ID: 948983488

View in Genome Browser
Species Human (GRCh38)
Location 2:241507043-241507065
Sequence AGTTGGGCCTGCAGTGGAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 163}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948983488_948983495 9 Left 948983488 2:241507043-241507065 CCTGTTCCACTGCAGGCCCAACT 0: 1
1: 0
2: 0
3: 11
4: 163
Right 948983495 2:241507075-241507097 GCACATAGGAGTGAACAAGGAGG 0: 1
1: 0
2: 2
3: 11
4: 166
948983488_948983492 -5 Left 948983488 2:241507043-241507065 CCTGTTCCACTGCAGGCCCAACT 0: 1
1: 0
2: 0
3: 11
4: 163
Right 948983492 2:241507061-241507083 CAACTCTCCATTCAGCACATAGG 0: 1
1: 0
2: 0
3: 14
4: 125
948983488_948983497 26 Left 948983488 2:241507043-241507065 CCTGTTCCACTGCAGGCCCAACT 0: 1
1: 0
2: 0
3: 11
4: 163
Right 948983497 2:241507092-241507114 AGGAGGGCCACACATTTTAGCGG 0: 1
1: 0
2: 1
3: 8
4: 125
948983488_948983496 10 Left 948983488 2:241507043-241507065 CCTGTTCCACTGCAGGCCCAACT 0: 1
1: 0
2: 0
3: 11
4: 163
Right 948983496 2:241507076-241507098 CACATAGGAGTGAACAAGGAGGG 0: 1
1: 0
2: 2
3: 14
4: 215
948983488_948983494 6 Left 948983488 2:241507043-241507065 CCTGTTCCACTGCAGGCCCAACT 0: 1
1: 0
2: 0
3: 11
4: 163
Right 948983494 2:241507072-241507094 TCAGCACATAGGAGTGAACAAGG 0: 1
1: 0
2: 1
3: 34
4: 1651

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948983488 Original CRISPR AGTTGGGCCTGCAGTGGAAC AGG (reversed) Intronic
900585475 1:3430523-3430545 AGCTGGACCTGCACTGGCACGGG - Intronic
901021826 1:6260008-6260030 AGTTGGCCCTGCAGTGGGCGGGG - Intronic
901536367 1:9884916-9884938 GGGTGGGGCTGCGGTGGAACAGG + Intronic
903259178 1:22122069-22122091 AGTGGGGCCAGCTGGGGAACAGG - Intronic
903572019 1:24313069-24313091 AGTTGTGCCTGCAGAGCAGCAGG - Intergenic
905028877 1:34868507-34868529 GGCTGGGGCTGCAGTGTAACAGG - Intronic
906688047 1:47775238-47775260 AGTTTGGCCGGCAGAGGAAGTGG - Exonic
909612981 1:77572703-77572725 AATTGGGCCTGCAGTGAACCTGG - Intronic
912496409 1:110094860-110094882 AGTTGGGCATGGAGGGGAAGGGG - Intergenic
915117209 1:153608530-153608552 AGGTGGGCCAGCTGTGGAGCAGG - Intronic
918142976 1:181733765-181733787 AGTTGGGGGTGGAGGGGAACAGG - Intronic
918932608 1:190875018-190875040 ATTTGGGACTCCAGTGGAGCTGG - Intergenic
919881371 1:201903360-201903382 AGTGGGGCCTCCAGTGCAGCTGG - Intronic
919991418 1:202710383-202710405 AGTTGGGGCAGCGGTGGAGCGGG - Intronic
920415944 1:205799453-205799475 AGATGGGACAGCAGTGGCACAGG + Intronic
920907403 1:210184500-210184522 AGTTGAGCCTGCAGTGATCCTGG + Intergenic
921105141 1:211969509-211969531 ATTTGGGCTAGCAGTGGAAGAGG - Intronic
1063189686 10:3681740-3681762 TGTGGGTTCTGCAGTGGAACAGG + Intergenic
1064143283 10:12807793-12807815 AGGGGGGCCTGCAGTGGAGCTGG - Intronic
