ID: 948983314

View in Genome Browser
Species Human (GRCh38)
Location 2:241506007-241506029
Sequence GGTCATTCCCCTTGTTTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 151}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948983314_948983316 -3 Left 948983314 2:241506007-241506029 CCCACAAAACAAGGGGAATGACC 0: 1
1: 0
2: 0
3: 9
4: 151
Right 948983316 2:241506027-241506049 ACCCAGCACACATAGCTGAGTGG 0: 1
1: 0
2: 2
3: 18
4: 171
948983314_948983319 13 Left 948983314 2:241506007-241506029 CCCACAAAACAAGGGGAATGACC 0: 1
1: 0
2: 0
3: 9
4: 151
Right 948983319 2:241506043-241506065 TGAGTGGTGATACAGTGCTCTGG 0: 1
1: 0
2: 0
3: 8
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948983314 Original CRISPR GGTCATTCCCCTTGTTTTGT GGG (reversed) Intronic
901200734 1:7465715-7465737 GGGCCTTCCTCTTCTTTTGTAGG + Intronic
901811501 1:11769203-11769225 TTTCATTCCCATTCTTTTGTGGG - Intronic
906546340 1:46621894-46621916 AGACCTTCCCCTTGCTTTGTGGG + Intergenic
911615133 1:100002475-100002497 GGTCTTTCCTCTTTTTTTCTTGG + Intronic
912620145 1:111147662-111147684 AGTAATTTCCCTTCTTTTGTAGG - Exonic
913464009 1:119120419-119120441 GGTCCTGCACCTTTTTTTGTTGG - Intronic
913485570 1:119329966-119329988 GGTCTTTTCTCTGGTTTTGTTGG - Intergenic
915042946 1:152983699-152983721 GGTTGTTCCCCGTGTTCTGTGGG - Intergenic
916247333 1:162701939-162701961 AGTAAATCCCCTTGTTTTCTTGG + Intronic
919964844 1:202512577-202512599 GATTATTATCCTTGTTTTGTAGG + Intronic
920938160 1:210455418-210455440 GCTCGTTCCCTTTGTTTTTTTGG + Intronic
921311147 1:213845060-213845082 TGTAATTTTCCTTGTTTTGTCGG - Intergenic
1065725813 10:28667102-28667124 GCTCATGCCACTTGTTTTGGAGG + Intergenic
1068298430 10:55106754-55106776 GGATGTTCCCCTTTTTTTGTTGG - Intronic
1068547232 10:58361273-58361295 GATCATTACCCTTGTTTCATTGG + Intronic
1069653180 10:70066393-70066415 GGTTTTCTCCCTTGTTTTGTTGG - Intronic
1070983725 10:80670235-80670257 GGTCTTTGCCCTTGGTTTCTGGG - Intergenic
1072148217 10:92662500-92662522 AGTCATTTCCCTTGTTGTTTTGG + Intergenic
1073481575 10:103789234-103789256 GGGCATTCCCTTTGGCTTGTGGG - Intronic
1074903505 10:117839917-117839939 GATCATTCCCTTGGTTGTGTGGG + Intergenic
1075371523 10:121939901-121939923 GTTCATTCCTCTTTTTTTTTTGG - Intergenic
1076808825 10:132876133-132876155 GGGCATTCCCCTTGGTTTAATGG - Intronic
1080358462 11:31482493-31482515 TGTCATTTCCTTTGATTTGTGGG - Intronic
1083499552 11:63091271-63091293 GGTCCTTGCCCTTTTTTGGTTGG - Intronic
1085698223 11:78723604-78723626 GGTCAATCCCCTCATTTTGTTGG - Intronic
1085702501 11:78757454-78757476 GGTGATTCCCATTGTTCTGAGGG - Intronic
1085954505 11:81375167-81375189 GATTATTTTCCTTGTTTTGTAGG - Intergenic
1091008124 11:131972559-131972581 TGTCATTCCCATTGCTTTGAGGG + Intronic
1091817174 12:3447342-3447364 GGACATTACATTTGTTTTGTTGG + Intronic
1091849330 12:3682624-3682646 ATTCTTTCACCTTGTTTTGTTGG + Intronic
1095653726 12:44644843-44644865 AGACATTATCCTTGTTTTGTGGG + Intronic
1096042650 12:48531537-48531559 CATCATTCCCCTTGCTTTGTCGG + Intergenic
