ID: 948983880

View in Genome Browser
Species Human (GRCh38)
Location 2:241508489-241508511
Sequence GCTGCGGGTGGGAGCCTTCG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 137}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948983880_948983899 27 Left 948983880 2:241508489-241508511 CCGCGAAGGCTCCCACCCGCAGC 0: 1
1: 0
2: 0
3: 4
4: 137
Right 948983899 2:241508539-241508561 CCCAGCCCGCGAAGCAACGGTGG 0: 1
1: 0
2: 0
3: 1
4: 53
948983880_948983901 30 Left 948983880 2:241508489-241508511 CCGCGAAGGCTCCCACCCGCAGC 0: 1
1: 0
2: 0
3: 4
4: 137
Right 948983901 2:241508542-241508564 AGCCCGCGAAGCAACGGTGGTGG 0: 1
1: 0
2: 0
3: 3
4: 65
948983880_948983897 24 Left 948983880 2:241508489-241508511 CCGCGAAGGCTCCCACCCGCAGC 0: 1
1: 0
2: 0
3: 4
4: 137
Right 948983897 2:241508536-241508558 CCTCCCAGCCCGCGAAGCAACGG 0: 1
1: 0
2: 1
3: 6
4: 104
948983880_948983887 -7 Left 948983880 2:241508489-241508511 CCGCGAAGGCTCCCACCCGCAGC 0: 1
1: 0
2: 0
3: 4
4: 137
Right 948983887 2:241508505-241508527 CCGCAGCCTCTGTTCGCCCGGGG 0: 1
1: 0
2: 0
3: 6
4: 97
948983880_948983889 0 Left 948983880 2:241508489-241508511 CCGCGAAGGCTCCCACCCGCAGC 0: 1
1: 0
2: 0
3: 4
4: 137
Right 948983889 2:241508512-241508534 CTCTGTTCGCCCGGGGACCCCGG 0: 1
1: 0
2: 1
3: 7
4: 114
948983880_948983883 -9 Left 948983880 2:241508489-241508511 CCGCGAAGGCTCCCACCCGCAGC 0: 1
1: 0
2: 0
3: 4
4: 137
Right 948983883 2:241508503-241508525 ACCCGCAGCCTCTGTTCGCCCGG 0: 1
1: 0
2: 1
3: 10
4: 93
948983880_948983890 1 Left 948983880 2:241508489-241508511 CCGCGAAGGCTCCCACCCGCAGC 0: 1
1: 0
2: 0
3: 4
4: 137
Right 948983890 2:241508513-241508535 TCTGTTCGCCCGGGGACCCCGGG 0: 1
1: 0
2: 2
3: 7
4: 87
948983880_948983885 -8 Left 948983880 2:241508489-241508511 CCGCGAAGGCTCCCACCCGCAGC 0: 1
1: 0
2: 0
3: 4
4: 137
Right 948983885 2:241508504-241508526 CCCGCAGCCTCTGTTCGCCCGGG 0: 1
1: 0
2: 1
3: 16
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948983880 Original CRISPR GCTGCGGGTGGGAGCCTTCG CGG (reversed) Exonic
900685562 1:3945744-3945766 GCGGCGGGAGGGAGCCTCCTGGG - Intergenic
901814269 1:11785053-11785075 CCTGCGGGAGGGGGCCTTCCGGG - Intronic
905569233 1:38991073-38991095 GGTGGGGGTGGGGGCCTTCCCGG + Intergenic
907490751 1:54807394-54807416 GCTGAGGGTGGGAGCCACAGGGG + Intronic
910408527 1:86915078-86915100 GCTGGCGGTGGTGGCCTTCGCGG + Exonic
920358887 1:205398379-205398401 CCTGCTGGTGGCAGCCTTTGGGG + Intronic
923612256 1:235505252-235505274 GCCCCGGGTGGGAGCCCTCCTGG + Intergenic
924708372 1:246516270-246516292 GCTGGGGGCGGGGGCATTCGGGG - Intergenic
1066460386 10:35607966-35607988 CCTGCTGGAGGCAGCCTTCGGGG + Exonic
1067722878 10:48743057-48743079 GCTCCTGGAGGGAGCCTTCCAGG - Exonic
1067800991 10:49359683-49359705 ACTGCGGGTGGCAGCCTGAGTGG - Intergenic
1072349856 10:94545974-94545996 GGCGCGGGTGGCAGCCTGCGGGG + Intronic
1074211445 10:111339172-111339194 GCTGGGGCTTGGAGCCTTAGAGG + Intergenic
1074469621 10:113715289-113715311 CCACCGGGTGGGAGCCATCGTGG + Intronic
1075444969 10:122506729-122506751 GCTGCGGCCGGGAGAGTTCGTGG + Exonic
