ID: 948975506

View in Genome Browser
Species Human (GRCh38)
Location 2:241461273-241461295
Sequence CTGGCTTGGGGGGCGCGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 442
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 408}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948975506_948975515 -9 Left 948975506 2:241461273-241461295 CCCCTCCGCGCCCCCCAAGCCAG 0: 1
1: 0
2: 2
3: 31
4: 408
Right 948975515 2:241461287-241461309 CCAAGCCAGTGCTGTCTCGCCGG 0: 1
1: 0
2: 0
3: 9
4: 109
948975506_948975521 11 Left 948975506 2:241461273-241461295 CCCCTCCGCGCCCCCCAAGCCAG 0: 1
1: 0
2: 2
3: 31
4: 408
Right 948975521 2:241461307-241461329 CGGGTGGTGCTGAGGTCCACCGG 0: 1
1: 0
2: 0
3: 12
4: 152
948975506_948975517 -5 Left 948975506 2:241461273-241461295 CCCCTCCGCGCCCCCCAAGCCAG 0: 1
1: 0
2: 2
3: 31
4: 408
Right 948975517 2:241461291-241461313 GCCAGTGCTGTCTCGCCGGGTGG 0: 1
1: 0
2: 0
3: 3
4: 75
948975506_948975519 3 Left 948975506 2:241461273-241461295 CCCCTCCGCGCCCCCCAAGCCAG 0: 1
1: 0
2: 2
3: 31
4: 408
Right 948975519 2:241461299-241461321 TGTCTCGCCGGGTGGTGCTGAGG 0: 1
1: 0
2: 0
3: 13
4: 105
948975506_948975516 -8 Left 948975506 2:241461273-241461295 CCCCTCCGCGCCCCCCAAGCCAG 0: 1
1: 0
2: 2
3: 31
4: 408
Right 948975516 2:241461288-241461310 CAAGCCAGTGCTGTCTCGCCGGG 0: 1
1: 0
2: 0
3: 17
4: 598

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948975506 Original CRISPR CTGGCTTGGGGGGCGCGGAG GGG (reversed) Intronic
900306740 1:2013625-2013647 CTGTCTTGGGGGTGGTGGAGGGG + Intergenic
901074472 1:6544545-6544567 CTGGGGTGGGGGGCGGGGGGGGG - Intronic
901202529 1:7474859-7474881 CTGGAGTGGGGTGCGGGGAGAGG - Intronic
901333867 1:8431798-8431820 CTGGCTTGGGGAGAGAGAAGCGG - Intronic
901653423 1:10755852-10755874 CTGGGGTGGGGGGTGCAGAGGGG - Intronic
901657906 1:10781149-10781171 CTTGCCTGGAGGGCGAGGAGGGG + Intronic
902323687 1:15684653-15684675 AGGGCGTGGGGGGCGCGGCGAGG - Intronic
903109002 1:21112329-21112351 CTGTCTTGGGTGGCTCTGAGTGG - Intronic
903830126 1:26169716-26169738 CTCGCTGGGGAGGCGCGGGGTGG - Intergenic
903897623 1:26619076-26619098 CGGGGTGGGGGGGCGGGGAGTGG - Intergenic
904043627 1:27598112-27598134 CTGGCTCAGGGGGTGGGGAGGGG + Intronic
904259744 1:29281471-29281493 CAGGCTTGGTGGGAGGGGAGCGG + Intronic
904607218 1:31704377-31704399 CGGGGTGGGGGGGCGGGGAGGGG + Intergenic
905075819 1:35269278-35269300 CTGGGTGGGGGGGAGGGGAGGGG + Intronic
905337496 1:37255576-37255598 CTGGCGTGGAGGGGGCGGGGAGG + Intergenic
905819630 1:40979649-40979671 CGGGCCTGGAGGGCGCGGGGCGG - Exonic
905864347 1:41368622-41368644 ATGGGTTGGGGGGTGGGGAGAGG - Intronic
905932360 1:41798133-41798155 CTGTCGTGGGGTGCGGGGAGTGG + Intronic
906264427 1:44417749-44417771 CTGGGGGAGGGGGCGCGGAGAGG + Intronic
906345309 1:45010974-45010996 CTGTCGCGGGCGGCGCGGAGGGG + Exonic
908159668 1:61394176-61394198 CTGTCTTGGGTGGGGCAGAGGGG - Intronic
910795990 1:91098485-91098507 ATGGCTTGGAGGGCCCGGACAGG + Intergenic
911081691 1:93939269-93939291 CTGTCGTGGGGTGCGGGGAGCGG - Intergenic
911725538 1:101237983-101238005 CTGGCTTGGGGTGGGGGGTGGGG + Intronic
911842593 1:102702896-102702918 CTGTTGTGGGGTGCGCGGAGCGG + Intergenic
911927304 1:103851174-103851196 CTGTCTTGGGGTGGGGGGAGGGG - Intergenic
912518308 1:110229308-110229330 CTGGCTTGGGGCGCAGGTAGGGG + Intronic
912655858 1:111485928-111485950 CTGGGTTGGGGGGTGGGCAGGGG - Intronic
912993532 1:114511314-114511336 CTCGGTTCGCGGGCGCGGAGCGG + Intergenic
916054188 1:161056529-161056551 CTGCCTGGGGAGGCGCGGTGTGG + Exonic
916792586 1:168136951-168136973 CGGGCGTGGGGGGGGCGGGGCGG - Intronic
916904876 1:169272441-169272463 CTGTCATGGGGGGCGGGGGGAGG - Intronic
917854355 1:179089045-179089067 CTAGCTTGGGGAGTGTGGAGGGG + Intronic
918770838 1:188558100-188558122 GTGGGTTGGGGGGAGCGGGGAGG - Intergenic
919896696 1:202013473-202013495 CTGGCTTGGTGGTCCTGGAGAGG + Intronic
922397002 1:225212053-225212075 CTGTCTTGGGGTGGGGGGAGGGG - Intronic
922614172 1:226951404-226951426 CAGGCCTGGGGGGCTGGGAGGGG - Intronic
922676811 1:227558570-227558592 CTGGCTTGCTGTGCGGGGAGCGG + Intergenic