1097470732 12:59987796-59987818 GGTCAGTCCCCTTATTCTCTGGG + Intergenic
1100069416 12:90694032-90694054 GTTCATTTCCCTTATTTTCTGGG + Intergenic
1101714438 12:107298239-107298261 TGTCTTTCCTCTTGTTTGGTGGG + Intergenic
1102382343 12:112477922-112477944 AGTCATTCACCGTGTTTTGCAGG - Exonic
1102766368 12:115436999-115437021 TTTCCTTCCCCTTGCTTTGTAGG - Intergenic
1105510827 13:21050375-21050397 GGTGGTTCCCCTTGGTCTGTGGG - Intronic
1107153698 13:37141784-37141806 GGTCCTTCCCCATGATATGTGGG - Intergenic
1108941487 13:55961437-55961459 GGTTATTTCACTTTTTTTGTGGG + Intergenic
1109421041 13:62112969-62112991 GTTCAGAACCCTTGTTTTGTGGG - Intergenic
1111371768 13:87328565-87328587 GGTCTTTCTCCTTGTCTTGTAGG + Intergenic
1111511342 13:89267771-89267793 GGTCCTTCCTCTTGTGTTGAGGG + Intergenic
1111891738 13:94090769-94090791 GGTTCTTCCACTTGTTATGTGGG - Intronic
1112952708 13:105020928-105020950 GCTCTTTACACTTGTTTTGTTGG + Intergenic
1113638711 13:111941796-111941818 GTTCTTTTCCGTTGTTTTGTAGG + Intergenic
1113679064 13:112229680-112229702 GGTCACTACCGGTGTTTTGTGGG + Intergenic
1114779107 14:25518508-25518530 GGGCATTCCCTCTGATTTGTAGG - Intergenic
1118421098 14:65604729-65604751 GGTCATTTCCTTTCTTCTGTTGG - Intronic
1118887059 14:69876393-69876415 AGTCATACTCCTTGTCTTGTGGG - Intronic
1121869254 14:97392053-97392075 GGTCATTCCACCTTTTTTCTTGG + Intergenic
1126941235 15:53768069-53768091 GGTCTTTCCACTCCTTTTGTTGG - Intergenic
1130898953 15:88192682-88192704 ACACACTCCCCTTGTTTTGTGGG + Intronic
1131602688 15:93865545-93865567 GGCCACTTCCCTCGTTTTGTTGG - Intergenic
1132493160 16:245502-245524 GGTCCTTGCCTTTCTTTTGTGGG + Intronic
1133476191 16:6124368-6124390 AGTCATTGCCTTTGTATTGTAGG + Intronic
1134779658 16:16884255-16884277 GTTCATTCCCCTTCCTTAGTTGG - Intergenic
1136735719 16:32465243-32465265 GGTTATTTCCTTTGTTTTCTGGG + Intergenic
1137560636 16:49499918-49499940 TATTAGTCCCCTTGTTTTGTTGG - Intronic
1137862979 16:51865482-51865504 GGTCTTTCCTCTTATGTTGTGGG - Intergenic
1147237517 17:39068800-39068822 GGTCATTCCCCCAGTTTCTTAGG - Intronic
1152165053 17:78698320-78698342 GGTCATTCCCGTCGTCTTCTGGG + Exonic
1152614913 17:81333626-81333648 GGACACTCCCCTTGGTTTGAGGG - Intergenic
1153710304 18:7792505-7792527 GCTCATACCCCTTGTTATTTGGG + Intronic
1156371486 18:36475218-36475240 GGCTTTTCCCCTTGTTTTGATGG + Intronic
1157226831 18:45873709-45873731 TGGCATTACCCTAGTTTTGTAGG + Intronic
1157343837 18:46805426-46805448 GATCATTCCCTTTGATTTGCTGG - Intergenic
1158157470 18:54442104-54442126 AGTCATTCCCCATATTTTGCTGG - Intergenic
1158516617 18:58135926-58135948 GGCCATACCCCTTGTGTGGTTGG + Intronic
1163987693 19:20968733-20968755 GGTCATTTCACTTATTTTGGGGG + Intergenic
1166477023 19:43135504-43135526 GGTCACTCCCGTTGTCTTCTTGG + Intronic
1167001626 19:46748585-46748607 ATTCATTTACCTTGTTTTGTGGG + Exonic
927934864 2:27070721-27070743 GGTCTTTCCCCCTCTTTTCTAGG - Exonic
930949797 2:57126734-57126756 AGTCTTTCCTCTTGTTCTGTTGG + Intergenic
934920652 2:98342622-98342644 GGTGATTGTCCTTCTTTTGTGGG + Intronic
