ID: 948967162

View in Genome Browser
Species Human (GRCh38)
Location 2:241391797-241391819
Sequence CAGCTTTAACATCTTGAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 143}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948967162_948967165 18 Left 948967162 2:241391797-241391819 CCAAGCTCAAGATGTTAAAGCTG 0: 1
1: 0
2: 0
3: 10
4: 143
Right 948967165 2:241391838-241391860 AATACCATTGAATCGTTCAAGGG 0: 1
1: 0
2: 0
3: 5
4: 113
948967162_948967167 27 Left 948967162 2:241391797-241391819 CCAAGCTCAAGATGTTAAAGCTG 0: 1
1: 0
2: 0
3: 10
4: 143
Right 948967167 2:241391847-241391869 GAATCGTTCAAGGGCCAGTCAGG 0: 1
1: 0
2: 0
3: 4
4: 57
948967162_948967164 17 Left 948967162 2:241391797-241391819 CCAAGCTCAAGATGTTAAAGCTG 0: 1
1: 0
2: 0
3: 10
4: 143
Right 948967164 2:241391837-241391859 GAATACCATTGAATCGTTCAAGG 0: 1
1: 0
2: 0
3: 6
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948967162 Original CRISPR CAGCTTTAACATCTTGAGCT TGG (reversed) Intronic
901854885 1:12038304-12038326 CAGCTGAAACATCTTCATCTGGG + Intergenic
907112540 1:51939371-51939393 CAGCTTTATGACCTTGACCTTGG - Intronic
907491265 1:54810384-54810406 CAGCCTTAACATCTTGGTCCTGG - Intronic
920650897 1:207836674-207836696 CAGCTTTATCATCTTGGCCAAGG - Intergenic
1062926289 10:1317865-1317887 CAGCCTTCCCGTCTTGAGCTTGG + Intronic
1064606964 10:17052143-17052165 CATCTTTAAAATGTTGAGATGGG + Intronic
1066293113 10:34031646-34031668 GAGCTTTCACATCCTGTGCTTGG - Intergenic
1069352711 10:67548677-67548699 CAACTTTATAATCTTGAGTTAGG + Intronic
1074047789 10:109854497-109854519 CAGCTTTATCAACTTGAGTACGG - Intergenic
1074057996 10:109940018-109940040 AATCTTTAAGATCTTGAGGTAGG + Intergenic
1074087042 10:110216008-110216030 CAGCTTTAACACCTCTAGCCAGG - Intronic
1075203178 10:120423224-120423246 CAGTTTCAACATCTTTAGATGGG + Intergenic
1076186086 10:128450492-128450514 CAGCTTTAGCACCTGGAGCACGG + Intergenic
1078732236 11:13985490-13985512 CAGCTTTATCACTTAGAGCTGGG - Intronic
1079467430 11:20744530-20744552 CAGCTTTAAGTTGTTGGGCTTGG + Intronic
1081361903 11:42190393-42190415 CAGGTTTGGCCTCTTGAGCTTGG - Intergenic
1087792634 11:102423049-102423071 CACCTTTAGCAGCTTGAGCTAGG - Intronic
1089744547 11:120607589-120607611 CAGCTTTGCCATGTTGAGTTTGG + Intronic
1089998737 11:122934526-122934548 CTGCTTTCGAATCTTGAGCTTGG - Exonic
1090679717 11:129041872-129041894 CAGCTTTAACATCTGCTGCATGG - Intronic
1093471363 12:19505567-19505589 GAGGTGTAACATCTTGAGGTGGG + Intronic
1094634208 12:32208744-32208766 CAGTTCTAACATGTTTAGCTAGG + Intronic
1098672221 12:73246378-73246400 CATCTTTAACATTTAGAGATTGG - Intergenic
1100377197 12:94028599-94028621 CAGCTTTTACATATTAAGATTGG + Intergenic
1100922592 12:99505142-99505164 CAGTTTTGATATCTGGAGCTAGG + Intronic
1103686427 12:122735585-122735607 TAGCTTTTACATCTAGATCTTGG - Intergenic
1108463031 13:50686417-50686439 CAGCTTGAACACCTTGAGGTTGG + Intronic
1109432522 13:62253789-62253811 CAGCTTTATGATGTTGAGCATGG - Intergenic
