ID: 948982516

View in Genome Browser
Species Human (GRCh38)
Location 2:241501603-241501625
Sequence CGATAACCACACAAAGGAGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 130}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948982516_948982525 19 Left 948982516 2:241501603-241501625 CCACCTCCTTTGTGTGGTTATCG 0: 1
1: 0
2: 2
3: 14
4: 130
Right 948982525 2:241501645-241501667 CAAACGAGCCCTTGCCAATGCGG 0: 1
1: 0
2: 0
3: 2
4: 75
948982516_948982528 29 Left 948982516 2:241501603-241501625 CCACCTCCTTTGTGTGGTTATCG 0: 1
1: 0
2: 2
3: 14
4: 130
Right 948982528 2:241501655-241501677 CTTGCCAATGCGGTCGAGCTTGG 0: 1
1: 0
2: 0
3: 3
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948982516 Original CRISPR CGATAACCACACAAAGGAGG TGG (reversed) Exonic
901148992 1:7087893-7087915 CGAAAACCACACAAAGTATTTGG - Intronic
902660504 1:17897892-17897914 TGATAACCACACAATAGTGGTGG + Intergenic
902862687 1:19257492-19257514 CACCAACCGCACAAAGGAGGAGG + Exonic
906697750 1:47836015-47836037 CAATAATGGCACAAAGGAGGAGG + Intronic
921141119 1:212307517-212307539 TAATAACAGCACAAAGGAGGAGG - Intronic
921452676 1:215327392-215327414 CAATAACAACACAAAGGAGCGGG + Intergenic
921752346 1:218810458-218810480 CAATAACAACTGAAAGGAGGAGG - Intergenic
1065348813 10:24776464-24776486 CAATTACCACATAAAGGAAGAGG + Intergenic
1066368875 10:34802901-34802923 CAACAACCCCACAAAGCAGGTGG + Intronic
1068446631 10:57133419-57133441 AGATAACCTCACGAAGGAAGCGG - Intergenic
1069430333 10:68329385-68329407 CCATAACCACACAAAATATGCGG + Intronic
1069641071 10:69955849-69955871 CCATAATAACACAGAGGAGGAGG - Intronic
1071456638 10:85856248-85856270 AGAAACCCACAGAAAGGAGGAGG + Intronic
1072828866 10:98636776-98636798 CAATAAGCACAGAAAGGAGTTGG - Intronic
1073667473 10:105550045-105550067 CCATAACAGCACAAAGAAGGTGG + Intergenic
1074311048 10:112323693-112323715 GGATAAGTACACAGAGGAGGAGG + Intergenic
1075798375 10:125136521-125136543 CTATAGGCACACAAAAGAGGAGG - Intronic
1077715504 11:4575971-4575993 CAATAACCACAGAAAGGAAGTGG + Intronic
1079930521 11:26554120-26554142 CTATAATGACACAAAGCAGGTGG - Intronic
1080623280 11:34005388-34005410 CAAAAACCACACAAGGCAGGTGG - Intergenic
1081669450 11:44934931-44934953 TGATGACGACAAAAAGGAGGCGG + Exonic
1082251711 11:49989412-49989434 CAATAACAACACAAAGTAGAAGG - Intergenic
1087069003 11:94056633-94056655 CAATAATAGCACAAAGGAGGGGG - Intronic
1087791940 11:102415217-102415239 AGATAACCACACAATAGTGGCGG + Intronic
1090743305 11:129686722-129686744 CAATAACAATACAGAGGAGGAGG + Intergenic
1090797081 11:130144388-130144410 AGAAGACCACACCAAGGAGGCGG + Exonic
1091828167 12:3530878-3530900 CCATAGCCCCACAAAAGAGGCGG + Intronic
1096764764 12:53875702-53875724 CGATAATAGCACAAAGGAGATGG + Intergenic