935370691 2:102343496-102343518 GGCCATTCCCATTGTCTTGATGG - Intronic
936877664 2:117211972-117211994 GGTCATTACCCTTGTCTTCGAGG - Intergenic
938221822 2:129575415-129575437 TGACATTCCCCTAGTTTTGGGGG + Intergenic
941663612 2:168220979-168221001 GGTGATTCCTCTTGTTTCCTGGG + Intronic
943584710 2:189724507-189724529 GGTCAAGGACCTTGTTTTGTTGG + Intronic
945074303 2:206022443-206022465 GGTAATTCCCTTTGTTTGTTGGG - Intronic
946280185 2:218660827-218660849 GGTCAATACCCTCCTTTTGTGGG - Intronic
947193023 2:227529436-227529458 GTTCATTAGCATTGTTTTGTAGG + Intronic
948983314 2:241506007-241506029 GGTCATTCCCCTTGTTTTGTGGG - Intronic
1170287266 20:14723750-14723772 GGTCATATCCCTTGGTCTGTGGG + Intronic
1172598450 20:36167077-36167099 GGTCCTTTCCCCTGTTTTTTTGG - Intronic
1173816014 20:45988587-45988609 GGTCATTTATTTTGTTTTGTTGG + Intergenic
1178266236 21:31144873-31144895 GGTCATTCCCACTGTTTTAAGGG + Intronic
1185183008 22:49373790-49373812 GGTCATTTCCTTTGTTATTTTGG - Intergenic
949945797 3:9189025-9189047 GGTCTTTGTCCTTTTTTTGTAGG + Intronic
950062803 3:10086279-10086301 TTTCTTTCCCCTTGTCTTGTAGG + Intronic
950991083 3:17438384-17438406 GGTCCTTCCCATTGATATGTGGG - Intronic
952871961 3:37909075-37909097 GGTCTTTCTCTTTATTTTGTTGG + Intronic
953019101 3:39102866-39102888 TGTCATTCTCCTTGTTCTGTGGG + Exonic
960438001 3:117651095-117651117 GCTTATTCCCCTTCTTTTGATGG + Intergenic
964210225 3:154218526-154218548 GGTCATGGCCATTCTTTTGTTGG + Intronic
964892801 3:161557156-161557178 GGTCATGTCCCTTCCTTTGTGGG + Intergenic
969257606 4:6013101-6013123 GGTCATTAACCTTGTTCAGTAGG + Intergenic
970213801 4:13737815-13737837 GGTCATTCTGGCTGTTTTGTGGG + Intergenic
971978891 4:33728627-33728649 GATCATTTCCCTTGTTTTTCAGG - Intergenic
974953930 4:68615857-68615879 GGTAATTCCCCTTTTTTTGATGG + Intronic
978701010 4:111646080-111646102 GCTCATTCCCCTTCTTTAGTGGG + Intergenic
983174583 4:164573272-164573294 TGTCATTCTCTTTGTCTTGTAGG + Intergenic
984841847 4:184075950-184075972 GGTCAGACCCCTTACTTTGTAGG - Intergenic
988272472 5:29034122-29034144 TGTAATTCCCAGTGTTTTGTGGG - Intergenic
988714374 5:33810671-33810693 TGTCATATCCCTTGTTTTGCTGG - Intronic
989817988 5:45759985-45760007 GGTCTTTTCCCTTCTTTTCTTGG + Intergenic
990975336 5:61555687-61555709 CGTAATTCCCCATGTTTTGAAGG - Intergenic
994155119 5:96494735-96494757 GGTCATTCCCACTGATTGGTGGG - Intergenic
995182308 5:109240370-109240392 GCCCATTCCCGTTGTTTTGGGGG + Intergenic
995412350 5:111872984-111873006 AGGCATTCCCATTGTTATGTAGG + Intronic
996288680 5:121826453-121826475 GGTTATTTCCCTTCTTCTGTTGG + Intergenic
996593320 5:125173393-125173415 TGTCATTCCCACAGTTTTGTGGG + Intergenic
998384938 5:141751840-141751862 GTGCATTCCCCTGGTTTTTTTGG - Intergenic
999374313 5:151076226-151076248 GCTGGGTCCCCTTGTTTTGTGGG - Intronic
999601934 5:153276382-153276404 GATCATGCCTCTTGTTTTGTAGG - Intergenic
999684028 5:154086443-154086465 GCTCTTTCCCTTTCTTTTGTCGG + Intronic
1003408540 6:5843127-5843149 GGTCATTCCACATGGTGTGTTGG + Intergenic