1112464630 13:99632817-99632839 CATCTCTATCATCTTGAGTTTGG - Intronic
1113008079 13:105730362-105730384 AAGCTCCACCATCTTGAGCTTGG - Intergenic
1115432985 14:33342549-33342571 CAGCTTTAACATCTCAAGGGTGG + Intronic
1117740956 14:58818823-58818845 CTGCTTTAACTTCTTGAGGTTGG + Intergenic
1119217532 14:72880635-72880657 CAGCCTCAACCTCTTGGGCTCGG + Intronic
1120176928 14:81304411-81304433 CATCTCTAACAGCGTGAGCTTGG - Intronic
1120467374 14:84876957-84876979 CAGTTTTGACATGTAGAGCTTGG + Intergenic
1122396915 14:101440174-101440196 TTCCTGTAACATCTTGAGCTTGG - Intergenic
1129168698 15:73794570-73794592 AAGCCTTAAGACCTTGAGCTTGG - Intergenic
1130542844 15:84834372-84834394 GAGCTTTAATTTCATGAGCTGGG + Intronic
1133652349 16:7824491-7824513 CAGCTTTAAAATATTGTGCCAGG + Intergenic
1136121532 16:28138943-28138965 CACCTTTGTCATCTTGAGGTTGG - Intronic
1138221106 16:55250974-55250996 CTGCTTGAACATCTTGAACCAGG + Intergenic
1138689755 16:58756314-58756336 CAGCTTGGACATCTTGTGCAGGG + Intergenic
1139763795 16:69209842-69209864 TAGTTTAAACATCTTGAGGTGGG - Intronic
1140339929 16:74147582-74147604 TAGCTTTGAAATCTTGATCTTGG + Intergenic
1142528260 17:560455-560477 CATCTGTAACATCCTGAGCACGG - Exonic
1143594849 17:7907886-7907908 CACCTTTTACATCTTCTGCTAGG - Exonic
1143792703 17:9310760-9310782 CAGCTCTAACATCGAGACCTTGG - Intronic
1144324067 17:14160962-14160984 CAGCTTTTAGCTCTTGAGATAGG - Intronic
1146021065 17:29279612-29279634 CATCTTTGACCTCTTGGGCTTGG + Intronic
1150288247 17:63966161-63966183 CAGCTATGACACCTTCAGCTGGG - Exonic
1152530564 17:80916317-80916339 CAGCTTCAACATCTGGCACTGGG - Intronic
1155034355 18:22012554-22012576 GAACTTTGACATTTTGAGCTGGG + Intergenic
1156757475 18:40545988-40546010 CAGCTTTAGCATCATGGACTTGG - Intergenic
1157381001 18:47217400-47217422 GAGCTTTAACATCTGTAACTTGG - Intronic
1159843885 18:73435323-73435345 CAGCTTTATCATCTTTAGTACGG - Intergenic
1160470898 18:79132416-79132438 CAGCTTTCTCATCTAGAACTCGG - Intronic
1161879853 19:6941075-6941097 CATCCTTAAATTCTTGAGCTTGG + Intergenic
1162870688 19:13584263-13584285 CAGCTCTAACAGGATGAGCTGGG + Intronic
926650652 2:15340484-15340506 CAATTTTAACATATTGAGATTGG + Intronic
927231446 2:20827836-20827858 CAGCTTCAGCCTCTTGACCTTGG - Intergenic
927307880 2:21594690-21594712 CAGCGTTTACATCTTGATTTTGG + Intergenic
928070268 2:28208243-28208265 CAGACACAACATCTTGAGCTGGG - Intronic
930086694 2:47502863-47502885 CAGTTTCAACATCTTGAAATGGG - Intronic
930110134 2:47671891-47671913 CAGCTTTAAAAAATTGAGGTTGG - Intergenic
930582031 2:53223396-53223418 CAATTTTAACATCTTGAAATTGG - Intergenic
930701937 2:54467202-54467224 CAGCTGTAAAGTCTTGGGCTGGG + Intronic
930766923 2:55094071-55094093 CAGCTTTAACATATGAATCTTGG - Intronic
931014944 2:57966015-57966037 AAGCTTTAACATCTTAAACAGGG + Intronic
933855875 2:86413651-86413673 CTGCTGTAGCATCTTGAGTTGGG - Intergenic
937426169 2:121800973-121800995 CAGCTTGAACACCCTGAGCGGGG - Intergenic