1064660157 10:17599740-17599762 CGTTGGTCCTACAGTAGAACAGG - Intronic
1065341656 10:24712284-24712306 ACTTGGGCATGCAGTGGAGAAGG + Intronic
1068341403 10:55708910-55708932 AGTTGTCCCTCCAGAGGAACTGG + Intergenic
1068946058 10:62729917-62729939 AGTAGGGTCTGCAGTGGAGAAGG - Intergenic
1070550776 10:77488993-77489015 AGGTGGGCCTTGAGTGGAGCAGG - Intronic
1070911466 10:80122464-80122486 AGCTAGGCCTGCAGTGGTCCTGG - Intergenic
1076377780 10:130003120-130003142 GGTTGCACCTGCAGTGGGACAGG - Intergenic
1076997751 11:307213-307235 AGGTGGGCCTCCAGGGGAAAGGG + Intergenic
1077014100 11:392398-392420 AGGTGGGCCTGGGGTGGACCTGG + Intergenic
1077299501 11:1840474-1840496 AGGTGGGTCTGCAGGGGAGCTGG + Intronic
1077572500 11:3352336-3352358 AGTTGGGGGTGCAGGAGAACTGG + Intronic
1077573483 11:3358047-3358069 AGTTGGGGGTGCAGGAGAACTGG + Intronic
1078185386 11:9047623-9047645 GGTAGGGCCTGCAGTTGATCTGG - Intronic
1081632482 11:44699350-44699372 CATTGGGCCTGCAGTGGCACTGG + Intergenic
1082554659 11:54548736-54548758 TGTGAGGCCTGCAGTGGAAAAGG + Intergenic
1082583897 11:54909955-54909977 ATTTGGGCCTACAGTGAAAAAGG - Intergenic
1083714105 11:64565827-64565849 AATAGAGCCTGCATTGGAACCGG + Intronic
1085410515 11:76287887-76287909 AGTTGGGGTTGGTGTGGAACAGG + Intergenic
1087816821 11:102667124-102667146 AGATCTGCCTACAGTGGAACAGG + Intergenic
1089792222 11:120953426-120953448 ACTGGGGGCTGCAGTGGAGCAGG + Intronic
1090352154 11:126114580-126114602 AGCTGGGCATGCAGGGGAAAAGG + Intergenic
1094056625 12:26274968-26274990 AGTGGGGCCTGCCCTGGAAGGGG + Intronic
1094507542 12:31074195-31074217 GGTTGTGCCTGCGGTGGAACTGG + Intronic
1094857535 12:34417416-34417438 ATTTGGGCCTACAGTGAAAAAGG - Intergenic
1096911051 12:54984159-54984181 AGTAGGGCCTGAAATGAAACCGG + Intronic
1097363059 12:58679692-58679714 AGTAGTGGCAGCAGTGGAACTGG + Intronic
1097863655 12:64542528-64542550 AGTTGAGTCTGCAGAGGAGCAGG - Intergenic
1097959321 12:65517140-65517162 AGTTGGGCCTGCAGTCATAAAGG - Intergenic
1104678181 12:130729810-130729832 AGATGGGCCTGGGGTGGCACGGG + Intergenic
1104732986 12:131118882-131118904 AGTGGGGCCTGCTGTGCACCAGG + Intronic
1105498737 13:20953164-20953186 AGCTGGGCCTGCAGTGGAGGAGG + Intergenic
1106590205 13:31092109-31092131 AGTTTTGGCTGCAGTGGAACAGG - Intergenic
1113668635 13:112159808-112159830 CGTGAGGCCTGGAGTGGAACAGG + Intergenic
1114261866 14:21042800-21042822 TGTTGGGGCTGCAGTGGATGTGG + Intronic
1114437916 14:22723554-22723576 AGCTGGCTCTGCAGGGGAACAGG + Intergenic
1119265385 14:73260986-73261008 AGATGGGCCTGGGGTGGATCAGG + Intronic
1119575844 14:75721212-75721234 AGTTGGGGGTGGAGTGGAAGGGG - Intronic
1121916182 14:97838591-97838613 GGTTGGCCCTGCAGAGGAAGTGG - Intergenic
1122696783 14:103558126-103558148 AGTTGGACCTGCAGTAGTATGGG + Intronic
