - Intronic
1154192971 18:12245768-12245790 CTCTTTTGACCCTGCTGGGTGGG - Intergenic
1154940917 18:21111876-21111898 CTCTGTCGCCTCCGCAGGGTGGG + Intergenic
1155239758 18:23854072-23854094 CTCTCCTCCCTCTGCTCTGTTGG + Intronic
1156365033 18:36418123-36418145 CACTCTTGCCCCTTCAGGGTGGG + Intronic
1157539450 18:48489464-48489486 CTTTCTTGACTCTCCTAGGTTGG + Intergenic
1158166377 18:54546004-54546026 CTCTCTTCCCTCTTCTGTGATGG + Intergenic
1158619608 18:59021278-59021300 CTCTGATGTCTCGGCTGGGTAGG + Intergenic
1158801674 18:60918308-60918330 CTCTCTTGACTGTTCTGTGTAGG - Intergenic
1160078946 18:75704355-75704377 ACCTGTTGCCTCTGCTGGATTGG - Intergenic
1160118817 18:76108828-76108850 CTCTAGTTCCTCTGCTGGCTTGG - Intergenic
1161269721 19:3383132-3383154 CTCTCTTGGCTCTCCTCGGAGGG - Intronic
1163104204 19:15114274-15114296 CTCTCTTGCCTCCCCTTGGCCGG + Exonic
1166239602 19:41480926-41480948 CTATCTTGCCACTGCTTGGCTGG - Intergenic
1168104280 19:54157012-54157034 TTCTCTTGCCTCTCCTGAGGGGG + Exonic
927257330 2:21050926-21050948 ATCTGTGGCCTCTGCAGGGTGGG - Intergenic
927842650 2:26455321-26455343 CTCCCTTGCCTCTGACGGGGAGG - Intronic
929250674 2:39751205-39751227 CTGTCATGCCTCTGCTGGCTTGG - Intronic
931431006 2:62209019-62209041 CACTCTTGCCCAGGCTGGGTCGG + Intronic
932308068 2:70717818-70717840 GGCTCATGCCTCTGGTGGGTGGG + Intronic
933634097 2:84688202-84688224 CTCTGTTGCCCAGGCTGGGTGGG - Intronic
933796594 2:85924909-85924931 GTGTCTTCCCTCTGCTGGGCGGG - Intergenic
940547297 2:155103488-155103510 CTCTCTTGCCACTGCCATGTAGG - Intergenic
940777370 2:157898753-157898775 ACTTCTTGCCTCTGCTGTGTGGG - Intronic
942222981 2:173789627-173789649 GTCTCTTGCCTCAGATGGATGGG - Intergenic
942517171 2:176766595-176766617 CTCTGTTGGCTCTGTTGGGCTGG - Intergenic
944079471 2:195770756-195770778 CTCTGTTGCCTGGGCTGGGTAGG + Intronic
944837093 2:203590480-203590502 CTCTCTTGTCTGAGATGGGTGGG - Intergenic
944855288 2:203761308-203761330 CTCTCCTGCCTTTCCTGTGTAGG - Intergenic
945613678 2:212039182-212039204 TTCTCTTTCCTCTGCTAGGCTGG - Intronic
945943383 2:215971772-215971794 CTCTTTTGTCTCTGCTGCTTTGG - Intronic
946456007 2:219826682-219826704 GTCTCTGGCCACTGATGGGTGGG - Intergenic
946765410 2:223035939-223035961 CAATCTTGCCTCTGTTGGGAAGG + Intergenic
947280322 2:228445363-228445385 CTCTCTTGCCTCTGCTTTGCTGG + Intergenic
947578167 2:231293295-231293317 CTCTCCTGCCTTCTCTGGGTAGG + Intronic
947711453 2:232318697-232318719 CTCACTTGCCTCCCCTGGGGTGG - Intronic
947844879 2:233236127-233236149 CTCTCATGCCACAGCTGGGAGGG - Intronic
947911168 2:233801960-233801982 CTCTCTTGCCACATCAGGGTGGG + Intronic
947917914 2:233846545-233846567 CCCTCTATCCTCTGCTGAGTGGG + Intronic
948119276 2:235516825-235516847 CTCTGTTCCATCAGCTGGGTTGG + Intronic
948148551 2:235726933-235726955 ATTTCTTGCCTGTGTTGGGTGGG + Intronic
948965056 2:241372753-241372775 CTCTCTTGCCTCTGCTGGGTGGG + Intronic
1169798596 20:9492743-9492765 CACGCTTGCCCTTGCTGGGTTGG + Intergenic
