ID: 948981143

View in Genome Browser
Species Human (GRCh38)
Location 2:241495480-241495502
Sequence CAGCACACTGCAGGGGTGGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 505
Summary {0: 1, 1: 0, 2: 3, 3: 65, 4: 436}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948981138_948981143 -9 Left 948981138 2:241495466-241495488 CCTGACGTGCACAACAGCACACT 0: 1
1: 0
2: 1
3: 7
4: 135
Right 948981143 2:241495480-241495502 CAGCACACTGCAGGGGTGGAAGG 0: 1
1: 0
2: 3
3: 65
4: 436
948981137_948981143 -8 Left 948981137 2:241495465-241495487 CCCTGACGTGCACAACAGCACAC 0: 1
1: 0
2: 0
3: 3
4: 75
Right 948981143 2:241495480-241495502 CAGCACACTGCAGGGGTGGAAGG 0: 1
1: 0
2: 3
3: 65
4: 436

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948981143 Original CRISPR CAGCACACTGCAGGGGTGGA AGG Exonic
900243282 1:1626792-1626814 CAGCAGGCTGCAGGTGTGGGGGG - Intronic
900431953 1:2606737-2606759 CACCCCTCTGCAGGGCTGGATGG + Intronic
900435317 1:2628344-2628366 CAGCCTCCCGCAGGGGTGGAGGG + Intronic
900467714 1:2833871-2833893 CAGCACAGTGCCGGGGTGCACGG - Intergenic
900586053 1:3432862-3432884 CAGCACAGGGCAGGTGGGGATGG - Intronic
901185992 1:7373517-7373539 CTCCACACTGCAGCGGGGGAAGG + Intronic
901492795 1:9605181-9605203 CAGCCCACATCAGGAGTGGAAGG - Intronic
901805070 1:11733536-11733558 CAGGACCCTGTAGGGGCGGAAGG - Intergenic
902228795 1:15014189-15014211 CAGAATCCTGCAGGTGTGGATGG - Intronic
905254588 1:36672010-36672032 GGGCACTCTGGAGGGGTGGAAGG - Intergenic
905259226 1:36705851-36705873 CAGCACACTGCAGGGTGCGCAGG + Intergenic
905825790 1:41025107-41025129 CAGCCCTCTTCAGGGGAGGAGGG - Intergenic
905957890 1:42014361-42014383 CAGCACACAGCAAGGAAGGAGGG + Intronic
906520183 1:46462115-46462137 CAGCCCACTCCAGAGGTGGGGGG - Intergenic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
908717659 1:67087517-67087539 CAGCAAACAGAAGTGGTGGACGG - Intergenic
909186468 1:72492620-72492642 CAGTACAGTGCAAGGTTGGAAGG - Intergenic
909715383 1:78701639-78701661 CAGCACAATGCAGTGGAGCAGGG + Intergenic
911972456 1:104454780-104454802 CAGAACACTGATGGGGTGGCTGG + Intergenic
912367954 1:109150376-109150398 CAACACAGTGCTGGGGTGCAGGG - Intronic
913058595 1:115184264-115184286 CAGCAGGCTTCAGGGCTGGAAGG + Intergenic
913156878 1:116108391-116108413 AAGCCCAGTGAAGGGGTGGAAGG + Intergenic
915043554 1:152990431-152990453 CAGCAAACTCAAGGGGAGGAGGG - Intergenic
916062863 1:161113276-161113298 CAGAACCCTGAAGGAGTGGATGG - Intronic
917236003 1:172892632-172892654 GAGCACACTGCAGGTGGGGGTGG - Intergenic
917285081 1:173415049-173415071 CAGCACGCTGGGGGAGTGGATGG - Intergenic
917701853 1:177589747-177589769 CAGCACACTGCAGGGTCTCAGGG + Intergenic
918864035 1:189871218-189871240 CAGTACACTGCAGTCTTGGAAGG - Intergenic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
920871842 1:209801387-209801409 CCGGACTCTGCGGGGGTGGAGGG + Exonic
922496264 1:226060664-226060686 CAGCACAATTCAGGGGTGCTGGG - Intergenic
922748530 1:228060268-228060290 CAGCTCGACGCAGGGGTGGATGG - Exonic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
922878916 1:228964445-228964467 CAGTACACTGTAGGGTCGGAAGG - Intergenic
924662693 1:246036368-246036390 AAGGAGACTGCGGGGGTGGATGG - Intronic
924724041 1:246651257-246651279 CAGCAGCGTGGAGGGGTGGAGGG - Intronic
924941296 1:248813835-248813857 GAGCACACAGCACGGGGGGAGGG - Intronic
1062972472 10:1659746-1659768 CAGGACACTGGAGGAGAGGAGGG - Intronic
1062972502 10:1659867-1659889 CAGGACACTGGAGGAGAGGAGGG - Intronic
1063565619 10:7170641-7170663 CACCACCCAGCAGGGGTGGGAGG - Intronic
1063978058 10:11432708-11432730 CAGCAGACTGCGGGGGAGGGAGG + Intergenic
1064095171 10:12418857-12418879 CATCCCTCGGCAGGGGTGGACGG - Intronic
1065199862 10:23302012-23302034 CGGCAAACAGCAGAGGTGGACGG + Intronic
1066246839 10:33591964-33591986 CGGCAGACAGCAGTGGTGGACGG + Intergenic
1066313117 10:34217574-34217596 CAGCAGACTACAGGGATAGACGG + Intronic
1067277812 10:44850395-44850417 GAGCTCACTGCTGGGATGGATGG + Intergenic
1067755237 10:49000134-49000156 CAGCCCACTGCAGTGGCAGAGGG + Intergenic
1068715073 10:60178939-60178961 CAGCAAACTGGAGGGGTGCGGGG + Intronic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068988851 10:63131015-63131037 CAGCAAACAGCGGTGGTGGACGG + Intergenic
1069037966 10:63665000-63665022 CAGCGAACAGCAGTGGTGGATGG + Intergenic
1069453491 10:68535715-68535737 CAGAACATTGCATGGGTGGGAGG - Intergenic