1076669518 10:132111894-132111916 GCTGAGGGTGGCAGCCGTGGAGG + Intronic
1077283706 11:1756741-1756763 GCTGCAGGTGGGGGCCCTGGGGG + Intronic
1077867327 11:6234192-6234214 GGCGCAGGTGGGAGCCTGCGGGG - Intronic
1078099096 11:8319122-8319144 CCTGCGGGTGTGAGGTTTCGTGG - Intergenic
1079689601 11:23404364-23404386 GCTGCAGGTGGGAGCCCGTGTGG - Intergenic
1087808929 11:102589236-102589258 GGTGCGGGTGGGTGGCTTCCAGG - Intronic
1104842777 12:131832584-131832606 GCAGTGGGTGGGAGCCTCCTGGG + Intronic
1104952482 12:132447857-132447879 GCTGCGGAAGGGCGCCCTCGAGG - Intergenic
1104980405 12:132570900-132570922 GCCGAGGGAGGAAGCCTTCGCGG - Intronic
1106603848 13:31209482-31209504 GCTGGGGGAGGAAGCCTTTGGGG - Intronic
1107738674 13:43425262-43425284 GATGGGGGTGGGAGCCTCCATGG - Intronic
1108313133 13:49215182-49215204 GCTGCAGGTGGCAGTCTTTGGGG + Intergenic
1109765219 13:66886507-66886529 GCTGTGGATGGCAGCTTTCGTGG - Intronic
1113358340 13:109604505-109604527 GCTGGAGGTGAGAGCCTTGGAGG + Intergenic
1114092561 14:19302536-19302558 GCTTCGGGTGGGAGCCGGCCCGG + Intergenic
1122922117 14:104884560-104884582 GCGGCGAGTGAGAGCCCTCGTGG + Intronic
1122940631 14:104979472-104979494 GCAGAGGGTGGGAGCCTCCCTGG + Intergenic
1128181627 15:65610443-65610465 GGTGGGGGTGGGAGACTTGGGGG - Intronic
1128757109 15:70190558-70190580 GCTGCTGTTTGGAGCCATCGAGG - Intergenic
1132554119 16:565170-565192 GCTGCGAGGGGGAGCCCTGGGGG - Exonic
1133138064 16:3725895-3725917 GCTGGGGGTGGTAGACTTAGGGG + Exonic
1133200971 16:4204345-4204367 CCTGAAGGTGGGAGGCTTCGTGG - Intronic
1133581621 16:7149827-7149849 GCTCCGACTGGGAGCCTTTGGGG - Intronic
1136554825 16:31001498-31001520 GCTGGGGCTGGGGGCCTTGGAGG + Intronic
1139951761 16:70675884-70675906 GCTGAGGGTGTGAGCCATAGAGG - Intronic
1141957528 16:87383054-87383076 GCTGGGGCTGGGATCCCTCGAGG - Intronic
1142661956 17:1436763-1436785 GCTGTGGGTGGGAACCCTCCTGG + Exonic
1143213994 17:5210384-5210406 GCTGGGGATGGGAGCCTGGGAGG + Exonic
1147643958 17:42022654-42022676 GCTTCTGGTGGGAGCCTCAGTGG + Intronic
1148157082 17:45430741-45430763 TCTGCGGGCGGGAGGCTTCCAGG - Intronic
1148895356 17:50836195-50836217 GACGGGGGTGGGAGCCGTCGGGG + Intronic
1150699227 17:67433311-67433333 GCTGCGGGAGCGAGCCTGGGCGG + Intronic
1151492410 17:74440430-74440452 GCTGCTGCTGGGTGCCTTCCTGG + Exonic
1151537773 17:74748557-74748579 GCTGAGGGTGGGGACCTCCGCGG - Intergenic
1151749330 17:76027699-76027721 GCTGTGGGTGGGGGCCTGCCTGG - Intergenic
1157590403 18:48833276-48833298 GCTGCAGGCGGGAGGCCTCGTGG + Intronic
1158900533 18:61957893-61957915 GCTGCACGTGGGAGCCCTGGAGG + Intergenic
1160686395 19:438868-438890 GCTGTGGGTGGGGGCTGTCGAGG + Intronic
1160975173 19:1789505-1789527 GCTGCAGGAGCGCGCCTTCGTGG - Exonic
1161074095 19:2276564-2276586 GGTGTGCGTGGGAGGCTTCGGGG - Intronic
1161100959 19:2421752-2421774 ACAGTGGGTGGGAGCCATCGAGG - Intronic
1161236739 19:3201950-3201972 GCTGGGGGTGGGGGCCGTCCTGG + Intronic
1161412509 19:4124188-4124210 GCTGGGGGTGGGGTCCATCGCGG - Intergenic
1162345134 19:10114342-10114364 GCTGCGTGTGGCAGCGTTGGTGG + Exonic