922698057 1:227741583-227741605 CTGGCATGGGAGGGCCGGAGAGG + Intronic
924150840 1:241127541-241127563 GTGGCGTGGGGGGAGCGGGGAGG + Intronic
924561124 1:245156701-245156723 CTGGCTGGGGAGGCGCCGGGAGG + Intronic
1065186612 10:23174899-23174921 CCGGATTGGGGGCCGGGGAGGGG + Intergenic
1065590342 10:27256741-27256763 CGGGGGTGGGGGGCGCGGGGCGG - Intergenic
1066975646 10:42365930-42365952 CTGAGTTGGGGGGAGGGGAGAGG - Intergenic
1067806083 10:49394764-49394786 CTGGCCTGGGGAGTGGGGAGTGG + Intronic
1067889957 10:50126341-50126363 CTGGCGTGTGGAGCGAGGAGAGG - Intronic
1068159153 10:53241510-53241532 GTGGGGTGGGGGGAGCGGAGAGG - Intergenic
1068340963 10:55701988-55702010 CAGGGTTGGGGGGCTAGGAGAGG + Intergenic
1068989141 10:63133347-63133369 CTGGCTCTTGGGGCGCAGAGAGG + Exonic
1069854871 10:71434582-71434604 CTGGCTGGGGAGGCTCTGAGAGG - Intronic
1074453770 10:113580154-113580176 CTGTCTTCGGGGGCGGGGGGAGG + Intronic
1075774829 10:124975996-124976018 CTGTCTTGTGGGGAGCGGAGGGG + Intronic
1076614384 10:131746489-131746511 TTGGCTTGGGGGGTGGGGGGCGG - Intergenic
1076665491 10:132087854-132087876 CTGTCATGGGGTGCGGGGAGTGG - Intergenic
1076826660 10:132972875-132972897 ATGGCTTGGGGGCAGCGGTGAGG - Intergenic
1076838388 10:133032616-133032638 CTGGCGTGGGGAGTGGGGAGTGG + Intergenic
1076880103 10:133235838-133235860 CGGGCTTGGGGGGATCGGAGGGG + Intergenic
1077043172 11:533394-533416 CTGGCTGGGGCGGGGCGGGGCGG + Intronic
1077154530 11:1085447-1085469 CTGGGGTGGGGGGCGCTGAGAGG + Intergenic
1077300355 11:1843895-1843917 CTGGGTTGGGGGGTGAGGAATGG + Intergenic
1077384002 11:2260511-2260533 CTGGCTGGTGGGGGGCAGAGCGG - Intergenic
1077403253 11:2369261-2369283 AAGGCTTGGGGGGCAGGGAGGGG - Intergenic
1078057567 11:8019724-8019746 CTGGCGGGCGGGGCGAGGAGGGG + Intronic
1079030299 11:16981630-16981652 CGGGGTTGGGGGGCGGGGCGGGG + Intronic
1079132232 11:17753694-17753716 CCGGCGTGGGGGGTGGGGAGGGG + Intronic
1079543850 11:21608910-21608932 CTGTCTTGGGGTGGGGGGAGTGG + Intergenic
1080485268 11:32699729-32699751 GTGGGGTGGGGGGAGCGGAGAGG + Intronic
1080586387 11:33686518-33686540 CTGGATTGGGGAGGGCGCAGTGG + Intergenic
1081370158 11:42290779-42290801 CTGTCTTGGGGTGGGGGGAGGGG - Intergenic
1081760361 11:45572573-45572595 CTGGCCTGGAGGGCCCGGAGGGG - Intergenic
1081866147 11:46361758-46361780 CTGGCTGGGTGGGTGCGGGGAGG + Intronic
1081945770 11:46992385-46992407 CTGTCTTGGGGTGGGGGGAGGGG - Intronic
1083477427 11:62923232-62923254 GCGGCTTGGGCGGCGCGGTGGGG + Intergenic
1083595348 11:63916276-63916298 CCGGCCTGGGGGGAGCGGAGTGG - Intronic
1084526896 11:69703574-69703596 CTGGGGTGGGGCGCGCGCAGCGG + Intronic
1085023674 11:73224275-73224297 GTGGCTTGAGGGGAGTGGAGAGG - Intronic
1086804761 11:91226428-91226450 ATGGGTTGGGGGGAGCGGGGAGG + Intergenic
1086832591 11:91583855-91583877 CTGGCTTCTGGGGCTTGGAGGGG + Intergenic
1090275792 11:125418507-125418529 CTGGCTGGGGGGAGGCAGAGCGG + Intronic
1090606116 11:128424535-128424557 CTGGCCTGGGAGGGGCCGAGGGG + Intergenic
1091238458 11:134037001-134037023 CGGGGCTGGGGGGCGCGGGGAGG - Intergenic
1091829658 12:3540617-3540639 CGGGCTGGGGGGGCTGGGAGGGG - Exonic
1092696507 12:11177466-11177488 CTGGGTTGGGGGGAGGGCAGGGG + Intergenic
1093894540 12:24562119-24562141 CTGGGCTGGGGGTGGCGGAGAGG - Intergenic
1093995697 12:25640139-25640161 GTGACTTGGGGGGAGAGGAGTGG + Intronic
1094118135 12:26938875-26938897 CGGAGTCGGGGGGCGCGGAGAGG - Intronic
1094514836 12:31120314-31120336 CGGGGTCGGGGGGGGCGGAGAGG - Intergenic
1095332422 12:40982936-40982958 CTGTCTTGGGGTGGGGGGAGGGG + Intronic
1095679480 12:44956824-44956846 GTGGGTTGGGGGGAGCGGGGAGG + Intergenic
1097053727 12:56238295-56238317 GTGTGTTGGGGGGCACGGAGGGG - Exonic
1097234394 12:57529432-57529454 ATGGCTTCGGGGGGGCGGGGGGG - Exonic
1097716260 12:62969916-62969938 CTGGGTGTGGGGGCGCGGGGAGG + Intergenic
1098541482 12:71663121-71663143 CTGGAGTCGGGGGCGAGGAGTGG - Exonic
1100824098 12:98458547-98458569 CTGTTGTGGGGGGAGCGGAGAGG + Intergenic
1101557835 12:105827270-105827292 CTGTTTTGGGGTGCGGGGAGGGG + Intergenic