1070175636 10:73967084-73967106 CAGCAGACTTCAGGTATGGAGGG + Intergenic
1070711891 10:78689061-78689083 CAGCACCAGGCAGAGGTGGAGGG - Intergenic
1070776604 10:79113439-79113461 CAGGACCCTCCAGGTGTGGACGG - Intronic
1070892080 10:79948472-79948494 CTGGGCACTGCAGGGGTTGAGGG - Intronic
1071082706 10:81831312-81831334 CAGCAAATAGCAGTGGTGGACGG + Intergenic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1071475129 10:86019283-86019305 CAGAGCACAGCTGGGGTGGAGGG - Intronic
1075222995 10:120600798-120600820 CAGCACAGAGCAGGGGGAGAAGG - Intergenic
1075617088 10:123898014-123898036 CAGCAGACTACAGGTGTGGGAGG - Intronic
1075666752 10:124236461-124236483 CAGCTCACTGCAAGGGAGGCTGG - Intergenic
1075683777 10:124350072-124350094 CGGGACAGTGCAGGGCTGGAGGG + Intergenic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1076839996 10:133041209-133041231 CAGCTCCCTTCAGGGGTGGGGGG + Intergenic
1078099872 11:8323687-8323709 CGGAACACTGCCAGGGTGGAAGG - Intergenic
1078153566 11:8779143-8779165 CAGGACAATGGAGTGGTGGAGGG + Intronic
1080378156 11:31738483-31738505 CAGCACACTGCGGGGGGCTAAGG + Intronic
1080881486 11:36325361-36325383 TAGCAAACGGCAGTGGTGGACGG + Intronic
1081069741 11:38595865-38595887 CAGCAAATAGCAGTGGTGGATGG + Intergenic
1081070858 11:38606845-38606867 CAGCAAACAGCAGTGGTGGAAGG - Intergenic
1081534980 11:43989789-43989811 CAGCTTACTGCAGGGGTTGGGGG + Intergenic
1082805517 11:57447010-57447032 CAGCACACAGTGGGAGTGGAAGG - Intergenic
1084717431 11:70882895-70882917 CAGCAAACTGCAGGGCAGGCAGG + Intronic
1084766397 11:71311787-71311809 AAGCACAGAGCAGGTGTGGAGGG - Intergenic
1084809506 11:71603688-71603710 GTGGACACTGCAGGGGTGGAAGG + Intergenic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1084954179 11:72682840-72682862 CAGAACTCTGCAGGGTAGGAAGG + Intergenic
1085295263 11:75427929-75427951 CAGGACACTCCAGGGGAGCAAGG + Intronic
1085617770 11:78014570-78014592 CATGACACTGCAGGAGGGGAAGG + Intergenic
1086261747 11:84948137-84948159 CATCATCCTGCAGGGGTGGCAGG - Intronic
1086926212 11:92643320-92643342 CAGCTCACTGCAGGGCTGTCTGG - Intronic
1087957306 11:104304181-104304203 CAGCACACTGGGGGCGGGGAGGG + Intergenic
1088148927 11:106720360-106720382 CAGCATGGTGCTGGGGTGGAGGG + Intronic
1088182696 11:107129941-107129963 CAGCACAGTCCAGAGGAGGAAGG + Intergenic
1088242923 11:107789629-107789651 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1088269078 11:108015550-108015572 CAGTACACTGAAGGAGGGGAAGG - Intronic
1088663756 11:112074186-112074208 CAGGACACTCCAGAGGTTGACGG - Intronic
1088999984 11:115043912-115043934 CAGCACAGTGGAGGGTGGGAGGG + Intergenic
1089697904 11:120227053-120227075 CAGCACAGAGCAGTGGAGGAGGG + Intronic
1089882592 11:121789146-121789168 CAGCACACAGTGGGGGAGGAGGG + Intergenic
1090313431 11:125763892-125763914 CATCACACTGAGGGTGTGGAAGG - Intergenic
1091305016 11:134531285-134531307 CAGCACCCTGGAAGGGAGGAGGG - Intergenic
1091309572 11:134562975-134562997 GAGCACTCTGCAGGGGAGAAAGG + Intergenic
1091437465 12:483882-483904 CATGACACTGCAATGGTGGAGGG + Intronic
1091973645 12:4809067-4809089 GAGCCGACTGCGGGGGTGGAGGG + Intronic
1092644437 12:10554381-10554403 CTTCACACTGCAGGTGTGCAGGG - Intergenic
1093053557 12:14532412-14532434 CAGCATGCAGCAGGGGAGGACGG - Intronic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1096842962 12:54390473-54390495 CGGCCCAAGGCAGGGGTGGAGGG + Intronic
1096849000 12:54423502-54423524 CAGAGCACAGGAGGGGTGGATGG + Intergenic
1097075102 12:56387203-56387225 CAGCACACAGCAAGAGTGGAAGG + Intergenic
1097376748 12:58852228-58852250 CAGCAAACAGCAGTGGTGGGCGG + Intergenic
1097377757 12:58859357-58859379 CAGCAAACAGCAGTGGTGGGCGG + Intergenic
1098070731 12:66671495-66671517 CAGCAGCCTGTGGGGGTGGAGGG - Intronic
1098639878 12:72825637-72825659 CAGCAAACAGCAGTGGTAGACGG + Intergenic
1098984869 12:77001448-77001470 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1101012667 12:100467196-100467218 CAGCTGACTGCAGGGGTGGATGG + Intergenic
1101242009 12:102848309-102848331 CAGGAGACTGGAGAGGTGGAGGG + Intronic
1101242016 12:102848344-102848366 CAGGAGACTGAAGAGGTGGAGGG + Intronic
1101242036 12:102848449-102848471 CAGGAGACTGGAGAGGTGGAGGG + Intronic
1101242050 12:102848519-102848541 CAGGAGACTGGAGAGGTGGAGGG + Intronic
1101242067 12:102848624-102848646 CAGGACACTGGAGAGGTAGAGGG + Intronic