1008318223 6:50073544-50073566 GTTCATTCCCCATGTATTGAAGG + Intergenic
1009573048 6:65414006-65414028 GGTAATTCTGTTTGTTTTGTTGG + Intronic
1010981118 6:82371064-82371086 GGTCAGTCCCCTGGTTTTCCAGG - Intergenic
1011141395 6:84161409-84161431 ACTCATTCCACTTGTTTTCTTGG - Intronic
1011822032 6:91264362-91264384 GGTGATTTTCCTTGTTTGGTGGG - Intergenic
1014799156 6:125758767-125758789 GGTCTCTCCCTTTGTATTGTGGG - Intronic
1015058176 6:128929677-128929699 GGTGATTGCCCTTGATTTCTTGG - Intronic
1015863661 6:137706193-137706215 AGTCATTCACCATGTTTTGCAGG + Intergenic
1016733815 6:147454195-147454217 GGCCTCTCCCCTTGGTTTGTAGG - Intergenic
1018451854 6:163916424-163916446 GGTAATACCCCTCATTTTGTAGG + Intergenic
1018889871 6:167976181-167976203 GGTCATTCCCCCTGCAGTGTTGG + Intergenic
1018889924 6:167976350-167976372 GGTCATTCCCCCTGCAGTGTGGG + Intergenic
1018889938 6:167976392-167976414 GGTCATTCCCCCTGCAGTGTGGG + Intergenic
1018889999 6:167976602-167976624 GGTCATTCCCCCTGCAGTGTTGG + Intergenic
1024453489 7:49576887-49576909 GGACATTTCCCTTGTTTTTCTGG + Intergenic
1024586002 7:50842685-50842707 GGTCAGTGCCTTTGTTTTCTTGG + Intergenic
1024672020 7:51604752-51604774 GTTCATGTCCTTTGTTTTGTAGG + Intergenic
1031044737 7:116875094-116875116 GTTGATTCCACTTTTTTTGTGGG - Intronic
1034336682 7:150328392-150328414 GGTCTTTCTCCATGTTTTTTTGG - Intronic
1036609452 8:10336997-10337019 GGTCTTTACCATTGTTTTCTGGG - Intronic
1038419673 8:27424789-27424811 GGTTATTGCCCATGATTTGTAGG - Intronic
1041830581 8:62148267-62148289 GGCCATTCACCTTTTCTTGTTGG - Intergenic
1041883479 8:62780057-62780079 GGTCTTCCCTCTTGTTTTGTAGG - Intronic
1042230472 8:66549278-66549300 TCTCATTGCCATTGTTTTGTTGG - Intergenic
1049651073 8:143770227-143770249 GTTCATGCCCTTTGTTTTCTGGG + Intergenic
1052679171 9:31667074-31667096 GTTCATTCTCCTTGCTGTGTAGG - Intergenic
1053148994 9:35731180-35731202 GGTAAATGCCCTTCTTTTGTAGG - Intronic
1056212349 9:84376586-84376608 AGCGATTACCCTTGTTTTGTGGG + Intergenic
1056508138 9:87276899-87276921 GAACATTCGCCTTGTTTTGTTGG - Intergenic
1056964102 9:91151939-91151961 GCTCAGTCCCCTTGTGTGGTTGG - Intergenic
1058356470 9:104089497-104089519 TGTCATACCCCTTCTTTTATGGG - Intergenic
1059374336 9:113870590-113870612 GAGCATTTCCCTTGTTTTTTAGG + Intergenic
1060817475 9:126642745-126642767 GATCATTCTCCTTGTCTTGGAGG + Intronic
1060914187 9:127375653-127375675 GATCATTCCTCTTCCTTTGTAGG + Intronic
1187254726 X:17631979-17632001 GAACATGCCCCTTGTTTTCTGGG + Intronic
1188334288 X:28910368-28910390 TGTCATTCCCTTTATTTTATAGG + Intronic
1189992450 X:46607882-46607904 TGGCCCTCCCCTTGTTTTGTTGG - Intronic
1191179842 X:57549924-57549946 GGTCATGAACTTTGTTTTGTTGG - Intergenic
1194292789 X:92095721-92095743 AGTCATTACCCTTGATATGTAGG - Intronic
1195429499 X:104772765-104772787 GTTCATTCCACTTGTGTTATTGG + Intronic
1196656451 X:118223066-118223088 GGGCATTCCCGTTTTTTGGTGGG - Intergenic
1200173170 X:154094116-154094138 GGTCATTCCCCCTTTGATGTGGG + Intronic
1200610294 Y:5320283-5320305 AGTCATTACCCTTGATATGTAGG - Intronic