1102589508 12:113946729-113946751 CAGGCTTGAGAGGCGGGGAGAGG - Intronic
1103500713 12:121399917-121399939 CTGGCTGGGAGTGCGCGGGGAGG - Intergenic
1104611822 12:130235100-130235122 CAGGTTTGGGGGGCGGGGTGGGG + Intergenic
1104894876 12:132159199-132159221 CTGTCTTGGGGGGTGCTGGGCGG + Intergenic
1106250202 13:27977108-27977130 CTGTGTTGGGGGGGGCGGGGGGG + Intergenic
1106295909 13:28413363-28413385 CTGGCTTGGGGGGTGGAGGGCGG - Intronic
1107549052 13:41457974-41457996 CGGGGTTGGGGGGAGCGGCGGGG + Intronic
1108191130 13:47940141-47940163 GTGGCTTGGGGGGCAGGGGGCGG + Intronic
1110002056 13:70214725-70214747 GTGGCGTGGGGGGAGGGGAGAGG + Intergenic
1110092572 13:71471304-71471326 CAGGCTTGGGGAGAGGGGAGAGG + Intronic
1110173197 13:72526709-72526731 GTGGGTTGGGGGGAGGGGAGAGG + Intergenic
1110226082 13:73121111-73121133 CGGGGTTGGGGGGCGGGGGGAGG + Intergenic
1111103355 13:83614174-83614196 CTGGCATGGGGTGAGGGGAGGGG - Intergenic
1111214985 13:85129879-85129901 GTGGGTTGGGGGGAGGGGAGAGG + Intergenic
1111232563 13:85363131-85363153 CTGGCGGGGGGGGTGTGGAGTGG + Intergenic
1115126572 14:30002158-30002180 CTTGCTTGGGGGGCGGTGATGGG + Intronic
1116806229 14:49496206-49496228 CTGGCTTGGGAGGCTTGAAGTGG - Intergenic
1117974166 14:61281210-61281232 CGGGCTTGCGCGGCGCGGAGAGG - Exonic
1118932433 14:70255072-70255094 CAGGCATGGCGGGCGGGGAGGGG - Intergenic
1119702006 14:76761893-76761915 CCGGCTCGGGCGGCGCGCAGGGG - Intergenic
1121717398 14:96086196-96086218 CTGGCATGGGGGGAGGGGAATGG + Intronic
1122066308 14:99176269-99176291 CTGGCCTGGGGGACGCGGCCCGG + Intronic
1122077796 14:99246751-99246773 CTGTCTTGCGGGCGGCGGAGAGG + Intronic
1122543690 14:102510926-102510948 CTTGCTTGGTTGGAGCGGAGTGG - Intergenic
1123174919 14:106407721-106407743 GTGGGTTGGGGGGAGGGGAGAGG + Intergenic
1123423385 15:20148763-20148785 CCGGCTTTGGGGGCTCTGAGTGG + Intergenic
1123486534 15:20745248-20745270 GTGGGTTGGGGGGAGCGGGGAGG - Intergenic
1123532606 15:21155284-21155306 CCGGCTTTGGGGGCTCTGAGTGG + Intergenic
1124147251 15:27139259-27139281 CTGGTTTGGGGGGTGCAGAGAGG + Intronic
1124668717 15:31617925-31617947 CTGTTTTGGGGTGGGCGGAGGGG - Intronic
1125522898 15:40358075-40358097 CTGGCCTGGCGGGAGCAGAGGGG + Intergenic
1128146055 15:65333113-65333135 CTGGCCTGGGGGCCGGTGAGGGG + Intronic
1128841183 15:70853218-70853240 CTGCCTTGCGGGGGGCGGGGGGG - Intronic
1129691337 15:77715288-77715310 GTGGCTTGGGGGCCTAGGAGGGG + Intronic
1129707097 15:77800509-77800531 CTGGCTCTGGGGGAGGGGAGGGG - Intronic
1129814542 15:78540397-78540419 CTGGGTTGGGGCGGGGGGAGCGG - Exonic
1129863134 15:78879226-78879248 CTGTCTTGGGGGGCGGGGCGGGG - Intronic
1131609549 15:93946788-93946810 CTGGGATGGGGTGCGGGGAGAGG + Intergenic
1132805144 16:1771800-1771822 CTGGCCGGGGGGGCGCGGGGGGG - Intergenic
1132945874 16:2531205-2531227 CTGGCTGGAGGGTCGGGGAGGGG + Exonic
1133973025 16:10580587-10580609 CTGGCTGGGGGTGCGAGGCGAGG + Exonic
1134069910 16:11254729-11254751 CTGGGTTGGAGGGAGCGGATGGG - Exonic
1135903513 16:26489038-26489060 CAGGGTCGGGGGCCGCGGAGGGG + Intergenic
1136222081 16:28835404-28835426 CTGCCATGGGGGGTGCTGAGTGG + Intronic
1136637884 16:31537448-31537470 CTGGCCAGGGAGTCGCGGAGTGG - Intergenic
1136867888 16:33770940-33770962 CTGGCTCGGGCAGCGCTGAGGGG + Intergenic
1136898924 16:34015149-34015171 CTGGCTCGGGCAGCGCCGAGGGG + Intergenic
1138785818 16:59844957-59844979 CTGAGTTGGGTGGCGGGGAGTGG + Intergenic
1140315224 16:73889817-73889839 CTGGCTCTGGGGGCGGGGATGGG - Intergenic
1141764497 16:86049514-86049536 CAGGCTTGGGGGGGTAGGAGAGG - Intergenic
1142335861 16:89489764-89489786 CGGGCCTCGGGGGCTCGGAGCGG - Intronic
1203074084 16_KI270728v1_random:1108387-1108409 CTGGCTCGGGCAGCGCCGAGGGG - Intergenic
1203104291 16_KI270728v1_random:1345352-1345374 CTGGCTCGGGCAGCGCTGAGGGG - Intergenic
1203129223 16_KI270728v1_random:1617016-1617038 CTGGCTCGGGCAGCGCTGAGGGG + Intergenic
1142586809 17:979247-979269 CGGGCGTGGGGGGCGGGCAGGGG + Intronic
1142586821 17:979273-979295 CGGGCGTGGGGGGCGGGCAGGGG + Intronic
1142623551 17:1179435-1179457 CTGGTCTGGGGGGCGCGGGCGGG - Intronic