938015818 2:127866382-127866404 CAGCTAGTACATGTTGAGCTGGG + Intronic
938899780 2:135790254-135790276 CAGCCCTAACAACTTGAGATGGG - Intronic
941410877 2:165155821-165155843 AAGCTTTGACACCTTTAGCTGGG - Exonic
942488821 2:176469088-176469110 CAACTTGAAAATCTTGAGTTTGG + Intergenic
942641647 2:178066930-178066952 CTGCTTTACCATCTTGCACTAGG + Intronic
943570258 2:189565402-189565424 CAGCTTTCACAGCTAGAGCTGGG + Exonic
944217638 2:197271895-197271917 CAGTTTTAAAACCTTGGGCTGGG - Intronic
946964031 2:225017739-225017761 CAGCTTAAACATATTCAGCAAGG - Intronic
948967162 2:241391797-241391819 CAGCTTTAACATCTTGAGCTTGG - Intronic
1174460624 20:50679874-50679896 CAGCCTCAACCTCCTGAGCTCGG - Intronic
1178007415 21:28237150-28237172 CAGCCTCAACCTCTTGGGCTAGG - Intergenic
1181616823 22:24060690-24060712 CAGCTTCAACCTCCTGGGCTCGG + Intronic
1183819692 22:40335894-40335916 CAGCTTTTACATGTGGAGCAGGG - Intergenic
949211757 3:1511477-1511499 CAGTGTCAACATCTTCAGCTGGG - Intergenic
952334871 3:32395083-32395105 CAGCCTTAACCTCCTGGGCTCGG + Intronic
952961416 3:38592842-38592864 AAGCTTTAAGATCTTGGGATTGG - Intronic
953293618 3:41690866-41690888 CTGCTATAACATTATGAGCTTGG - Intronic
957939438 3:86987128-86987150 CAGCTTTGAAATCTTTAGCTAGG + Intronic
958558977 3:95719051-95719073 CAGCTTCAAATTCCTGAGCTAGG + Intergenic
958984867 3:100768386-100768408 CAGCTTTTAAAACTTGAGCCAGG - Intronic
959001480 3:100969275-100969297 CAGCTTTAAAATGAAGAGCTTGG - Intronic
961989795 3:131176230-131176252 CAGCTTCTCCATCTTGGGCTGGG - Intronic
967815336 3:193793535-193793557 GAGCTTTCACAGCCTGAGCTTGG + Intergenic
970445151 4:16117211-16117233 CAGGTTAAACATCTTGAACTAGG - Intergenic
970768658 4:19583247-19583269 GAGCTTTAACATTTTGCTCTAGG - Intergenic
971589365 4:28447399-28447421 GAACTGTAACATCTTGAGTTAGG - Intergenic
972065035 4:34931735-34931757 CAGATTTAAGATCTTAATCTTGG + Intergenic
973117259 4:46477198-46477220 CATGGTTAACAGCTTGAGCTTGG - Intergenic
976794400 4:88916139-88916161 CAGATATAGCACCTTGAGCTTGG + Intronic
982147380 4:152410391-152410413 CTGCTTCAACATCTTGAGACAGG + Intronic
982626556 4:157774293-157774315 CAGAGTTCACATCTTGAACTAGG + Intergenic
984453010 4:179927777-179927799 CAGCTGAAAAATCTTGAGTTGGG + Intergenic
987331001 5:16857709-16857731 CTACTTTAACCTCTTGAGCAAGG + Intronic
987857255 5:23437035-23437057 GAGCTTTAACATCTAGAGGAAGG + Intergenic
987957728 5:24762816-24762838 CAGCTATATCATCTTGAACTTGG + Intergenic
988403460 5:30793304-30793326 AAAATGTAACATCTTGAGCTAGG - Intergenic
989300852 5:39891650-39891672 CATCTTTGACATCTTGGGCAAGG + Intergenic
989673882 5:43951312-43951334 AAGCTTTAAAAGCTTAAGCTTGG + Intergenic
992244199 5:74801450-74801472 CAGCTCTAAAATCTAGATCTGGG - Intronic
996148294 5:120002500-120002522 CATTTTTAACATTTTGAGTTTGG - Intergenic
996975974 5:129435116-129435138 CAGCCTCAACTTCTTGGGCTCGG + Intergenic
999635309 5:153615793-153615815 CAGTTTCAACATCTAGAGATGGG - Intronic
