ID: 948974292

View in Genome Browser
Species Human (GRCh38)
Location 2:241454059-241454081
Sequence TAGCCATGAGTCACCGCACC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60022
Summary {0: 1, 1: 20, 2: 887, 3: 10420, 4: 48694}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948974290_948974292 -5 Left 948974290 2:241454041-241454063 CCCAAAGTGTTGGGATTATAGCC 0: 25
1: 2181
2: 44142
3: 285175
4: 274524
Right 948974292 2:241454059-241454081 TAGCCATGAGTCACCGCACCCGG 0: 1
1: 20
2: 887
3: 10420
4: 48694
948974283_948974292 11 Left 948974283 2:241454025-241454047 CCACCCACCTCGGCCTCCCAAAG 0: 27130
1: 110883
2: 157143
3: 168159
4: 124493
Right 948974292 2:241454059-241454081 TAGCCATGAGTCACCGCACCCGG 0: 1
1: 20
2: 887
3: 10420
4: 48694
948974282_948974292 20 Left 948974282 2:241454016-241454038 CCTCGTGATCCACCCACCTCGGC 0: 3073
1: 18264
2: 49460
3: 60485
4: 55029
Right 948974292 2:241454059-241454081 TAGCCATGAGTCACCGCACCCGG 0: 1
1: 20
2: 887
3: 10420
4: 48694
948974289_948974292 -2 Left 948974289 2:241454038-241454060 CCTCCCAAAGTGTTGGGATTATA 0: 2151
1: 50580
2: 344031
3: 247644
4: 126600
Right 948974292 2:241454059-241454081 TAGCCATGAGTCACCGCACCCGG 0: 1
1: 20
2: 887
3: 10420
4: 48694
948974285_948974292 7 Left 948974285 2:241454029-241454051 CCACCTCGGCCTCCCAAAGTGTT 0: 4825
1: 102576
2: 192656
3: 133596
4: 67130
Right 948974292 2:241454059-241454081 TAGCCATGAGTCACCGCACCCGG 0: 1
1: 20
2: 887
3: 10420
4: 48694
948974280_948974292 25 Left 948974280 2:241454011-241454033 CCTGACCTCGTGATCCACCCACC 0: 5878
1: 26218
2: 57891
3: 57746
4: 41133
Right 948974292 2:241454059-241454081 TAGCCATGAGTCACCGCACCCGG 0: 1
1: 20
2: 887
3: 10420
4: 48694
948974291_948974292 -6 Left 948974291 2:241454042-241454064 CCAAAGTGTTGGGATTATAGCCA 0: 12
1: 1235
2: 22329
3: 141944
4: 264531
Right 948974292 2:241454059-241454081 TAGCCATGAGTCACCGCACCCGG 0: 1
1: 20
2: 887
3: 10420
4: 48694
948974287_948974292 4 Left 948974287 2:241454032-241454054 CCTCGGCCTCCCAAAGTGTTGGG 0: 6468
1: 135481
2: 274928
3: 207474
4: 120415
Right 948974292 2:241454059-241454081 TAGCCATGAGTCACCGCACCCGG 0: 1
1: 20
2: 887
3: 10420
4: 48694
948974284_948974292 8 Left 948974284 2:241454028-241454050 CCCACCTCGGCCTCCCAAAGTGT 0: 2579
1: 49781
2: 203709
3: 273134
4: 174902
Right 948974292 2:241454059-241454081 TAGCCATGAGTCACCGCACCCGG 0: 1
1: 20
2: 887
3: 10420
4: 48694

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948974292 Original CRISPR TAGCCATGAGTCACCGCACC CGG Intronic
Too many off-targets to display for this crispr