1143014246 17:3883221-3883243 CTGGTTTGGGGGCCACGGTGAGG - Intronic
1143508611 17:7383360-7383382 GTGGCTTGAGGGGCAGGGAGGGG + Intronic
1143661371 17:8326653-8326675 CAGGCTTGGGGGCCGGGGCGTGG - Intergenic
1145765396 17:27455814-27455836 CTGGCTTGGTGGGCTGGGAATGG + Intergenic
1146093028 17:29901128-29901150 GTGGGTTGGGGGGAGGGGAGAGG + Intronic
1146172840 17:30646422-30646444 CTGGGGTGGGGGGCGAGGCGGGG + Intergenic
1146346297 17:32062433-32062455 CTGGGGTGGGGGGCGAGGCGGGG + Intergenic
1146384059 17:32353663-32353685 CTGGCTACGGGGGCGGGGGGAGG + Intronic
1146925636 17:36742855-36742877 CTGGCATCGGGGACGCTGAGAGG + Intergenic
1147307502 17:39573922-39573944 CTCTCTTGGTGGGCGGGGAGGGG + Intergenic
1147967220 17:44199770-44199792 CTGGAGTGGGGGGCGGGGGGAGG - Intronic
1148686696 17:49505133-49505155 CTGGCTTCGGGGGTGTGGTGGGG - Intronic
1148739517 17:49884616-49884638 CTTGCCCGGGGGGCGGGGAGCGG - Intergenic
1148760106 17:49995191-49995213 GTGGCTTGGGACGCGAGGAGAGG - Exonic
1150282497 17:63937558-63937580 CTGGCGTGGGGGATGGGGAGTGG - Intergenic
1151400134 17:73850554-73850576 CTGGCCTGGGGGGCTGGAAGGGG - Intergenic
1152363712 17:79843794-79843816 CTGGGTTTGGGGGCGCGACGGGG - Intergenic
1152566418 17:81102361-81102383 GAGTCTTGGGTGGCGCGGAGAGG - Intronic
1152768470 17:82153453-82153475 CAGGCTTGAGGGGCACTGAGGGG + Intronic
1153051431 18:906048-906070 CTGTCTTGGGGGGCGTGCGGTGG + Intronic
1153686646 18:7552839-7552861 CTGTCATGGGGTGCGGGGAGTGG - Intergenic
1156496012 18:37525427-37525449 CTGGGTTGTGGGGAGGGGAGTGG + Intronic
1157062316 18:44305835-44305857 CTGTCATGGGGTGGGCGGAGGGG + Intergenic
1157828466 18:50834114-50834136 CTGCCTTGGGGGCTGGGGAGTGG - Intergenic
1158258982 18:55587714-55587736 CAGGGTTGGGGGGAGCGGAGTGG + Intronic
1158763652 18:60421757-60421779 CAGGCTTGGGGGGCCCTGAAAGG + Intergenic
1159022642 18:63155914-63155936 CTGGCTGGGGAGGCGGGGAAGGG - Intronic
1159237973 18:65702166-65702188 CTGTCATGGGGTGGGCGGAGGGG - Intergenic
1159952602 18:74496251-74496273 CTGGATTGGTGGGCGTGGCGGGG + Exonic
1160452425 18:78974407-78974429 CTGGCGCGGGGGGGGCGGGGCGG + Intergenic
1160453202 18:78979322-78979344 GCGGGTTGGGGGGCGGGGAGAGG + Intergenic
1160696815 19:488955-488977 CGGGCTTGGGGCGGGCGGCGCGG - Intergenic
1160714652 19:570707-570729 GTGGGTTGGGAGGGGCGGAGGGG + Intergenic
1160714664 19:570730-570752 GTGGGTTGGGAGGGGCGGAGGGG + Intergenic
1160714676 19:570753-570775 GTGGGTTGGGAGGGGCGGAGGGG + Intergenic
1160714688 19:570776-570798 GTGGGTTGGGAGGGGCGGAGGGG + Intergenic
1160714700 19:570799-570821 GTGGGTTGGGAGGGGCGGAGGGG + Intergenic
1161104650 19:2437243-2437265 CTGCCTCCGGGGGCTCGGAGAGG - Intronic
1161378075 19:3950349-3950371 CTGGGGTGGGGGGCGGGGGGCGG - Intergenic
1161392374 19:4028237-4028259 CAGGACTGGGGGGCGGGGAGGGG - Intronic
1161468171 19:4443615-4443637 CTGGGTTGGGGGGTTAGGAGAGG + Intronic
1161715958 19:5876540-5876562 CTTGCTTGGGGGGTGCGGTGAGG + Intronic
1163243121 19:16076423-16076445 CCGGCCCGGGGGGCGGGGAGAGG + Intronic
1163701200 19:18787457-18787479 GGGGGTTGGGGGGCGAGGAGAGG - Intronic
1164051204 19:21586808-21586830 GAGGCCTGGGGGGAGCGGAGCGG - Intergenic
1164834683 19:31349645-31349667 CGGGGCTGGGGGGCGGGGAGAGG + Intergenic
1166076595 19:40417419-40417441 CTGGACTGGGTGGGGCGGAGTGG - Intergenic
1166361076 19:42253329-42253351 CTGGATGGAGGGGTGCGGAGCGG + Intronic
1166712420 19:44945806-44945828 CTGGGTTGGGGGCTGTGGAGGGG - Intronic
1167426336 19:49431586-49431608 GTGGCGTGGAGGGCGCGAAGAGG - Intronic
1167622115 19:50566360-50566382 CTGGAGAGGGGGGCGGGGAGGGG + Intronic
1167967405 19:53158574-53158596 CTGGGGTGGAGGGCGCGGTGCGG + Intronic
1167972500 19:53197240-53197262 CTGGGGTGGAGGGCGCGGTGTGG - Intergenic
1168060506 19:53889599-53889621 CTGGCTTAGGGGGCGTTGGGAGG - Intronic
1168309177 19:55452114-55452136 CGGGCTTGGGGGGTGAGGAGGGG + Intergenic
1168347097 19:55655252-55655274 CAGGGTTGGGGGGCGCCGCGCGG - Intronic
925132697 2:1504620-1504642 CTGGCTTGGAGGCAGCGGTGAGG - Intronic
925189065 2:1868563-1868585 CTGCCTTCGGGGCCGGGGAGAGG - Intronic