1097427417 12:59464061-59464083 CGATAATAACACAATGGAGAAGG + Intergenic
1097686834 12:62699067-62699089 AGCTAACCACACAAGGGGGGTGG + Intronic
1103925064 12:124419034-124419056 GGAGCACCACACAGAGGAGGCGG - Intronic
1105047591 12:133018093-133018115 CAATAACACCACAAAGGAGGAGG + Exonic
1108002123 13:45913677-45913699 CGAGAATCACTCCAAGGAGGTGG - Intergenic
1108124508 13:47226494-47226516 CCATAACAACACTAAGGAGAGGG - Intergenic
1108136888 13:47374133-47374155 AAATAACAGCACAAAGGAGGGGG - Intergenic
1111934092 13:94541841-94541863 AGAGAACCACACAAACGTGGAGG + Intergenic
1112299605 13:98218043-98218065 CGCGAATCTCACAAAGGAGGCGG - Intronic
1113412290 13:110100927-110100949 ACACAACCACACAAGGGAGGTGG - Intergenic
1113824279 13:113238747-113238769 CGATGTTCACACAAACGAGGAGG - Intronic
1116171760 14:41411536-41411558 CTATATCCAGACAAAGGAAGAGG - Intergenic
1117266672 14:54095389-54095411 CAATATCCTAACAAAGGAGGTGG + Intergenic
1118707200 14:68491240-68491262 CAATCACAACAGAAAGGAGGAGG - Intronic
1121400258 14:93669913-93669935 AGATAACCAGACATATGAGGGGG + Intronic
1127494735 15:59499315-59499337 TGATAATAGCACAAAGGAGGTGG - Intronic
1130827431 15:87563955-87563977 CGATAATGACAAAAAGAAGGTGG + Intergenic
1134134216 16:11668760-11668782 CGAGATCCGGACAAAGGAGGCGG + Intronic
1134237313 16:12477246-12477268 CGACCACCACACAGATGAGGTGG - Intronic
1135675441 16:24411274-24411296 CAATAAACAGGCAAAGGAGGGGG + Intergenic
1136140969 16:28288494-28288516 CGATAACTGCAGCAAGGAGGCGG - Intergenic
1137435120 16:48448442-48448464 GGAAAACTTCACAAAGGAGGTGG - Intergenic
1139443789 16:66983991-66984013 CAGTGACAACACAAAGGAGGTGG - Intergenic
1140211259 16:72972460-72972482 TTATAATCACATAAAGGAGGGGG - Intronic
1144469999 17:15530432-15530454 TGATAATAGCACAAAGGAGGAGG - Intronic
1144926345 17:18813219-18813241 TGATAATAGCACAAAGGAGGAGG + Intergenic
1150628728 17:66861158-66861180 CAATAACAGCACAAAGGAGTTGG + Intronic
1156406401 18:36786675-36786697 CTAAAACCACAAAAGGGAGGGGG + Exonic
1159526410 18:69596882-69596904 CAATAACAACACAAAGGAGGTGG + Intronic
1160795733 19:944609-944631 CGAAAACCAGACAATGAAGGAGG - Intronic
1161185337 19:2914880-2914902 CAATAACAGCACAGAGGAGGAGG - Intronic
1165375586 19:35439539-35439561 ACATAATCACAAAAAGGAGGAGG - Intergenic
927486180 2:23489819-23489841 CGGTACCCACACCAAGGAGGAGG + Intronic
929287769 2:40155060-40155082 AGACAACCAAAAAAAGGAGGAGG - Intronic
929743651 2:44631986-44632008 CGATAACAGCATAAAGGAGAGGG - Intronic
929940272 2:46328356-46328378 CGTTAACCAAACATGGGAGGTGG + Intronic
931294907 2:60913294-60913316 AAATAACCACACATATGAGGAGG - Intronic
931315799 2:61129627-61129649 CAATAACAGAACAAAGGAGGTGG + Intronic
932342288 2:70973171-70973193 CAATAACAACAAAAATGAGGTGG - Intronic
932647575 2:73520051-73520073 AGATAACTACACAAAAGAGCTGG - Intronic