1101242113 12:102848868-102848890 CAGGAGACTGGAGAGGTGGAGGG + Intronic
1102429036 12:112867392-112867414 CAGGACTCTGCAGCAGTGGATGG - Intronic
1102438855 12:112946357-112946379 CACCCCACTCCAGGGGTGAAAGG + Intronic
1103141995 12:118556766-118556788 CTGCACACTGAAGGGAAGGATGG + Intergenic
1103169102 12:118798686-118798708 CAGCACTCTTCAGAGCTGGAAGG + Intergenic
1104850971 12:131873564-131873586 CAGCAAGCAGCAGTGGTGGATGG + Intergenic
1105514304 13:21076423-21076445 TCGCACAGTGCAGGGGCGGAGGG + Intergenic
1107156430 13:37172407-37172429 CAGCAAACAGCAGTGGCGGAGGG + Intergenic
1107803850 13:44135637-44135659 CAGTACATTGCAAGGGTGCAAGG - Intergenic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1109931290 13:69221993-69222015 CAGCAAACAGTAGTGGTGGACGG - Intergenic
1110987077 13:81984444-81984466 TAGCAAACAGCAGTGGTGGATGG + Intergenic
1111536801 13:89612121-89612143 CGGCAAACGGCAGTGGTGGACGG + Intergenic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1111910276 13:94303076-94303098 CAGCAAACAGCAGTGGTGGATGG + Intronic
1113732837 13:112654611-112654633 CAGCACCTTGCAGGGGTGTGAGG - Intronic
1114384823 14:22243779-22243801 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1118025597 14:61764887-61764909 GATTACAATGCAGGGGTGGAAGG - Intronic
1118444687 14:65840527-65840549 CAGCAGACTGCAGGGGGTAAGGG - Intergenic
1118843016 14:69526881-69526903 CGGTAAAGTGCAGGGGTGGAAGG - Intronic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1119199560 14:72742517-72742539 GAGCACACGGCAGAGGGGGAAGG + Intronic
1120107987 14:80517978-80518000 CAGCAAACAGCAGTGGTGGACGG + Intronic
1120677420 14:87437037-87437059 AACCACAAGGCAGGGGTGGAGGG - Intergenic
1121413498 14:93763431-93763453 GAGCTCACTGCAGGCCTGGAAGG - Intronic
1122325752 14:100879931-100879953 CTGGACAGTGCAGGGGTGCAGGG - Intergenic
1122796730 14:104209839-104209861 CTGCATACGGCAGGGGTGGGGGG + Intergenic
1123941158 15:25217318-25217340 CAGCACAGTGCAGGAGAGCAGGG - Intergenic
1123982744 15:25619029-25619051 CAGCAAACTGCAGCTGTGGGAGG - Intergenic
1125590999 15:40854381-40854403 GAGCACACTGGACGGGTGGAAGG - Exonic
1126153889 15:45547395-45547417 CAGCGAACAGCAGTGGTGGATGG + Intergenic
1127074522 15:55312237-55312259 CGGCAAACAACAGGGGTGGACGG + Intronic
1127385277 15:58461898-58461920 CAGCACGAGGCAGGTGTGGAGGG - Intronic
1127546693 15:59999664-59999686 CACCACAGTGCAGGGGTCGCTGG + Intergenic
1127822797 15:62674939-62674961 CACCACACTGCATGTGTGCATGG + Intronic
1127835680 15:62789140-62789162 CAGCACACGGAAGGGATGCAGGG - Intronic
1128537861 15:68504179-68504201 CAGGGCACTGCAGGGTTGGCCGG - Intergenic
1128874341 15:71189953-71189975 CCACGCACTGCTGGGGTGGAAGG + Intronic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1129799742 15:78405346-78405368 CAGCAGGCTGCAGTGGTGGTGGG - Intergenic
1131420109 15:92298265-92298287 CAGCAAATAGCAGTGGTGGACGG - Intergenic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1133018344 16:2955141-2955163 CACCCCCCCGCAGGGGTGGATGG - Intergenic
1134693897 16:16208895-16208917 CAGGATCCTGCAGGGGTGAATGG - Intronic
1134977941 16:18585748-18585770 CAGGATCCTGCAGGGGTGAATGG + Intergenic
1135017211 16:18933849-18933871 CAGCAAACATCAGGGATGGAAGG + Intergenic
1135652239 16:24216433-24216455 CAGGACACGGCAGGCGAGGAGGG - Exonic
1136873080 16:33825354-33825376 AAGAACACTGCAGCTGTGGAAGG - Intergenic
1138344699 16:56312724-56312746 CAGCACATCCCAGGGCTGGATGG - Intronic
1139044525 16:63040446-63040468 CTGCTCCCTGCAGGGATGGATGG + Intergenic
1139965794 16:70744662-70744684 CAGCCACCTGCAGGGGTGGGAGG + Intronic
1141298453 16:82791595-82791617 CAGCAAACAACAGTGGTGGATGG - Intronic
1141769844 16:86083206-86083228 GATCATATTGCAGGGGTGGAGGG + Intergenic
1142040690 16:87891910-87891932 CAGCAGAGTGGAGGGGTCGAAGG + Exonic
1203099092 16_KI270728v1_random:1290701-1290723 AAGAACACTGCAGCTGTGGAAGG + Intergenic
1144433015 17:15212507-15212529 CAGCAAGCTGCAGGGGTGAAGGG + Intergenic
1146925698 17:36743302-36743324 ACCCACACTGCAAGGGTGGATGG + Intergenic
1147710496 17:42460129-42460151 CAGAAAGCTGCAGAGGTGGAAGG + Intronic
1148127132 17:45242660-45242682 CACCCCTCTGCAGGGATGGAGGG - Intronic
1148239366 17:45989971-45989993 GGGCACACAGCAGGGCTGGAGGG - Exonic
1148500393 17:48086217-48086239 CTCCTCAGTGCAGGGGTGGAGGG - Intronic
1148542674 17:48492880-48492902 CAGCAAACTGCCCGGGCGGATGG - Intergenic