926205618 2:10832915-10832937 GTGGCTGGGGGGGCGGGGGGTGG - Intronic
926466487 2:13196372-13196394 TTGGCGTGGGGGGAGCGGGGTGG - Intergenic
926707088 2:15844607-15844629 CTGGGTGGGGTGGGGCGGAGGGG - Intergenic
927708914 2:25313353-25313375 CTGGGGTGGGGGGCGGGGACAGG + Intronic
930666884 2:54108063-54108085 CTGGCTTGTGGGGCACCAAGAGG - Intronic
932019626 2:68069729-68069751 CTGTCTTGGGGCGGGGGGAGGGG + Intronic
933354733 2:81197023-81197045 CGGGCGTGGAGGGCGGGGAGTGG + Intergenic
934708979 2:96503087-96503109 CTGGCTCTGGGGGCAAGGAGGGG + Intronic
934712984 2:96527687-96527709 CGGGCTTGGGGGGCGGGCAGCGG - Intergenic
936482173 2:112893850-112893872 CTGGCTGGTGGGGAGTGGAGAGG + Intergenic
938077471 2:128347313-128347335 CTGGCTTGGGGCAGGTGGAGAGG - Intergenic
938166948 2:129038286-129038308 CTGTTTTGGGGTGGGCGGAGGGG - Intergenic
938413387 2:131084182-131084204 GTGGGGTGGGGGGGGCGGAGGGG - Intronic
939630871 2:144524555-144524577 AAGGCTTGGGGGGCGGGGAGCGG + Intronic
940398672 2:153222302-153222324 CTGGCTGGGGGGGGGGGGGGGGG + Intergenic
941594688 2:167461181-167461203 ATGGCTTGTGGGGCCCAGAGTGG - Intergenic
942087600 2:172457968-172457990 CTTGGTTGGGGGGCGGGGAGGGG - Intronic
943139917 2:183969748-183969770 GTGGGGTGGGGGGCGGGGAGAGG - Intergenic
943728958 2:191281554-191281576 CTGGCCTGGGGGCCGGGGAGGGG - Intronic
944612650 2:201427320-201427342 CTGTTTTGGGGTGCGGGGAGGGG - Intronic
944963700 2:204905321-204905343 CTGGCATGGTGGGAGAGGAGAGG + Intronic
946053199 2:216880780-216880802 CTGGCTTGTGGGGTGTGCAGTGG - Intergenic
947624577 2:231611724-231611746 CTGGCTGGGGTGGGGTGGAGAGG + Intergenic
948118405 2:235510984-235511006 CTGGGTGGGGGGGCGGGGGGCGG + Intronic
948196928 2:236103425-236103447 CTGAGGTGGGGGGCGGGGAGTGG - Intronic
948397877 2:237661086-237661108 CTGGGTTGGGCTGCGGGGAGAGG + Intronic
948487318 2:238289076-238289098 CCAGCTCGGGGAGCGCGGAGTGG + Intronic
948641897 2:239380072-239380094 CTGGGGTCGGGGGCGCGGCGTGG + Intronic
948944044 2:241210409-241210431 CTGCCTCGGGGGGCCCTGAGCGG + Intronic
948953906 2:241272651-241272673 CTGACGTGGAGGCCGCGGAGGGG - Intronic
948975506 2:241461273-241461295 CTGGCTTGGGGGGCGCGGAGGGG - Intronic
1169080720 20:2796501-2796523 CTGGCATGGGGAGTGGGGAGAGG - Intronic
1172455725 20:35071428-35071450 CTGGCATGGGGTGGGGGGAGGGG - Intronic
1172465044 20:35149933-35149955 CTGGGTTGGGGGGGGCGCGGGGG - Intergenic
1172644486 20:36461401-36461423 CTGACGCGGGGGGCGGGGAGGGG + Intronic
1174037806 20:47678858-47678880 CTCGCGTGGGGGGTGGGGAGCGG + Intronic
1175590412 20:60185604-60185626 CTGTTGTGGGGGGCGGGGAGGGG - Intergenic
1175863497 20:62162729-62162751 CTGGCATGGGGAGCAGGGAGTGG - Intronic
1175927030 20:62476025-62476047 CGGGCCGGGGCGGCGCGGAGGGG - Intergenic
1176051035 20:63119915-63119937 CTGGCTTGGGTGCTGTGGAGGGG - Intergenic
1176074359 20:63241740-63241762 CTGGCCTGTGGGGCTGGGAGTGG + Intronic
1176300411 21:5096474-5096496 CTGGCACGGGGTGCGGGGAGTGG - Intergenic
1176383031 21:6122875-6122897 CTGGGTTTGGGGGCGGGGACTGG - Exonic
1176988432 21:15464788-15464810 GTGGGGTGGGGGGCGAGGAGAGG + Intergenic
1178544038 21:33479016-33479038 CTGGGTCGGGGGGTGCGGAGGGG - Intronic
1179740438 21:43415364-43415386 CTGGGTTTGGGGGCGGGGACTGG + Exonic
1179856633 21:44165507-44165529 CTGGCACGGGGTGCGGGGAGTGG + Intergenic
1180230599 21:46424707-46424729 CAGGGTTGGGGGGGGCGCAGTGG - Intronic
1180830897 22:18905704-18905726 CTGGTCTGGGGAGCGGGGAGAGG + Intergenic
1180871605 22:19150006-19150028 CTGGGTGAGTGGGCGCGGAGCGG - Exonic
1182153105 22:28044595-28044617 GTGGGTTGGGGGGAGCGGGGAGG - Intronic
1182346343 22:29668494-29668516 CTGGCCTGGGAGGCGAGGAGTGG + Intronic
1183232732 22:36593060-36593082 CAGCCTTGGGGAGCGAGGAGAGG + Intronic
1183302028 22:37063201-37063223 CTGGCCTGGGGGGCGGGGAGAGG + Exonic
1183718790 22:39550137-39550159 CTGGCTGGGGTGGCACAGAGGGG + Intergenic
1183961430 22:41413880-41413902 CCGGCACGGCGGGCGCGGAGGGG + Intergenic
1184545262 22:45163476-45163498 CTGGCCGGGGTGGCCCGGAGGGG - Intergenic
1185352550 22:50345807-50345829 CTGACTTGGGGGGCACTGACTGG - Intronic