934982561 2:98856681-98856703 CAATAACAACAAAAAGGAGGAGG + Intronic
935254734 2:101299721-101299743 CCATTACCACACAAAGAACGTGG - Intronic
938395446 2:130943724-130943746 CAACAACAACATAAAGGAGGAGG - Intronic
938423717 2:131166369-131166391 CAATAACAACACAAAGGGTGAGG - Intronic
939986934 2:148838483-148838505 CAGTAACCACACAAAGGAGGTGG - Intergenic
940844823 2:158629200-158629222 AGGTAAGCACACCAAGGAGGGGG - Intronic
943207030 2:184913192-184913214 CAATAACTACATAAAGAAGGAGG - Intronic
943430757 2:187798117-187798139 CAATAACAGCACAGAGGAGGTGG - Intergenic
947847841 2:233259860-233259882 AGATAAATAAACAAAGGAGGTGG - Intronic
948982516 2:241501603-241501625 CGATAACCACACAAAGGAGGTGG - Exonic
1170668693 20:18409761-18409783 CAATAACAACACAAAGAAGGTGG + Intronic
1173677476 20:44849418-44849440 CTATAGCCACACAAAGGTAGTGG + Intergenic
1177663419 21:24119190-24119212 AGATAAGCACACTTAGGAGGTGG + Intergenic
1178808091 21:35856274-35856296 TGAGTGCCACACAAAGGAGGTGG + Intronic
1183696038 22:39422929-39422951 CAAGAATCACAGAAAGGAGGAGG - Intronic
1183907967 22:41056950-41056972 CAATAACAGCACAAAGGAGGTGG - Intergenic
1184056674 22:42056305-42056327 CAATAACAGCATAAAGGAGGAGG - Intronic
949403510 3:3690294-3690316 CATTAACTACACAAATGAGGGGG - Intergenic
950102453 3:10366317-10366339 CAATAACCCCAGAAGGGAGGAGG - Intronic
950697277 3:14712559-14712581 TGATAACAACATAAAGGGGGAGG - Intronic
951957877 3:28277057-28277079 AGAAAACCACAAAAAGGAAGTGG - Intronic
954201451 3:49025722-49025744 CAAGGACCACACAAAGGAGTTGG + Intronic
954271175 3:49510591-49510613 CCATAACCACAGAGAGCAGGAGG - Exonic
955916607 3:63913129-63913151 AGATATACACACACAGGAGGAGG - Intronic
956640726 3:71413040-71413062 TGAAAAACACACAAAGGTGGAGG + Intronic
957857932 3:85903097-85903119 CAATAACAGCACAAAGGAAGTGG - Intronic
959271497 3:104216664-104216686 CGATAACAAAATAAAGGAGCTGG + Intergenic
960554589 3:119013397-119013419 CAATAACCAAACAAGTGAGGAGG - Intronic
960651291 3:119953048-119953070 CAATAACAGCAAAAAGGAGGGGG + Intronic
964249935 3:154701661-154701683 CAATAACAGCACAAAGAAGGTGG + Intergenic
970170372 4:13283430-13283452 CCATGACCACAGTAAGGAGGGGG + Intergenic
973565462 4:52182125-52182147 CAATAACATCACAAAAGAGGAGG + Intergenic
977887606 4:102271234-102271256 CAAGAAGGACACAAAGGAGGAGG + Intronic
980202017 4:129668149-129668171 TGATAACCAAACGAAGGAGACGG + Intergenic
981875438 4:149538227-149538249 CAGTAACAACACAAAGGAGGAGG + Intergenic
985862472 5:2483834-2483856 TTATAACAACACAAAAGAGGAGG + Intergenic
987037015 5:14029348-14029370 CGATAATGACACAGAGGAGGAGG + Intergenic
987898117 5:23975789-23975811 CAATAACAACACAAAGTAGGTGG - Intronic
990351812 5:54925267-54925289 CAATAACAGCATAAAGGAGGAGG - Intergenic
992761946 5:79958183-79958205 CCAGGAGCACACAAAGGAGGTGG + Intergenic