1148826730 17:50399327-50399349 CAGCAAACAGCAGTAGTGGACGG + Intergenic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1151938978 17:77281245-77281267 CAGCGCAGCGCAGGGGTGGGCGG + Intronic
1152067796 17:78121158-78121180 CTGGACTCTGCAGGGGTGCAGGG + Exonic
1152071841 17:78137989-78138011 CAGCAGCCTGCAGGGATGGGAGG - Exonic
1152218475 17:79048118-79048140 CAGCACAGCGCAGGGGTGGAAGG - Exonic
1152848489 17:82617196-82617218 CACCACCCTGCTGGGGTGGGGGG + Intronic
1152931338 17:83111690-83111712 CTGCCCGCTGTAGGGGTGGAAGG - Intergenic
1153400773 18:4682045-4682067 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1154270284 18:12912424-12912446 CGGCACAGCGCAGGGGTGGGAGG - Intronic
1154300011 18:13184614-13184636 CAGCACTCTGCAGGGATGGGCGG - Intergenic
1154412803 18:14150461-14150483 CAGCACCCTGCAGGGAGGGTCGG + Intergenic
1155303121 18:24451581-24451603 CAACACATTTCTGGGGTGGAAGG - Exonic
1155749242 18:29399246-29399268 CGGCAAACGGCAGTGGTGGATGG + Intergenic
1156257044 18:35408807-35408829 CAGCACACAGCAGGCATGGAGGG - Intergenic
1156360829 18:36383130-36383152 CAGAACACAGCAGGGCTGGAAGG - Intronic
1156395199 18:36693079-36693101 CAGCACAGTGCAGGGCTGGCTGG - Intronic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1157621382 18:49019099-49019121 CAGGCCACGGCAGGGGTGGGAGG + Intergenic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1160021578 18:75185577-75185599 CAGCTCTATGCAGGGGTGCAGGG - Intergenic
1160420868 18:78742949-78742971 CACCTCAGAGCAGGGGTGGAGGG - Intergenic
1160657450 19:280866-280888 CAGCACAGTGCTGGGGTCAAGGG - Intergenic
1160734942 19:658197-658219 CATCACGCTGCAGGGGTGCATGG - Intronic
1161013062 19:1969397-1969419 CAGGAGACTGCTGGGCTGGAAGG - Intronic
1161157345 19:2739572-2739594 CAGCTCACCGCCGGGGGGGAGGG - Intronic
1161551697 19:4916593-4916615 CAGCACACAGGACGGGTGGAGGG - Intronic
1161770951 19:6230424-6230446 CAGCACCCAGCAGAGCTGGAGGG - Intronic
1161911682 19:7198630-7198652 CCTCACATTGCAGGGGGGGAGGG + Intronic
1161968389 19:7561588-7561610 CAGCCCAGTCCAGGGGTGGGAGG - Exonic
1162080011 19:8212208-8212230 GAACAGACTGCAGGGGTCGAAGG + Intronic
1163390579 19:17027496-17027518 CTTCATACAGCAGGGGTGGATGG + Intergenic
1164173170 19:22745520-22745542 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1164646725 19:29863738-29863760 CAGCACCCAGCAGGAGGGGAAGG - Intergenic
1164686933 19:30172788-30172810 CAGGGCACTGCAAGGGTTGAAGG + Intergenic
1164760879 19:30727479-30727501 GAGCCCACTGCAGGAGTTGATGG - Intergenic
1165071674 19:33259444-33259466 CAATAAACTGCAGGGCTGGAAGG - Intergenic
1165762181 19:38327902-38327924 CAGCACACAGGAGGGGTTTAGGG - Exonic
1166184042 19:41127885-41127907 CGGCGCCCTGCAGGGGTGGCAGG - Exonic
1166356298 19:42229474-42229496 CAGGACACCCCAGAGGTGGAAGG - Intergenic
1166910199 19:46149014-46149036 CAGCACACTCCTGGGGTAGTCGG - Exonic
1167445225 19:49533646-49533668 CAGCACAGGGCAGGGCTGGAGGG + Intronic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
925023807 2:592583-592605 CAGCAAACAGCAGTGGTGGAGGG - Intergenic
925073143 2:987284-987306 TGGCACACTGCAGGTGTGGTGGG + Intronic
926163782 2:10505518-10505540 AGGCACCCTGCAGGGGTGGGTGG - Intergenic
927994360 2:27472745-27472767 AAGAGCACTGCAAGGGTGGATGG + Intronic
928121182 2:28584652-28584674 CAGGGCACTGCAGAGGTGGCAGG - Intronic
928306348 2:30173008-30173030 CAGCACTTTGCAGGGGAGGGAGG + Intergenic
928793855 2:34992133-34992155 CCGCACTCTGCAGGGCTGGTGGG + Intergenic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
929812351 2:45201108-45201130 CAGATCCCTGCAGTGGTGGATGG - Intergenic
929834311 2:45380647-45380669 CAGAACAGTGGAAGGGTGGAAGG - Intergenic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
932337462 2:70939132-70939154 CAGGACGCTGCAGGTGTGGCTGG + Intronic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
933515841 2:83300501-83300523 CAGCAAACTACAGGTGTTGAGGG + Intergenic
934048470 2:88190830-88190852 AAGGTCAGTGCAGGGGTGGAAGG - Intergenic
934886280 2:98028369-98028391 TCGCACGCAGCAGGGGTGGAGGG - Intergenic
935118731 2:100161046-100161068 CAGCTCAGCTCAGGGGTGGAGGG + Intergenic
935450826 2:103206927-103206949 CAGCACACTGCCTGGATTGAAGG + Intergenic
935748347 2:106209327-106209349 CAGCAAACAGCAGTGGTGGATGG - Intergenic
935956628 2:108383400-108383422 CAGCACACTGGAGGATGGGATGG - Exonic