1185352639 22:50346114-50346136 CTGACTTGGGGGGCACTGACTGG - Intronic
1185380228 22:50504528-50504550 CGGGCTTGGGGGGTGTGGAGTGG - Intronic
949354875 3:3169934-3169956 GTGGGTTGGGGAGGGCGGAGGGG - Intronic
950557542 3:13704535-13704557 CTGGGGTGGGGGGCGGGGTGGGG + Intergenic
951411471 3:22372315-22372337 CTCGCATGGGGGGCGCGGAATGG - Intronic
951898350 3:27632776-27632798 CCGGCCCGGGGGGCGGGGAGAGG + Intergenic
953916277 3:46923011-46923033 CTGTCTTTGGGGGCCAGGAGTGG - Intronic
954615704 3:51967781-51967803 CTGGCCTGGCGGGAGCGGAGGGG - Intronic
954663728 3:52239413-52239435 CTGGCTTGGGGCGCACAGATCGG - Intergenic
955769517 3:62373702-62373724 CAGGTTTGGGGGACGCGGGGAGG + Intronic
955993763 3:64656779-64656801 CAGGGTTGGGGGGCGCAGAGGGG + Intronic
956448625 3:69350818-69350840 CTGCCTTGGGGTGTGGGGAGGGG + Intronic
956813531 3:72887953-72887975 CTGGCTGCGGGCGGGCGGAGGGG + Intergenic
958443166 3:94180842-94180864 CTGTCTTGGGGTGGGAGGAGGGG - Intergenic
959656844 3:108816352-108816374 CTGTCATGGGGTGGGCGGAGCGG + Intergenic
960838542 3:121932908-121932930 CTGTTGTGGGGTGCGCGGAGGGG - Intronic
961477875 3:127159801-127159823 CTGGCTGGGGGAGGGAGGAGGGG + Intergenic
964486555 3:157191172-157191194 CTGTCGTGGGGTGGGCGGAGGGG - Intergenic
964620714 3:158717734-158717756 CTGGCTGAGGGGGCGGGGAGAGG + Intronic
965615216 3:170585855-170585877 GGGGCGCGGGGGGCGCGGAGGGG + Intronic
966536507 3:181041042-181041064 CTGTCATGGGGTGGGCGGAGGGG - Intergenic
967220329 3:187242924-187242946 CAGGGTTGGGGAGCGAGGAGTGG - Intronic
969054046 4:4390617-4390639 CTGGCTTGGGGAGCGGGGTTTGG + Intronic
969585307 4:8088074-8088096 CTGAGTTGGGGGGCGCTGAGTGG - Intronic
969592636 4:8130647-8130669 CTGGCCTGGAGGGAGCAGAGGGG + Intronic
969720825 4:8892501-8892523 GTGGCGTGGGGGGAGGGGAGGGG - Intergenic
969844822 4:9912139-9912161 CTGGGGTGGGGGGAGCGGGGAGG + Intronic
972591758 4:40494691-40494713 CTGGCTTCTGGGGCTTGGAGGGG - Intronic
974024229 4:56718607-56718629 GTGGCATGGGGGGAGGGGAGAGG + Intergenic
979821299 4:125175588-125175610 CTGTCGTGGGGTGCGGGGAGGGG - Intergenic
981033675 4:140151004-140151026 GGGGCATGGGGGGCGCGGCGGGG + Intronic
982373718 4:154663111-154663133 GTGGCATGGGGGGAGCGGGGAGG + Intronic
984605368 4:181779784-181779806 CTGTCGTGGGGTGCGGGGAGTGG - Intergenic
985708348 5:1414393-1414415 CTGGGTGGGGGGGCCTGGAGGGG + Intronic
985780204 5:1866632-1866654 CTGGCCTGTGGGGGGAGGAGGGG - Intergenic
986661780 5:10065769-10065791 AGGGCGTGGGGGGCGGGGAGGGG - Intergenic
987097009 5:14559100-14559122 CTGGCTTGGGGGAAGGAGAGGGG + Intergenic
987308526 5:16660854-16660876 CTGTCTGGCGGGGCGGGGAGTGG + Intergenic
987380887 5:17284821-17284843 CTGCCTTGGGGGCTGTGGAGAGG + Intergenic
987703670 5:21434955-21434977 CTGTCGTGGGGTGCGGGGAGGGG - Intergenic
989188914 5:38650614-38650636 CGGGCTTGGGGGAGGGGGAGGGG + Intergenic
992363433 5:76066442-76066464 CTGTCTTGGGGTGGGGGGAGGGG + Intergenic
992690383 5:79236004-79236026 CTGGCTCAGGGGACGCCGAGAGG + Intronic
992958308 5:81933182-81933204 CTGTCTTGGGGTGGGCGTAGGGG - Intergenic
993242455 5:85408069-85408091 GTGGGTTGGGGGGAGCGGGGAGG + Intergenic
993305701 5:86272630-86272652 CTGTTATGGGGGGCGGGGAGGGG + Intergenic
995524492 5:113039702-113039724 TTGGGGGGGGGGGCGCGGAGTGG - Intronic
996299231 5:121961626-121961648 ATGGCTAGGGGGGCGCTGAACGG - Intergenic
997456962 5:134024878-134024900 CTGGCTAGGGGGTAGGGGAGTGG - Intergenic
997800807 5:136859643-136859665 GTGGCTTGGGGGAGGCGTAGAGG - Intergenic
997877327 5:137560839-137560861 CTGGGGTGGGGGGCGGGGGGAGG + Intronic
998140601 5:139697534-139697556 CTGGCTGGTGGGGGGCGGAGTGG + Intergenic
1001424191 5:171612809-171612831 CTGGGGTGGGGGACGGGGAGAGG - Intergenic
1001791492 5:174461216-174461238 CTGGCTTCTGGGGGGCAGAGGGG + Intergenic
1002027946 5:176408071-176408093 CTGGCTGGGGGGCCGAGGTGAGG + Intronic
1003325440 6:5086667-5086689 CTGGCGTGAGGGGCGCGTGGAGG + Exonic
1005674761 6:28142100-28142122 CTGGCCTGAGGGGTCCGGAGAGG + Intronic
1005755863 6:28924289-28924311 CTGGCTTTGGCCGCGCGCAGTGG + Intergenic