1169919668 20:10721301-10721323 GTCTCATGCCTCTCCTGGGAGGG + Intergenic
1172019184 20:31900853-31900875 CTCTCCTGCCTCTGCTCAATGGG + Intronic
1173329134 20:42059697-42059719 CTCTGTTGCCTTGGCTGGGCAGG + Intergenic
1173522914 20:43712409-43712431 CTCCCTGGCCTCTCCTTGGTGGG + Intronic
1173841220 20:46158343-46158365 CACTCTTCCCTCCCCTGGGTTGG - Intergenic
1174186092 20:48707298-48707320 CTCTCCAGCCTCGGCTGGGCAGG + Intronic
1174386095 20:50189451-50189473 CTTGCCCGCCTCTGCTGGGTAGG - Intergenic
1176009832 20:62887076-62887098 CTCTCCAGCAGCTGCTGGGTGGG + Intronic
1176116808 20:63435573-63435595 CTCTCTGGCCTCGGTTGGTTTGG - Intronic
1176408318 21:6433923-6433945 GTTCCTTGCCTCTGGTGGGTAGG + Intergenic
1178913725 21:36695757-36695779 TTCTGTTGCCTCTGCTTGCTGGG + Intergenic
1179180068 21:39037404-39037426 CTTCTTTGCCTGTGCTGGGTGGG - Intergenic
1179588156 21:42387140-42387162 CTGACTTGGGTCTGCTGGGTGGG + Intronic
1179683811 21:43042249-43042271 GTTCCTTGCCTCTGGTGGGTAGG + Intergenic
1180181249 21:46119580-46119602 CCCTCGTCCCTCTGCTGCGTCGG - Intronic
1180903958 22:19395360-19395382 CTCTTCAGCCTCTACTGGGTGGG - Intronic
1180995565 22:19963552-19963574 CGATCTTGCCTGTGCAGGGTTGG - Exonic
1184232941 22:43168311-43168333 GTCTCTTGACTTTGCTGGGGAGG + Intronic
1184652867 22:45927097-45927119 ATCTCTTGCCTTCACTGGGTTGG + Intronic
1184949945 22:47834139-47834161 ATCCCTTGCTTCTGTTGGGTTGG - Intergenic
1185214231 22:49589454-49589476 CTCTCTTTCCTCCGCTGGGTAGG - Intronic
950459183 3:13111102-13111124 CTCTCCAGCCTCTGCAGGGCAGG - Intergenic
951545187 3:23817720-23817742 CTGTCTTCCCTCTGCTGTCTTGG - Intronic
952252327 3:31666466-31666488 CTCCTTTGCCTCTGCAGGGAAGG + Intronic
953125336 3:40087033-40087055 CTCTCATGCCACTGCTACGTGGG + Intronic
953889568 3:46742306-46742328 CTGCCTTGCCTCTGCTGAATGGG - Intronic
954885031 3:53865309-53865331 GTCTCTTGCTTCTCATGGGTGGG - Exonic
955469258 3:59269158-59269180 CTCTCTTGCCTAGGCTGGAGTGG - Intergenic
956190812 3:66606521-66606543 CTTTCTGGCCTGTGCTGGCTTGG + Intergenic
957566859 3:81895165-81895187 CTTTCTTGCTTCTGCTTTGTCGG - Intergenic
957939446 3:86987266-86987288 CTCTCTGGACTCTGCTACGTTGG - Intronic
960488650 3:118283094-118283116 CTCTTTCTCCTCTGCTGGTTGGG + Intergenic
961160734 3:124722523-124722545 CTCTCTTATCTCTGTTGGGAGGG - Intronic
963801367 3:149679204-149679226 CTCTCTGACTTCTGTTGGGTTGG + Intronic
963834081 3:150038662-150038684 TTCTCCTGCCTCAGCTGGGGAGG - Intronic
966861661 3:184233952-184233974 CTCTCTTCCCACTGCTGGGTGGG - Intronic
969569047 4:7997681-7997703 GTCTCCTGCTGCTGCTGGGTGGG + Intronic
975217629 4:71774442-71774464 CTCTCTTTCCTTTTGTGGGTTGG + Intronic
976933960 4:90604972-90604994 CTCAGTTGCCGCTGCTGGCTGGG - Intronic
977346643 4:95824515-95824537 CTCCCTTGCCTCTGCAGAATAGG - Intergenic
980184457 4:129444813-129444835 GTCTCTTACCTCTTCTTGGTTGG + Intergenic
981162635 4:141517036-141517058 CTCCCTTGCTCCTGCTGGGGAGG - Intergenic
981797544 4:148614176-148614198 CTACCTTGCCTCTGATGGTTAGG + Intergenic