936627049 2:114159319-114159341 CAACTCACTGCAGAGGTGGGTGG + Intergenic
937424752 2:121789663-121789685 CAGGGCACTGCTGGGGCGGAGGG + Intergenic
937775515 2:125770920-125770942 CAGGTTCCTGCAGGGGTGGAGGG + Intergenic
938102184 2:128504700-128504722 CAGGGCAGTGCAGGGCTGGATGG + Intergenic
938161086 2:128985146-128985168 CAGCACCCTGCCTGGGTGAAGGG + Intergenic
938660968 2:133486994-133487016 CAGCACACTGCAGGAGTAAAAGG + Intronic
938703610 2:133900650-133900672 CAACACAATGCTGGAGTGGAAGG + Intergenic
939067121 2:137496944-137496966 CAGCAAATTGCAGAAGTGGAAGG + Intronic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
940979205 2:159982586-159982608 CAGCATTCTGCAGGGGAGGAAGG - Intronic
941901208 2:170680439-170680461 CCACACACTGCAGGTGTGAAAGG - Intergenic
942265306 2:174218750-174218772 CAGCAAACCCCAGGGGTGGGAGG + Intronic
945896888 2:215493445-215493467 CAGTACAATGCAAGGTTGGAAGG + Intergenic
946180192 2:217944189-217944211 CAGAGCACTGCAGGGGTTAAAGG - Intronic
947220665 2:227788803-227788825 CATCACACTGCAAGAGTTGAGGG + Intergenic
947818534 2:233054533-233054555 CAGAACAGGGAAGGGGTGGAGGG + Intergenic
947872018 2:233444543-233444565 CAGCGCACAGCAGGCATGGATGG - Intronic
947918308 2:233848869-233848891 GAGCAGACTGCAGGCTTGGAAGG + Intronic
948301917 2:236914028-236914050 CAGGGCAGAGCAGGGGTGGATGG + Intergenic
948660824 2:239505548-239505570 CAGCAGACCTGAGGGGTGGAGGG - Intergenic
948665946 2:239535125-239535147 CAGCACACAGCATGGGTCCACGG - Intergenic
948981143 2:241495480-241495502 CAGCACACTGCAGGGGTGGAAGG + Exonic
1170791114 20:19510377-19510399 CAGCACACAGCAGTGGGGCATGG - Intronic
1171187892 20:23136614-23136636 CAGCAAGCCGCAGAGGTGGACGG + Intergenic
1171307136 20:24116345-24116367 CAGCCCACTGCAGAGGGGGAGGG + Intergenic
1171456427 20:25275249-25275271 CAGCACCCTGCTGGGCAGGAGGG - Intronic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1173161835 20:40658607-40658629 CCCCACTCTGCAGGAGTGGAGGG - Intergenic
1173539684 20:43842268-43842290 CTGCAGACAGCAGGGGTAGATGG - Intergenic
1175953871 20:62598061-62598083 CCGTACACTGCTGGGGGGGATGG + Intergenic
1176673667 21:9757318-9757340 CAGAAAGCTGCCGGGGTGGATGG + Intergenic
1176860204 21:14007794-14007816 CAGCACCCTGCAGGGAGGGTCGG - Intergenic
1177263980 21:18760153-18760175 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1178563262 21:33659017-33659039 CAGGAAACTGCAGGATTGGAGGG + Intronic
1178916106 21:36706329-36706351 CAGTGCTCTGCAGGGGTGCAGGG + Intronic
1179268806 21:39831896-39831918 CAGCACAGTGCAGGGCTTGCTGG + Intergenic
1179444728 21:41423260-41423282 CAGCAAATGGCAGTGGTGGATGG + Intronic
1179785528 21:43727821-43727843 CTGCACGCTGTGGGGGTGGACGG + Intronic
1179919384 21:44499401-44499423 ACGCACACTGCAGGAGTGGCTGG + Exonic
1180839421 22:18952217-18952239 CAGCAACCTGCAGGGGTGGGTGG + Intergenic
1181062479 22:20288267-20288289 CAGCAACCTGCAGGGGTGGGTGG - Intergenic
1181141172 22:20806032-20806054 CAACACACAGCAGGGGTGGTGGG + Intronic
1181142815 22:20819701-20819723 CAGCAGATTGCTGGGGAGGATGG + Exonic
1182653763 22:31873343-31873365 CACCACAGTGTAGGGTTGGAAGG + Intronic
1183154878 22:36067061-36067083 CAGCACAGTGCGGGGGTGGGTGG - Intergenic
1183319132 22:37154427-37154449 CAGCTCACTGCAAGGGAGGCTGG - Intronic
1183319584 22:37156911-37156933 CAGCACCGAGCAGGGGTGGGCGG - Intronic
1183516617 22:38270573-38270595 CAGCACAGTGCAGGGCAGCATGG + Intronic
1183998786 22:41656697-41656719 CAGAAGACTGCAAGGGAGGAGGG - Intronic
1184285336 22:43467713-43467735 CAGAACACAGCAGAGGGGGATGG - Intronic
1184464012 22:44658606-44658628 GTGCACACTGGAGGGGTGGGGGG + Intergenic
949811676 3:8012972-8012994 CAGCAAACAGCAGTGGTGGATGG + Intergenic
950439295 3:12999380-12999402 CAGCACACTGCCGAGCTGGGAGG - Intronic
950965438 3:17142738-17142760 GAGCCCACAGCAGGGCTGGACGG - Intergenic
951016256 3:17735811-17735833 CAGCAAACAGCAGTGGTGGATGG + Intronic
951551847 3:23882616-23882638 GAGCCCACTGCAGGGGTGGAGGG + Intronic
951678882 3:25273943-25273965 GTGCACAGTGCAGGGGTGGCAGG - Intronic
952881783 3:37990325-37990347 CAGCTCACTTCAGGAGGGGAAGG - Intronic
952924666 3:38312504-38312526 CAGCACTCTGCCTGGGTGAATGG - Intronic
953531555 3:43744524-43744546 TAACAGGCTGCAGGGGTGGAGGG - Intergenic
953920359 3:46947361-46947383 CAGCCCCATGCCGGGGTGGAGGG + Intronic
954361815 3:50126206-50126228 CAGCACAGTTCTGGGGAGGAAGG + Intergenic