1006108245 6:31729337-31729359 CTGGAGTGGGTGGGGCGGAGTGG - Exonic
1006388416 6:33745107-33745129 CTGGCTGGGGAGGCGCAGGGTGG - Intronic
1006643088 6:35498295-35498317 CGGGCTCTGGGGGCGCTGAGGGG + Exonic
1007045467 6:38769361-38769383 CTGGCTTGGGAGGCTAGGGGAGG - Intronic
1007698139 6:43746886-43746908 CTCCCTTGGGGGGCTGGGAGCGG + Intergenic
1008374156 6:50772235-50772257 CTGTCATGGGGTGGGCGGAGGGG + Intronic
1008650373 6:53555328-53555350 CAGGGTTGGGGGGAGCAGAGGGG - Intronic
1009521737 6:64690828-64690850 CTGGGGTGGGGGGAGCGGGGAGG + Intronic
1010182474 6:73103479-73103501 CTGTCATGGGGGGGGGGGAGAGG + Intronic
1011549845 6:88521350-88521372 GTGGGGTGGGGGGAGCGGAGAGG - Intergenic
1011641736 6:89422368-89422390 TTGGCTTGGGGAGGGGGGAGCGG - Intergenic
1015244669 6:131062988-131063010 CCGGGATGGGGGGCGGGGAGAGG - Intronic
1015480416 6:133702281-133702303 CTGGGTTGGGGGAGGCAGAGAGG - Intergenic
1015932893 6:138380478-138380500 CTGGCTAGGGCGGGGCGCAGTGG + Intronic
1016923417 6:149317759-149317781 CTGGCTGAGGGGGAGGGGAGGGG - Intronic
1017073855 6:150600180-150600202 GGGCCTTGGGGGGCGCCGAGCGG + Intronic
1017324442 6:153130387-153130409 CTGGCGTGTGCGGCGCGGGGTGG - Intronic
1019362714 7:613779-613801 TTGGCTCGGGAGGCCCGGAGCGG - Intronic
1019408082 7:894344-894366 GTGGCTTTGGGGTCGCGGCGGGG + Intronic
1019461301 7:1160312-1160334 CGGGCCTGCGGGGCGCGGCGGGG - Intronic
1019518167 7:1448591-1448613 CTGGCTCGGCGGGCGCGGCAGGG + Intronic
1019569685 7:1705060-1705082 CTGGGGTGGGGGGCGCGTACTGG + Intronic
1019689727 7:2403799-2403821 CTGGCCTGGCGGGCGCGGCTTGG + Intronic
1019856092 7:3609703-3609725 CTGTCTTGGGTGGCGGGGGGTGG - Intronic
1022763724 7:33385980-33386002 GTGGGGTGGGGGGAGCGGAGAGG + Intronic
1022942503 7:35254061-35254083 CTGGCGTGGGGAGCGCGGCGCGG + Exonic
1022989550 7:35694689-35694711 CCAGCTTGGGGGTCGCGGTGGGG - Exonic
1023455452 7:40333899-40333921 CTGTCGTGGGGTGCGGGGAGTGG - Intronic
1023875846 7:44285853-44285875 ACGGCGTGGGGGGCGCGGCGGGG + Intronic
1025306702 7:57868079-57868101 CTGGCAAGGGCAGCGCGGAGGGG - Intergenic
1025600642 7:62993353-62993375 CTGTCATGGGGTGCGGGGAGGGG - Intergenic
1026009896 7:66628739-66628761 CTGGGTTGGGGGGGGGGGGGGGG - Intergenic
1027539606 7:79452317-79452339 CTGGCTAGGGGTGAGCGCAGGGG + Intronic
1027576785 7:79941234-79941256 CTGTCATGGGGTGAGCGGAGCGG - Intergenic
1027620046 7:80472999-80473021 CTGGCGTGGGAGGGGCAGAGGGG + Intronic
1028099818 7:86805895-86805917 CTGTCGTGGGGTGCGGGGAGGGG - Intronic
1029207035 7:98875843-98875865 CTGGCTCTGGGGGGGCGGTGGGG + Intergenic
1030779021 7:113574125-113574147 CTGTCATGGGGTGCGGGGAGGGG + Intergenic
1031233981 7:119147971-119147993 CTAGTTTGGGGGGCGGGGGGCGG + Intergenic
1031467821 7:122135118-122135140 CTGTCATGGGGTGCGGGGAGGGG + Intronic
1031604105 7:123748546-123748568 CGGGCTTGGGGGCCGGGAAGTGG - Intronic
1032018177 7:128392764-128392786 CTGGCTGGCTGGGCTCGGAGGGG + Exonic
1032399506 7:131614034-131614056 CTGGCTTGAGGGGAGAGGAAAGG + Intergenic
1033352231 7:140570764-140570786 CTGGCCTGGGAGGTGGGGAGGGG - Intronic
1035436373 7:158863111-158863133 CTGGCTGGGGGTGGGGGGAGGGG + Intronic
1035450399 7:158973943-158973965 CGAGGGTGGGGGGCGCGGAGAGG - Intergenic
1035450417 7:158973982-158974004 CGAGGGTGGGGGGCGCGGAGAGG - Intergenic
1035450436 7:158974022-158974044 CGAGGGTGGGGGGCGCGGAGAGG - Intergenic
1036135322 8:6154950-6154972 CTAGCCTGGGGGACGGGGAGTGG + Intergenic
1036733282 8:11284727-11284749 CAGGCTGGGTGGGCGCGGCGAGG - Exonic
1036770435 8:11575104-11575126 CTGGCCTGGGTGGAGGGGAGGGG - Intergenic
1036798052 8:11769956-11769978 CTGCCTCGGGGTGCGGGGAGAGG - Exonic
1037886725 8:22599569-22599591 GGGGCTGGGGGGGCGGGGAGCGG - Intronic
1037922496 8:22817243-22817265 CTGGATTTGGGGGCACTGAGGGG - Intronic
1038276597 8:26126450-26126472 CTGACTTTGGGAGAGCGGAGGGG - Intergenic
1038405070 8:27315476-27315498 CTGCGTTGGGGGGAGGGGAGAGG - Intronic
1038444961 8:27596818-27596840 CTGTCTCGGGGGGCGGGGGGGGG + Intergenic
1038466817 8:27772297-27772319 ATGGCGTGGGGGGCGCGGAGGGG - Intronic
1038766115 8:30429257-30429279 CTGGCTGGGGGGCCTCAGAGGGG + Intronic