983004751 4:162470196-162470218 CACTCTTGCCTCTGGTGAATTGG - Intergenic
984766416 4:183403855-183403877 CTCTCTTTCCTCTGCAAGCTTGG + Intergenic
985599403 5:818656-818678 CTCTGTTGCCCGTGCTGGTTTGG - Intronic
986304427 5:6504903-6504925 CCATCTTTCCTGTGCTGGGTGGG + Intergenic
987186903 5:15430741-15430763 GTCTCTTACTACTGCTGGGTTGG + Intergenic
987301325 5:16600344-16600366 CTCTCCTGACCTTGCTGGGTGGG - Intronic
987322831 5:16786108-16786130 CTCTCCGGCCCCTGGTGGGTAGG - Intronic
988454264 5:31373327-31373349 CTCTGTTGCCTCTGCAGGGGTGG + Intergenic
988500313 5:31778296-31778318 GCCTCTTGCCACTGCTGGCTGGG - Intronic
991667248 5:69011550-69011572 CTCTCTTGGGCCTGCTGGTTTGG - Intergenic
992424483 5:76642394-76642416 TTCTTTTGCCTCTGCTGAGGTGG - Intronic
994613834 5:102078572-102078594 TTCTCTTGCCTCTGGGGGTTAGG - Intergenic
995598418 5:113771737-113771759 CACCCTAGCCTCTGCTTGGTTGG - Intergenic
999287889 5:150405035-150405057 CTCTCTTTCCTCTGGTGTCTAGG - Intronic
999298003 5:150472642-150472664 CACTCTTGCCTTTGCTGGGAAGG - Intergenic
1001315970 5:170641558-170641580 CTCTCAACCCTCTGCTGGGGTGG + Intronic
1002123508 5:177023422-177023444 CTCTCTGGCCTCTACTTGCTGGG + Intronic
1003527190 6:6908270-6908292 CTCTCTTCCCTTTCCTGAGTTGG + Intergenic
1004318429 6:14612692-14612714 CTCTCTTGAATCTTCTTGGTGGG - Intergenic
1004785535 6:18963799-18963821 CTCCATTCCCTCTACTGGGTTGG + Intergenic
1005870590 6:29971974-29971996 CTCACTTGGAACTGCTGGGTGGG - Intergenic
1005986279 6:30877764-30877786 CTCTCTTGGGTCTGCTGCTTTGG + Intronic
1005990286 6:30898003-30898025 CTCTCTCTCCTCTCCTGGATGGG + Intronic
1006211812 6:32401718-32401740 CTCCCCTCCCTCTGCTGGGGAGG + Intronic
1007017316 6:38481693-38481715 CTCTCTTGCCTTTAATGGATGGG - Intronic
1007075001 6:39060678-39060700 TTCCCTGGCCTCTGTTGGGTTGG - Intronic
1007259446 6:40553331-40553353 TTGTTTTTCCTCTGCTGGGTAGG - Intronic
1009433101 6:63588126-63588148 CTCTCTTGCCTCTTTAGGCTGGG - Intergenic
1009815889 6:68734298-68734320 CTCCCTTGCCTCTCCCAGGTAGG + Intronic
1009858635 6:69295593-69295615 CTCTCCTTCCTCTATTGGGTGGG - Intronic
1011294472 6:85811204-85811226 TTCTCCTACCTCTGCTGGCTGGG + Intergenic
1013685208 6:112572938-112572960 CTCTCTTGCATCTCCAGTGTGGG + Intergenic
1013911788 6:115284285-115284307 CTTTCTTGCCTCTACCCGGTGGG - Intergenic
1014057882 6:117037589-117037611 GTCTATTGGCTCTGCTGGATAGG - Intergenic
1019152657 6:170019157-170019179 CTCCCCTGCCTGTGCTGGCTTGG + Intergenic
1019629699 7:2041952-2041974 CTCTCTGGCCTTGGCTGGGTAGG - Intronic
1019705342 7:2494726-2494748 CTCTCTGCCCTATGCTGGGTGGG + Intergenic
1019892168 7:3955413-3955435 CTCTCTTGGATTCGCTGGGTGGG - Intronic
1020114706 7:5470109-5470131 ATCTCTAGCCCCTGCTGGGAAGG - Intronic
1022179787 7:27907848-27907870 CACTCTTGCCTGTGCTGCTTTGG + Intronic
1023539445 7:41249978-41250000 CTCTCCTTCCTCTGGAGGGTAGG - Intergenic
1023894158 7:44418200-44418222 CATTCCTGCCTCGGCTGGGTAGG - Intronic
1024209344 7:47190445-47190467 CTCTCTCAGCTCTGCTGGGCAGG + Intergenic