1001592514 5:172875350-172875372 CAGACATAACATCTGGAGCTGGG - Intronic
1002018076 5:176341828-176341850 CAGCTGAAATATCTTGAGCCAGG + Intronic
1004926839 6:20424077-20424099 CAGCTTTTACAGTTTGAGTTTGG + Intronic
1006481513 6:34298278-34298300 CAGCCTTGACTTCCTGAGCTGGG - Intronic
1007825550 6:44597597-44597619 CATTTTTAATATCTTGAGTTAGG + Intergenic
1008046708 6:46858821-46858843 GGGCTTTTCCATCTTGAGCTTGG - Exonic
1010763706 6:79754304-79754326 CAACTTTACCATCTTCAGCATGG + Intergenic
1013071040 6:106729672-106729694 CAGCTTAAACAATTTGAGGTCGG - Intergenic
1013873688 6:114798776-114798798 CATCTTTAACATCTACATCTAGG - Intergenic
1014906428 6:127035003-127035025 CTGCATTTGCATCTTGAGCTTGG + Intergenic
1016126949 6:140415438-140415460 CAGCTTTCACACCTAAAGCTGGG - Intergenic
1024089476 7:45923252-45923274 CAGCTTTATCATCTGGAGAGTGG + Intergenic
1026349779 7:69505718-69505740 AGCCTTTAACATCCTGAGCTTGG + Intergenic
1030139589 7:106291245-106291267 CAGCTTTAAGAGCTTGTGCATGG + Intergenic
1030343511 7:108407672-108407694 CAGCCTCAAAATCATGAGCTGGG - Intronic
1034508708 7:151518087-151518109 CAGCTTTAACAGCTGCAGCCAGG - Intronic
1035448886 7:158961774-158961796 CTGCTCTCACCTCTTGAGCTGGG + Intergenic
1036544595 8:9754920-9754942 CAGCTTTCACACCTTCAGTTAGG - Intronic
1038879646 8:31594110-31594132 CAGCCTTTACATATTGAGATGGG + Intergenic
1040360481 8:46659544-46659566 AAGGTTAAAGATCTTGAGCTGGG - Intergenic
1040829223 8:51659353-51659375 CAGCTTCATCAGCTTGTGCTGGG - Intronic
1041547159 8:59058582-59058604 TAGCTTGTACATCTTTAGCTGGG - Intronic
1042386748 8:68184907-68184929 CAGCTTAACCCTATTGAGCTAGG + Intronic
1044255570 8:90056645-90056667 CAGCTTTGACTTCCTGGGCTTGG + Intergenic
1047401086 8:124548022-124548044 AAGCTTTAACATCTGGAGTTTGG + Intronic
1049998182 9:1050710-1050732 CAGCTTTAGGATCTGGCGCTAGG - Exonic
1050981351 9:12019796-12019818 CAGCTTCAACATGTTGAGTTTGG - Intergenic
1051297281 9:15610304-15610326 CAGCTTAAACCTCCTGGGCTCGG + Intronic
1057110934 9:92470122-92470144 CATGTTTAACATTTTGGGCTGGG - Intronic
1058938334 9:109790121-109790143 CAGCTTTTTCATCTACAGCTGGG - Intronic
1059528206 9:115012759-115012781 CAGCTTTAAAATGATGATCTGGG + Intergenic
1060414855 9:123423115-123423137 CGGCTCTAGCATCTGGAGCTTGG - Intronic
1186591662 X:10936466-10936488 CAGCTTTTACATTTTCATCTCGG + Intergenic
1188914219 X:35890211-35890233 TAGCTTTAAAATCTTTAGGTAGG + Intergenic
1193595789 X:83443519-83443541 CTGCTTTAACATTTTGCTCTTGG - Intergenic
1195818650 X:108917549-108917571 CAGCTTTAACTTATTGAAGTGGG - Intergenic
1195915317 X:109929737-109929759 CAGCTTTAACTTATTAAGTTTGG - Intergenic
1196192048 X:112804956-112804978 CAGCTTTACCACCTTGGCCTGGG + Exonic
1196818609 X:119685361-119685383 CTGCTTTGACCCCTTGAGCTGGG - Intronic
1197075011 X:122343364-122343386 TGGATTTAACATCTTGAGGTCGG + Intergenic
1197192381 X:123662235-123662257 CAGCTTTAAAACCTTGGGCTGGG + Intronic
1199496877 X:148462116-148462138 CACTTTTCACATCTTGAGTTGGG + Intergenic