1122890522 14:104730074-104730096 AGTTGGGCCTCCACAGGCACTGG - Exonic
1124119204 15:26874696-26874718 AGTAAGACCTGCAGTGAAACAGG + Intronic
1126782315 15:52149453-52149475 AGATGAGGCTGCAGTGGGACTGG - Intronic
1130122232 15:81060889-81060911 AGTTGGGCACCCAGTGGAATGGG - Intronic
1130226228 15:82060198-82060220 AGTGGGGCCTGCAGTTGGAAGGG - Intergenic
1130433381 15:83872049-83872071 AATTCAGCCTGCAGTGGGACTGG + Intronic
1130678724 15:85977815-85977837 AGTTGGGGCTGCAGAGGGAGAGG - Intergenic
1135182361 16:20286942-20286964 AGTGGGGCATGCAGTGGGAGTGG - Intergenic
1136655772 16:31708342-31708364 GGTTGAGCATGCAGTGGCACAGG - Intergenic
1137526878 16:49244273-49244295 ATTGGGGTCTGCAGTGGCACTGG + Intergenic
1137778688 16:51078127-51078149 CGTTGGGCCTGCAGATGAACAGG - Intergenic
1140289570 16:73640137-73640159 CCTGGGGCCTGCAATGGAACTGG + Intergenic
1141936269 16:87240737-87240759 AGTTGGGCATGGAGTGGCAGGGG + Intronic
1144946080 17:18970218-18970240 AGTAGGGCCTGGGGTGGAAACGG + Exonic
1145184269 17:20780633-20780655 ATCTGGGCCTGCAGTGAAATAGG - Intergenic
1146790884 17:35749994-35750016 AGTGGGGGCTGGAGTGGGACTGG + Intronic
1149602172 17:57900061-57900083 AGCTGGGCCTGCAGGGAACCAGG - Intronic
1150778503 17:68100848-68100870 AGTTGGGACTGCAGTGAGTCTGG + Intergenic
1151723977 17:75874281-75874303 AGTGAGGTCTGCAGGGGAACAGG + Exonic
1156841237 18:41612173-41612195 AGTTGTGCCTGCAGAGACACAGG + Intergenic
1160514999 18:79473262-79473284 TGTGGGGCCTTCAGTAGAACAGG - Intronic
1160613069 18:80104169-80104191 AGTTGGTCCTGAATTGGAAGTGG - Intergenic
1160675633 19:389870-389892 GGTTGGGGCTGCAGAGGGACTGG - Intergenic
1161903346 19:7136326-7136348 AGGAGGGTCTGCAGTGGAAACGG - Intronic
1162087093 19:8255503-8255525 ATGTGGGCCTGCAGTGGAGAGGG + Intronic
1162301276 19:9846562-9846584 GCTTGGGACTGCAGTGGAAATGG - Intronic
1163451280 19:17378925-17378947 AGTTGGGCCTGGAGGGGATTTGG + Intergenic
1166309954 19:41957271-41957293 AGTGGGGACAGCAGGGGAACAGG - Intronic
1168701283 19:58440958-58440980 AGTGGGGCCCGCAGAGGACCTGG - Intergenic
927706123 2:25297459-25297481 ACTGGGCCCTGCAGTGGAACAGG + Intronic
930466723 2:51762141-51762163 AGTTGGCCTTGGAGTGGAACAGG - Intergenic
934664811 2:96163044-96163066 AGTTGGGGCTGCTGGGGAAGTGG + Intergenic
934665300 2:96165174-96165196 AGTTGGGGGTGTGGTGGAACAGG - Intergenic
936935716 2:117836640-117836662 AGCTCGGCCTGCGGAGGAACAGG - Intergenic
941878624 2:170459910-170459932 AGTCGGCCCTGCACTGGAAGCGG - Intronic
942739570 2:179159481-179159503 ATTTAGGCCTGAAGTAGAACTGG + Intronic
947359942 2:229336357-229336379 AGTTGGGACTGATGTGGATCAGG + Intergenic
948062578 2:235052547-235052569 AGTAGGGCCTGCAGAGGAAGAGG - Exonic
948083317 2:235225565-235225587 AGCTGGGCCAGCAGAGGACCAGG - Intergenic