1027239903 7:76320258-76320280 CTCTCCTGCCTCCCCTGGATGGG - Intergenic
1028866241 7:95716875-95716897 CTTTCTTTCCTCTACTGAGTTGG + Intergenic
1029371499 7:100153821-100153843 CTCCCTTCCCTCTCCTGGGGCGG + Intronic
1029541644 7:101186574-101186596 CTCTGTTGCCTGGGCTGGGCTGG + Intergenic
1032094795 7:128932632-128932654 CTCTCTGGCCCCTGACGGGTAGG - Intergenic
1032278720 7:130483640-130483662 CTCCTTTGCCTCTGGTGGTTGGG - Intergenic
1032655828 7:133928718-133928740 TTCTCTGGCCTCTTCTGTGTAGG - Intronic
1033228147 7:139576806-139576828 GGCTCTTGCCCCTGCTGGGCTGG - Intronic
1034337429 7:150332465-150332487 TTCCCTTGCCTCTCCTGGATGGG + Exonic
1034489908 7:151387596-151387618 CTCTCCTGCTTCTGCTTGGTTGG - Intronic
1035072927 7:156158009-156158031 CTCCCTCGTCTCTGCCGGGTGGG - Intergenic
1035958684 8:4112555-4112577 CTCTGTTCCCTCTTCTGGGGAGG + Intronic
1036655214 8:10673219-10673241 CACTCTTGCGTGTGGTGGGTGGG + Intronic
1038298025 8:26314413-26314435 TTCTTTTGCCTCTGCTGTGTTGG + Intronic
1038336799 8:26652159-26652181 CTCTTTTGTCTCTGTGGGGTTGG + Intronic
1039063360 8:33589939-33589961 CTCTGTTGCCCAAGCTGGGTTGG - Intergenic
1039910112 8:41819771-41819793 CTCTCTGGCCTCTGCCAGGCTGG - Intronic
1042940569 8:74103193-74103215 GTGTATTGCCTCTGCAGGGTCGG - Intergenic
1046632090 8:116631315-116631337 CTCTCTTTCCTTTCGTGGGTGGG - Intergenic
1047527511 8:125646152-125646174 CTCTTCTGCCTCTGCAGGGCAGG + Intergenic
1047622842 8:126625223-126625245 TTCTATTGCTTCTGCAGGGTGGG + Intergenic
1047728591 8:127706425-127706447 CTCTCCTCCCTCAGCTGGGATGG + Intergenic
1049275232 8:141717003-141717025 GTCACTTCCCTCTGCTGGCTGGG + Intergenic
1049998650 9:1053091-1053113 CTCTGTAGCATATGCTGGGTAGG + Intronic
1050580458 9:7049541-7049563 CTCTCTTGACTCTCTTTGGTTGG + Intronic
1053282400 9:36829204-36829226 CTCTCTAACCCCAGCTGGGTTGG - Intergenic
1055358143 9:75459441-75459463 CTCTCTGGCTTCTGCTCTGTAGG + Intergenic
1055630668 9:78220274-78220296 CACTCTGGCGTCTGCTGAGTAGG + Intergenic
1060102145 9:120849993-120850015 CTCTCTCACCTCTGCTGAGGTGG - Intergenic
1061482489 9:130903827-130903849 ATCTCTTGCCTCTGCTGATGGGG - Exonic
1186347996 X:8714115-8714137 CTCTCTGGCCTCTGCTGTCTTGG + Intronic
1186530060 X:10286406-10286428 CTGGCTTGCCTCTGGTGGCTGGG + Intergenic
1188913950 X:35887338-35887360 CCCTCTTCCCACTGCTGGTTTGG - Intergenic
1189335449 X:40168354-40168376 GTCTCTTGCCTCTGCCGGGAGGG + Intronic
1190042721 X:47084276-47084298 CTCTCTTCCTTCTGTTGAGTAGG - Intronic
1190260151 X:48792311-48792333 CTCCCTGGCCTCTGGTGGGGTGG - Exonic
1191862671 X:65678592-65678614 CTCACTTGGCTTTCCTGGGTGGG + Intronic
1192197430 X:69037969-69037991 GTCCCCTGCCACTGCTGGGTGGG - Intergenic
1195739679 X:108050940-108050962 GTTTCTTTCTTCTGCTGGGTGGG - Intronic
1196482848 X:116170030-116170052 CACTCTTGCTTCTGCTGGATTGG + Intergenic
1198041086 X:132853028-132853050 CACTCTTGCCTATGGTGTGTTGG - Intronic
1198130086 X:133685344-133685366 TTCTCTCTCTTCTGCTGGGTTGG - Intronic