954792409 3:53143083-53143105 CTGGACACTGTAGAGGTGGAGGG + Intergenic
957000509 3:74877945-74877967 CAGCAAACAGCAGTGGTGGATGG + Intergenic
957687039 3:83515284-83515306 CAGCAAACAGCAGTGGTGGACGG - Intergenic
958113182 3:89177515-89177537 CAGCACACGGCAGATGTGAAGGG + Intronic
958551088 3:95613894-95613916 CAAAACTCTGCAGGGGTGGTGGG + Intergenic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
960685528 3:120289963-120289985 CAGCCCACGGCAGGGGTGGGCGG - Intergenic
960717208 3:120587860-120587882 CAGCACACTGAATGGATAGAGGG + Intergenic
962655715 3:137542377-137542399 CAGCACAGTGCAGGGGATGGGGG + Intergenic
962755940 3:138465458-138465480 CAGCACCCCGCAGGGAGGGAAGG - Intronic
966864629 3:184250430-184250452 CAGCACCCTCTAGGGGTGGAGGG + Intronic
966994303 3:185265012-185265034 CGGCACTCAGCAGTGGTGGATGG - Intronic
968231825 3:197008956-197008978 TCGCTCACTGCTGGGGTGGAGGG + Exonic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
969169495 4:5348557-5348579 CAGCACCCTGCAGCAGTGGGTGG - Intronic
969238860 4:5887024-5887046 CAGGACAGTGCAGGGGAGGCAGG + Intronic
969731448 4:8960054-8960076 GTGGACACTCCAGGGGTGGAAGG + Intergenic
969791053 4:9494162-9494184 GTGGACACTCCAGGGGTGGAAGG + Intergenic
970847973 4:20565490-20565512 CAGCACACTGCAGAAATGAATGG - Intronic
971076770 4:23158374-23158396 CAGCGTACAGCAGGGGTGGATGG - Intergenic
972131255 4:35836797-35836819 AATCACACTGCAGGGCTGGCAGG - Intergenic
972340799 4:38150907-38150929 CAGGACACTGCTGGGCTGCAGGG - Intergenic
972476906 4:39459081-39459103 TAGCGCAGTGCAGGGGTTGAGGG - Exonic
972725495 4:41743619-41743641 CAGCACTCTGCAGGGTTTGGGGG + Intergenic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
973638935 4:52884812-52884834 CACCACACTGCTGTGCTGGAGGG - Intronic
973896106 4:55414783-55414805 CAGCCCATTCCTGGGGTGGAGGG - Intronic
974487853 4:62526898-62526920 CAGCAAACAGCAGTGGTGGACGG + Intergenic
975026035 4:69549990-69550012 AAGCACACTACAGGGGTGCTGGG - Intergenic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
975418825 4:74138679-74138701 CAGCAAACAGCAGTGGTGGATGG + Intronic
975528139 4:75373661-75373683 CAGAAGACTGTAGGGGAGGAGGG - Intergenic
976190167 4:82479711-82479733 CAGCAATCAGCAGTGGTGGATGG - Intergenic
976515229 4:85956792-85956814 CAGCAAAAAGCAGTGGTGGATGG + Intronic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
980190519 4:129519325-129519347 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980386303 4:132090774-132090796 CAGCAAACAGCAGTGATGGATGG + Intergenic
980474268 4:133291308-133291330 CATCACATTGCTGGGGTGTAAGG + Intergenic
980523646 4:133961712-133961734 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
980800129 4:137736071-137736093 CAGGACACTGCCAGGGTAGATGG + Intergenic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
985401041 4:189594351-189594373 CAGAAAGCTGCCGGGGTGGATGG - Intergenic
986290447 5:6395294-6395316 CAGCACAAGGCAGGGGAGGCAGG + Intergenic
986731366 5:10637072-10637094 CAGGACACTGAAGTGGGGGAGGG + Intronic
988456742 5:31393686-31393708 CAGCAGACAGCAGGACTGGAAGG - Intergenic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988806144 5:34742622-34742644 CAGCAAACTGCAGTAGTGTATGG - Intronic
988863506 5:35309026-35309048 CATCACACAGCAGGGATGGAAGG - Intergenic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
989123988 5:38033391-38033413 GAGCAGACTGCAGGGTTAGATGG + Intergenic
989717696 5:44483491-44483513 CAGCAAATAGCAGTGGTGGACGG - Intergenic
990926164 5:61026233-61026255 TAGCAGCCTGCAGGGGAGGAGGG + Intronic
992069467 5:73136027-73136049 AAGCACACTGTGGGGGTGGTGGG + Intergenic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
992392071 5:76338533-76338555 CAGCAGACTGCAGTGGGGGTGGG - Intronic
992678981 5:79134207-79134229 CAGCACACTGAAGGGCTTGAGGG + Intronic
993872423 5:93268142-93268164 CAGGAACATGCAGGGGTGGAGGG - Intergenic
993879814 5:93348871-93348893 CAGCTCCCAGCAGGGGTGCAGGG - Intergenic
996849656 5:127937998-127938020 CAGCAGGGGGCAGGGGTGGAGGG - Intergenic
997413834 5:133710102-133710124 CAGCCCACTGCACGGGAAGATGG + Intergenic
997976795 5:138445754-138445776 CTGCAGCCTGCGGGGGTGGAGGG - Exonic
998593790 5:143506109-143506131 CAGCAGCCTGCATGGCTGGAGGG - Intergenic
1001313774 5:170628919-170628941 CTGCAGACTGCAGGCCTGGATGG - Intronic
1001748734 5:174111620-174111642 GAGCACATTGCAGGAGTTGAGGG - Intronic