948983488 2:241507043-241507065 AGTTGGGCCTGCAGTGGAACAGG - Intronic
1169194993 20:3678174-3678196 AGCAGGGGCTGCAGAGGAACAGG - Intronic
1169758003 20:9063976-9063998 AATAGGGCTTGCAGTGGGACAGG + Intergenic
1169794953 20:9452007-9452029 AGGTGGGCTTGCTGTGGATCTGG - Intronic
1172759473 20:37311898-37311920 AGTGGGGCCGGCAGGGGACCTGG + Intronic
1175063336 20:56263736-56263758 GGTTGGGTCTGCCATGGAACTGG - Intergenic
1175463651 20:59174161-59174183 AGTGGGGCTTGCAGAGGAAACGG + Intergenic
1176068148 20:63210848-63210870 AGTTGGGGGAGCAGAGGAACTGG - Intronic
1181028793 22:20140261-20140283 AGTTGGGGCTGCATGGGGACAGG + Intronic
1182095856 22:27625165-27625187 AGGTGGGTATGCAGTGGGACTGG + Intergenic
952943964 3:38463981-38464003 AGGTGGGCCTCCAGTCCAACAGG - Intronic
953879082 3:46682264-46682286 AGTTGGGCCAGGAGTAGAAAAGG - Intronic
953917659 3:46930861-46930883 AGTGGGGCCTGCTGTGGAGAGGG - Intronic
954442766 3:50530713-50530735 AGTTGGGACTCCACTAGAACTGG - Intergenic
956751774 3:72349151-72349173 AGATGGGACTGCAGAGGAAGTGG + Intergenic
958207584 3:90423271-90423293 ATTTAGGCCTGCGGTGGAAACGG - Intergenic
961451337 3:127003643-127003665 GGCTGGGTCTGCAGGGGAACCGG + Intronic
962009701 3:131381538-131381560 GGTTGGGCCTGCGGTGGGGCGGG - Intergenic
963801906 3:149684630-149684652 GGTTGGGCCTGCAGTGAGCCAGG - Intronic
966442145 3:179957485-179957507 AGATGGGCATGCAGTGACACTGG + Intronic
966786172 3:183624851-183624873 AGTGGGGGCTGCAGAGGAAGAGG + Intergenic
971264989 4:25089432-25089454 AATGAGGCCGGCAGTGGAACAGG + Intergenic
972797128 4:42432591-42432613 AGTTGGGCATGGGGTTGAACTGG + Intronic
975409458 4:74032316-74032338 AGTTAGACCTGCAGTGAGACTGG + Intergenic
977427597 4:96888083-96888105 AGTTGGGCCTACAGGGGTCCTGG - Intergenic
979001628 4:115228014-115228036 AGTTTAGCCTGCAATGGAATTGG + Intergenic
981088721 4:140710642-140710664 AGATGGGCTTGCAGGGGAAATGG - Intronic
981599645 4:146471803-146471825 AGTAGAGCCTGCATTTGAACAGG + Intronic
983281515 4:165686736-165686758 AGTTAGGCCTACATTTGAACAGG + Intergenic
990683992 5:58278915-58278937 AGTTGGACCTGGAGTTGGACTGG + Intergenic
992244321 5:74803309-74803331 AATTTGGACTGCAGTAGAACAGG + Intronic
994425201 5:99576547-99576569 TGTTGGGCCTGCAGGAGCACAGG + Intergenic
994436138 5:99735686-99735708 TGTTGGGCCTGCAGGAGCACAGG - Intergenic
997572673 5:134943724-134943746 AGTGTGGACTGCAGTGGAGCTGG + Intronic
999751269 5:154629715-154629737 GGTGGGGCCTGCAGTGAACCAGG + Intergenic
1003015495 6:2464249-2464271 TGCTGGGTCTGCAGAGGAACGGG + Intergenic
1006321678 6:33322935-33322957 AGTGGGGCCTGCGGTGGGAGTGG - Exonic
1006874602 6:37284367-37284389 AGTTGACCCTGCAGCGGAAGCGG + Exonic
1007144601 6:39615716-39615738 CTTTGGGCATGAAGTGGAACAGG - Intronic