1039921790 8:41898019-41898041 CAGGGTTGGGGGGGGCGGCGGGG - Intergenic
1041971075 8:63743257-63743279 CAGGGTTGGGGGGCGAGGGGAGG + Intergenic
1042010297 8:64236691-64236713 CTGTCTTGGGGTGGGAGGAGGGG + Intergenic
1042985909 8:74582663-74582685 GTGGCTTGAGGGGTGAGGAGAGG + Intergenic
1043446870 8:80327572-80327594 CTGTCTTGGTGGGGGTGGAGCGG + Intergenic
1045037146 8:98184631-98184653 TTGGCTTGGGGGTCTCGGGGTGG - Intergenic
1045141546 8:99290499-99290521 CTGTCATGGGGTGCGGGGAGAGG + Intronic
1045510814 8:102810741-102810763 CTGGGTGGGAGGGCGCGGGGAGG + Intergenic
1047437574 8:124847635-124847657 CTGGTTTAGGGGGCACTGAGAGG - Intergenic
1049245257 8:141558997-141559019 CTGGCTTGGGGGCCAGAGAGAGG + Intergenic
1049760909 8:144331689-144331711 CTGCCGTGGGGGTCGGGGAGGGG + Exonic
1050672796 9:8016735-8016757 CAGGCTTGGGGGGCGTGGATTGG + Intergenic
1051318016 9:15864458-15864480 CTGTCGTGGGGTGCGGGGAGCGG - Intronic
1052358317 9:27528594-27528616 CTGGCGTGGGGGCCGGGGAGGGG + Intronic
1053575546 9:39355505-39355527 CCAGCTTGGGGGGTGGGGAGGGG + Intergenic
1054097106 9:60914192-60914214 CCAGCTTGGGGGGTGGGGAGGGG + Intergenic
1054118513 9:61189821-61189843 CCAGCTTGGGGGGTGGGGAGGGG + Intergenic
1054403150 9:64732374-64732396 CTGTTGTGGGGGGGGCGGAGGGG - Intergenic
1054745715 9:68852342-68852364 ATGGCTTGGGGGGCGGTGTGGGG - Intronic
1055987237 9:82063855-82063877 CCAGCTTGGGGGGTGGGGAGGGG - Intergenic
1056583670 9:87914344-87914366 CCGGCTTGGAGGGTGGGGAGGGG + Intergenic
1056584162 9:87917813-87917835 CCGGCTTGGAGGGTGGGGAGGGG + Intergenic
1056612707 9:88135112-88135134 CCGGCTTGGAGGGTGGGGAGGGG - Intergenic
1056613204 9:88138602-88138624 CCGGCTTGGAGGGTGGGGAGGGG - Intergenic
1057159938 9:92882423-92882445 CCGGCTTGGGGGGTGGGGAGGGG + Intergenic
1057625638 9:96673829-96673851 CTGGCTTTGGGGGAGGGGATGGG + Intergenic
1059375139 9:113875905-113875927 CGGGCGCGGGGGGCGCGGGGAGG + Intergenic
1060266671 9:122115720-122115742 CTGGCTTGAGGGGCAAGAAGTGG - Intergenic
1060727857 9:126017607-126017629 CTGGGATGGGGAGCGTGGAGTGG + Intergenic
1060757339 9:126223199-126223221 CTTGCTGGTGGGGAGCGGAGGGG + Intergenic
1060915230 9:127384971-127384993 CTGGCTTGGTGGCCGCGAAGGGG - Intronic
1061083431 9:128385774-128385796 CTGGATTTGGGGGTGGGGAGAGG - Intronic
1061874448 9:133536875-133536897 CTGGCTTGGAGGGAGCCGTGTGG + Intronic
1061880535 9:133566712-133566734 CTGGGTTGGGTGGGGCGGGGTGG + Intronic
1061932395 9:133839984-133840006 ATGGCCTCGGGGGCGGGGAGTGG - Intronic
1061976000 9:134068220-134068242 CTGGCCCGGGGGGCGCGCGGGGG + Intronic
1062225180 9:135446412-135446434 CTGGGGTGGGGGGAGGGGAGGGG + Intergenic
1062274888 9:135725997-135726019 ATGGCTGTGGGGGCTCGGAGTGG + Intronic
1062625111 9:137438973-137438995 CTGGGGTGGGGGCCGCAGAGAGG - Intronic
1185656339 X:1688691-1688713 CTGTCTCGGGGGGAGGGGAGGGG + Intergenic
1187648550 X:21375146-21375168 CCAGCTAGAGGGGCGCGGAGCGG + Intronic
1188546299 X:31311246-31311268 CTGGAATGGGGGGCGGGGGGTGG + Intronic
1190761402 X:53440939-53440961 CGACCTTGGCGGGCGCGGAGCGG - Intergenic
1192699057 X:73448207-73448229 CCAGCTTTGGGGGCGGGGAGGGG - Intronic
1192978603 X:76314890-76314912 CTGTATTGGGGTGGGCGGAGGGG - Intergenic
1193617978 X:83713086-83713108 CTGTCTTGGGGTGGGGGGAGGGG + Intergenic
1193710151 X:84869776-84869798 CTGTCGTGGGGTGGGCGGAGGGG + Intergenic
1195276760 X:103288486-103288508 GTGGGTTGGGGGGAGGGGAGAGG + Intergenic
1196828386 X:119758451-119758473 AGGCCTTGGGGGGCGTGGAGGGG - Intergenic
1198272911 X:135072248-135072270 CTGTCTTGGGGTGGGGGGAGTGG - Intergenic
1199104744 X:143851682-143851704 GTGGGGTGGGGGGAGCGGAGAGG - Intergenic
1200035003 X:153321273-153321295 CAGGTGTGGGGGGCGCGGAGGGG - Intergenic
1200829149 Y:7673445-7673467 CTGGCAGGGGGAGGGCGGAGGGG - Intergenic
1202167035 Y:22000538-22000560 CTGTCTTGGGGTGTGGGGAGCGG + Intergenic
1202224325 Y:22585835-22585857 CTGTCTTGGGGTGTGGGGAGCGG - Intergenic
1202318789 Y:23609825-23609847 CTGTCTTGGGGTGTGGGGAGCGG + Intergenic
1202551979 Y:26060233-26060255 CTGTCTTGGGGTGTGGGGAGCGG - Intergenic