1001928541 5:175657170-175657192 CAGCCCAGTGCAGGGGAGGCAGG - Intergenic
1002304276 5:178274178-178274200 GAGCCCATTGCAGGGGTGGAAGG - Intronic
1002683535 5:180988971-180988993 CAGATGACAGCAGGGGTGGATGG - Exonic
1002818596 6:701430-701452 CAGCACAGGGCAGGGCTGGCAGG - Intergenic
1003182163 6:3801350-3801372 CGGCACACTGCAGGGCTGGCAGG - Intergenic
1003330052 6:5122225-5122247 CAGCACCCTGCTTGGTTGGACGG + Intronic
1004044332 6:12011494-12011516 CAGCACACGGCGGGGGCGGAGGG - Intronic
1004236359 6:13878455-13878477 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1006897315 6:37479411-37479433 CAGCCCCCTGCAGGTGTGGCTGG + Intronic
1006983487 6:38163284-38163306 CAGGAGCCTGCAGGGGTTGAGGG - Intergenic
1007250025 6:40489297-40489319 CATCACACTTCAGAGCTGGAAGG + Intronic
1007415570 6:41689403-41689425 GAGAGCACTGCATGGGTGGAGGG - Intronic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1011190324 6:84720755-84720777 CAGCGAACAGCAGTGGTGGATGG + Intronic
1011550752 6:88529199-88529221 CTGCACAATGCCGGGCTGGATGG + Intergenic
1012111731 6:95243781-95243803 CTGCTCACTGCAGAGATGGAGGG - Intergenic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1013347602 6:109277214-109277236 GAGCACAGGACAGGGGTGGAAGG + Intergenic
1013983863 6:116166083-116166105 CAGCTTATTGCAGGGGTGAAGGG + Intronic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1015632764 6:135247944-135247966 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1017065892 6:150528787-150528809 GAGCAGACTGCAGGGGCTGAGGG - Intergenic
1017127394 6:151078882-151078904 TACCACACTGCAGAGGTGCAGGG + Intronic
1017787066 6:157765269-157765291 CACCACATTGCAGAGGTGCATGG + Intronic
1018143933 6:160865435-160865457 CAGCACAAAGCTGGGGTGGGAGG - Intergenic
1018395377 6:163374194-163374216 CAGCACAGTTCTGGGCTGGAAGG + Intergenic
1018481995 6:164200297-164200319 CAGAAAACTGCATTGGTGGATGG + Intergenic
1018789259 6:167134041-167134063 CAGAGCATGGCAGGGGTGGAGGG - Intronic
1019716027 7:2539757-2539779 CAGCCCCTTGCAGGGGTGAACGG - Intronic
1019840428 7:3437164-3437186 CAGTACCCTTCAGGGGTGAAAGG + Intronic
1020358202 7:7300740-7300762 CACCTCCCTGCAGGGGTCGACGG - Intergenic
1021144253 7:17065920-17065942 CAGCGAACAGCAGTGGTGGACGG - Intergenic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1021959589 7:25858620-25858642 CAGCCCGCTGCAGGGGCGCAGGG + Intergenic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1022125915 7:27357212-27357234 CCTCACACTGAAGGGATGGAGGG + Intergenic
1022989913 7:35696639-35696661 CGGCAGACAGCAGTGGTGGACGG - Intergenic
1024148021 7:46536784-46536806 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1024310795 7:47967052-47967074 CAGCACACTGCAGATCTGAAGGG + Intronic
1025017342 7:55449761-55449783 GGGCACAGTGCGGGGGTGGAGGG - Intronic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1029122613 7:98278905-98278927 CCGCACACTGCACGTTTGGAGGG + Intronic
1029217169 7:98959054-98959076 CTGCACACTGCAGGGAGGCAAGG - Intronic
1029346614 7:99983414-99983436 CAACAGACCGCGGGGGTGGAAGG + Intergenic
1029558601 7:101287451-101287473 CAACAGACCGCGGGGGTGGAAGG - Intergenic
1029709503 7:102291928-102291950 GAGGAGGCTGCAGGGGTGGAAGG + Intronic
1030313941 7:108095037-108095059 CAGCTCAATGCAGGGGTGAGGGG + Intronic
1030431253 7:109452177-109452199 CGGCAAACTGCAGTGGTGGACGG - Intergenic
1031149795 7:118040298-118040320 CAGCACAAGGCTGGGGTGGGGGG - Intergenic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1031920240 7:127595086-127595108 CATCTGGCTGCAGGGGTGGAAGG + Intronic
1032531597 7:132625261-132625283 CAGCACTGTGCTGGGCTGGAGGG - Intronic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034267482 7:149788313-149788335 CTTCACACTGCAGGGCTGGGTGG - Intergenic
1034416637 7:150968744-150968766 CAGCAGCCTGCAGGGAGGGAAGG + Intronic
1034451545 7:151139695-151139717 CTGCAGCCTGGAGGGGTGGAAGG - Intronic
1034546039 7:151790057-151790079 CAGTTCACAGGAGGGGTGGATGG - Intronic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034672530 7:152869361-152869383 CAGCACCTTGCAGGTATGGAAGG + Intergenic
1034707081 7:153155210-153155232 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1035022408 7:155807416-155807438 GAGCAAACTGAAGAGGTGGAGGG + Intronic
1036137884 8:6179073-6179095 CAGCAAACAGAAGGGGTTGAAGG - Intergenic
1036416205 8:8551068-8551090 CACAGAACTGCAGGGGTGGAGGG + Intergenic