1007724950 6:43910015-43910037 AGCTGGGCCTGCAGAGGCTCAGG + Intergenic
1007829044 6:44624424-44624446 AGCTGGGCCAGGAGTGGGACAGG + Intergenic
1008148587 6:47922432-47922454 AGTTGGGCCGGCAGGGGGGCTGG - Intronic
1011430153 6:87277166-87277188 AGTTGGGTCTGGAGTGAAATTGG + Intergenic
1014272286 6:119348828-119348850 AGGCGGGGCTGGAGTGGAACAGG + Exonic
1021666833 7:22990715-22990737 AGTTTGGAGGGCAGTGGAACTGG - Intronic
1022025916 7:26447818-26447840 AGCCGGGACTGCAGTGGAAGGGG - Intergenic
1023889309 7:44381236-44381258 AATGGGGCCTGCAGTGGCCCTGG + Exonic
1024075403 7:45815458-45815480 AGTTGGGAGTGCAGAGGAAATGG + Intergenic
1025871521 7:65438913-65438935 AGATCAGCCTGCAGTGGCACAGG - Intergenic
1026014490 7:66662387-66662409 AGTTGAGGCTGCAGTGAGACTGG + Intronic
1030299343 7:107959757-107959779 CGTTGGGCCGGCACTGGCACTGG + Exonic
1033218656 7:139513001-139513023 AATTGTGCCGGCAGAGGAACTGG + Intergenic
1034484348 7:151348941-151348963 AGTGTGGACTGCAGTGTAACGGG + Intronic
1034586172 7:152094397-152094419 ACTTGGGCCTCGAGTGAAACGGG - Exonic
1034591511 7:152143911-152143933 AGCCAGGCCTGCAGTGGTACAGG + Intronic
1035585606 8:770696-770718 TGCTGGGCCGGCTGTGGAACAGG + Intergenic
1040109807 8:43562267-43562289 AGCAGGCCCTGCACTGGAACAGG - Intergenic
1044033070 8:87262083-87262105 AGTTGGGGCTGCAGTGAGCCTGG + Intronic
1044861482 8:96527664-96527686 AGTTGGGTCTTCAGATGAACTGG + Intronic
1049332800 8:142064123-142064145 AGTTGGGGCTGCAGTAACACAGG + Intergenic
1049585752 8:143431581-143431603 TGCTGGGCCTGGAGTGGGACGGG + Intergenic
1051991878 9:23161690-23161712 AGTAGTGGCAGCAGTGGAACTGG - Intergenic
1053286555 9:36852925-36852947 AGCTGGGCCAGCAGAGGAAAGGG + Intronic
1057445980 9:95115007-95115029 GGTTGGGGCTGCAGTGAACCAGG - Intronic
1061009526 9:127946732-127946754 AGCTGGGTCTGCAGTGGAAAAGG + Intronic
1062036036 9:134382982-134383004 AGAAGGGGCTGCAGTGGGACTGG + Intronic
1062610656 9:137371920-137371942 AGTGGGGCCTGCAGTGGGTAGGG - Intronic
1186479226 X:9883466-9883488 AGTCTGGGCTGCAGTGGGACAGG - Intronic
1188888334 X:35578506-35578528 TGTTGGGCCTGCAGAGAAAAGGG + Intergenic
1189603040 X:42648058-42648080 AGTTTGTCTTGCAGTGGATCTGG - Intergenic
1190263427 X:48813967-48813989 ATTTGGGCCTCCAGTGTCACAGG + Intronic
1190270302 X:48858002-48858024 AGGTGGTCCTCCAGTGGACCAGG + Intergenic
1191568822 X:62579519-62579541 TTTGGGGCCTGCAGTGGAAAAGG + Intergenic
1195272844 X:103250440-103250462 AGCTGGGCCTGCAGTGCATGTGG + Intergenic
1195311257 X:103633863-103633885 AGCTGGGCCTGCAGTGCATGAGG - Intergenic
1195314701 X:103666174-103666196 AGCTGGGCCTGCAGTGCATGGGG - Intergenic
1198161513 X:134013048-134013070 AGGTCAGCCTGCAGTGGCACAGG + Intergenic
1201260046 Y:12149985-12150007 AGGTGGGCCTCCAGTTGACCAGG - Intergenic