994328836 5:98482146-98482168 CAACAACAACACATAGGAGGAGG + Intergenic
995176866 5:109188172-109188194 TGATGCCCAGACAAAGGAGGAGG - Exonic
997447884 5:133954954-133954976 AGATAACACCACACAGGAGGAGG + Intergenic
1005295729 6:24424942-24424964 CCATGACCACACACAGGAGTGGG - Exonic
1005590122 6:27314678-27314700 TAATAACAGCACAAAGGAGGTGG + Intergenic
1012267205 6:97160036-97160058 CAATAACAATAAAAAGGAGGTGG - Intronic
1012305665 6:97654053-97654075 GGATAGCCACACAAAAGCGGTGG + Intergenic
1016285656 6:142469821-142469843 AGACAACCACACATAGGAGAGGG - Intergenic
1016612527 6:146007956-146007978 TGAAAACAACACAAAGGGGGTGG - Intergenic
1021008637 7:15434094-15434116 CCACAACCACAAAAAGGAGGTGG - Intronic
1023592828 7:41797094-41797116 GGAAAAACACACAAAGGAAGAGG + Intergenic
1032215644 7:129955122-129955144 AGAAAACCACACAGAGAAGGAGG + Intergenic
1041609273 8:59825557-59825579 CAAAAACAACACAAAGGAAGTGG - Intergenic
1042690080 8:71488022-71488044 CAACAACCAAAAAAAGGAGGGGG + Intronic
1045548853 8:103152380-103152402 AGTTAACCACACAGAGGGGGCGG - Intronic
1045598600 8:103686921-103686943 CTAAAACCACACAAAGAAGCTGG - Intronic
1046282913 8:112057308-112057330 AGATAACCACACAAAATAGGAGG - Intergenic
1046869850 8:119193913-119193935 AGATAATCTCACAAAGGAAGGGG - Intronic
1049871523 8:144982032-144982054 TGACAACAGCACAAAGGAGGTGG + Intergenic
1050279105 9:4032191-4032213 CGTTCACTACACACAGGAGGAGG + Intronic
1050818585 9:9847968-9847990 CGAAAATCACACAAAGGCAGTGG + Intronic
1050902946 9:10967958-10967980 CTATAACCCCAAAAAGGAGGGGG - Intergenic
1052546569 9:29888528-29888550 CTCTCCCCACACAAAGGAGGTGG + Intergenic
1056594432 9:87994617-87994639 CAATAACAGCACAAAGGAGAAGG - Intergenic
1057296391 9:93845923-93845945 CAATAACAGCACAAAGGAGTGGG - Intergenic
1058126005 9:101195719-101195741 GGAAAACAACACAAAGCAGGTGG - Intronic
1060332418 9:122685325-122685347 AAATAATCACACAAAGGAGGAGG + Intergenic
1189124626 X:38433303-38433325 AAATAACCAAAAAAAGGAGGGGG - Intronic
1189678547 X:43489220-43489242 AGATAACCACACAAAATAGTGGG + Intergenic
1196786658 X:119426867-119426889 CTATAAACACACAAATGAGCTGG + Intronic
1197676164 X:129333001-129333023 TAATAATGACACAAAGGAGGAGG - Intergenic
1198475042 X:136987795-136987817 CAATGACAGCACAAAGGAGGGGG - Intergenic
1199963041 X:152794848-152794870 CGATAACAGCACCAAGGGGGTGG - Intergenic
1200122592 X:153798152-153798174 CAACAACCCCAAAAAGGAGGAGG - Intronic
1200178057 X:154132109-154132131 TGATAACAACACACAGGAGAAGG - Intergenic
1202282804 Y:23208048-23208070 TGATCACCACAAAAAGGAGCGGG + Intergenic
1202283087 Y:23210471-23210493 TGATCACCACAAAAAGGAGCGGG - Intergenic
1202434478 Y:24822433-24822455 TGATCACCACAAAAAGGAGCGGG + Intergenic
1202434761 Y:24824857-24824879 TGATCACCACAAAAAGGAGCGGG - Intergenic