1036902331 8:12679609-12679631 CCTCACACTGCAGGGCTGGAGGG + Intergenic
1037759775 8:21734099-21734121 CTGCACGCTGCAGGCTTGGAAGG - Intronic
1037802790 8:22044335-22044357 CAGCTGTCTGCAGTGGTGGAAGG + Intronic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1040514157 8:48120783-48120805 CAGCACTGTGCAGGTGGGGAGGG - Intergenic
1043829504 8:84970807-84970829 CTTCACACTGCAGGGTTGGAAGG - Intergenic
1044542261 8:93421051-93421073 CAGCACAGTGGATGGATGGAGGG - Intergenic
1044750077 8:95407377-95407399 AAGCACATTACAGGGTTGGAGGG + Intergenic
1045664320 8:104468926-104468948 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1045688086 8:104732281-104732303 CTGCACACTGGAGGGGAAGATGG - Intronic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1046524612 8:115368760-115368782 CAGATCCCTGCAGGAGTGGATGG - Intergenic
1046656589 8:116901287-116901309 CAGGGCAGGGCAGGGGTGGAGGG - Intergenic
1047276649 8:123410761-123410783 CAGCAAACAGCAGTGGTGGACGG - Intronic
1048631490 8:136247645-136247667 CAGCAAACAGCAGTGGTGAATGG - Intergenic
1049701075 8:144012947-144012969 CAGGTCACCGCAGGGGTGGGTGG - Intronic
1049731263 8:144179729-144179751 CATCACCCTGCAGGGGTGGGGGG + Intronic
1049812021 8:144579901-144579923 CTGGCCACTGCAGGGGCGGATGG - Intronic
1050113680 9:2241902-2241924 TTGCACACACCAGGGGTGGAGGG - Intergenic
1051619241 9:19034694-19034716 CAGAACTCTACAGGGGAGGATGG + Intronic
1051699196 9:19801422-19801444 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1051970178 9:22878077-22878099 CAGCCAACAGCAGTGGTGGACGG + Intergenic
1054449859 9:65398039-65398061 CAGCAGGCTGTGGGGGTGGAGGG + Intergenic
1055186669 9:73464782-73464804 CAGTACACTGCGTGGGTGAAGGG - Intergenic
1056146000 9:83729914-83729936 CAGTACAATGCAAGGGAGGAAGG + Intergenic
1056687056 9:88775564-88775586 CAACACCCTACAGGGGTTGAAGG + Intergenic
1056705015 9:88944283-88944305 CAGCAAACAGCAGTGGTGGTTGG + Intergenic
1056888309 9:90465834-90465856 CTGCACACTGTAGGGTTGCATGG - Intergenic
1056969783 9:91192333-91192355 CTGCTTACTGCCGGGGTGGAGGG - Intergenic
1057422045 9:94920446-94920468 CAGCAGGCTGCAGGGGTAGAAGG - Intronic
1057702992 9:97376993-97377015 CGGCACAGAGCAGGGGTGGAGGG - Intronic
1058354592 9:104068959-104068981 CAGGAGAATTCAGGGGTGGAGGG - Intergenic
1059339245 9:113588122-113588144 CAGTCCCCTGCAGGGGAGGAAGG - Intronic
1059528063 9:115011269-115011291 AAGCACACTTTAGGGCTGGAGGG + Intergenic
1061539615 9:131270968-131270990 AAGGACAGGGCAGGGGTGGAGGG - Intronic
1061590700 9:131595770-131595792 CAGCACACTGAATGCGTGGTAGG + Intronic
1061678750 9:132232263-132232285 CAGCACACCGGTGGGATGGATGG + Intronic
1062047662 9:134431889-134431911 CAGCACCCTGCAGAGGAGGAGGG - Exonic
1062343550 9:136104341-136104363 GGGCAGGCTGCAGGGGTGGAGGG - Intergenic
1062560217 9:137138333-137138355 ACGCACACTCCAGGGGTGGAGGG + Intergenic
1187758148 X:22548357-22548379 CAGCACACTGCAGGTGAGGTGGG - Intergenic
1188987681 X:36781952-36781974 CAGAAAAATGCATGGGTGGATGG - Intergenic
1189265957 X:39716200-39716222 AAGCACACTGCAGGGGGTTAGGG + Intergenic
1189515707 X:41711827-41711849 CACCCGACTGCAGGGGTGGGGGG + Intronic
1189607506 X:42695481-42695503 CAGCACCATGCAGGGCTGGTTGG + Intergenic
1189954280 X:46262003-46262025 CAGCAAACAGCAGCGGTGGGCGG + Intergenic
1190245837 X:48689420-48689442 CAGCTCACCGGAGGAGTGGATGG - Exonic
1190281958 X:48936980-48937002 CAGAACACTCCAGGGTAGGAAGG - Intronic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1191726907 X:64291453-64291475 CAGCACGCAGAAGGGGAGGAAGG - Intronic
1192853931 X:74987161-74987183 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1192960997 X:76130737-76130759 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1193172388 X:78350375-78350397 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1193295496 X:79827570-79827592 CTGCAAACAGCAGTGGTGGAAGG + Intergenic
1194507029 X:94745763-94745785 CTGCACACAGCAGGGGTGTGGGG - Intergenic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1195547123 X:106125169-106125191 CATCACACTCCAGGGCTGGTCGG - Intergenic
1195584602 X:106551389-106551411 CAGCAAACAGCAGTGGTGGTCGG - Intergenic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196694834 X:118600654-118600676 CAGCACAATGAAGGGGAGCAGGG + Intronic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1201421473 Y:13804542-13804564 CAGCAAACAGCAGTAGTGGAGGG - Intergenic