1162944008 19:14031628-14031650 TCTGGGGGTGGGGGCCTCCGAGG - Intergenic
1163091229 19:15021717-15021739 GTTCGGGGTGAGAGCCTTCGGGG + Intronic
1163513121 19:17747854-17747876 GGTGCGCGTGGGAGGCTGCGCGG - Intronic
1163557603 19:18001428-18001450 GCTGCGGGTGCGAGCGCTCGAGG + Intronic
1163827211 19:19530365-19530387 GGTGGGGGTGGGAGGCTGCGTGG - Intronic
1165108378 19:33487495-33487517 GCAGCGGGTGAGAACCCTCGTGG - Intronic
1165502677 19:36202592-36202614 GGAGCAGGTGGGAGCCTTCTAGG - Intronic
1168139309 19:54374684-54374706 TCTGGGGCTGGGAGCCTTCTGGG - Intergenic
1168158708 19:54493557-54493579 TCTGGGGCTGGGAGCCTTCTGGG + Intergenic
925342472 2:3147020-3147042 GCAGCGGGCAGGAGCCTCCGAGG - Intergenic
926215058 2:10901224-10901246 GCTGCGGGTAGGACCCCTCTGGG - Intergenic
926334073 2:11850155-11850177 GCTGCCGAAGGGAGCCTTCCAGG - Intergenic
928363907 2:30687262-30687284 GCTGCTGGTGAGAGCCCTCTGGG + Intergenic
928620632 2:33084396-33084418 GCTGCTGGTGGGAGGCGTCCTGG + Intronic
930755318 2:54967231-54967253 GGTGAGGGTGGGAGGCTTCTTGG + Intronic
931868333 2:66434436-66434458 GCTGGGGCTGGGAGCCGCCGGGG + Intronic
938971904 2:136440273-136440295 GCTGTGGGTGGGAAGCTTTGAGG + Intergenic
940259695 2:151766911-151766933 GCTTAGGGTGTGTGCCTTCGAGG + Intergenic
942089803 2:172478797-172478819 GTTGTGGGTGGGAGACTCCGAGG + Intronic
943699535 2:190974720-190974742 TCTGCGGGAGGGAGCCCTGGCGG - Intronic
944487367 2:200221063-200221085 GCTGCAAGTGGTAGCCTTTGGGG - Intergenic
948468294 2:238162539-238162561 GCTGGAGGTGGGGGCCCTCGGGG - Intronic
948735161 2:239998954-239998976 GCTGTGGGTTGGAGCCTTGGGGG - Intronic
948983880 2:241508489-241508511 GCTGCGGGTGGGAGCCTTCGCGG - Exonic
1168925264 20:1574135-1574157 GCTGAGGGAGGGAGGCTTCTGGG + Intronic
1168929142 20:1607163-1607185 GCTGAGGGAGGGAGGCTTCTGGG + Intronic
1169221418 20:3825372-3825394 GCTGCGTGTCTGAGCTTTCGTGG + Exonic
1170573934 20:17648513-17648535 GCTGCGGATGTGACCGTTCGTGG - Intronic
1172164687 20:32892009-32892031 GCTGCAGTTGGAAGCCTTTGGGG + Intronic
1173075635 20:39816786-39816808 GGAGCAGGTGGGAGCCTTCTTGG - Intergenic
1173615642 20:44401303-44401325 GCGGAGGGCGGGGGCCTTCGGGG + Exonic
1174657443 20:52183335-52183357 CCTGCGTGTGGGAGGCTTCCAGG - Intronic
1175666810 20:60868396-60868418 GCTGCAGGAGTGAGCCTTGGGGG + Intergenic
1179983245 21:44907272-44907294 GCTGTGGCCGGGAGCCTTCAGGG - Intronic
1180488168 22:15820030-15820052 GCTTCGGGTGGGAGCCGGCCCGG - Intergenic
1181041839 22:20196010-20196032 GCTGCCTCTGGGAGCCTTCCTGG - Intergenic
1183683556 22:39349374-39349396 GCTGGGGGTGGGAGGGTGCGCGG + Intergenic
1183745892 22:39691443-39691465 GCTGGGGGTGGGGGTCTTCCTGG + Intergenic
1185410097 22:50677327-50677349 GCTGCGGGTGGAAGCCCCTGGGG - Intergenic
954218490 3:49137907-49137929 ACTGTGGGTGGGAGCCATGGGGG - Intergenic
956472850 3:69586423-69586445 GCTGAGAGTGGGAGCCTTATGGG + Intergenic
964826812 3:160837702-160837724 GCCTCGGGTGGGACCCTTGGAGG + Intronic
968613893 4:1568795-1568817 GCTGCGGGTCGGAGGCGGCGCGG - Intergenic
968830552 4:2931271-2931293 GCGGCTGGTGGGAGACATCGAGG + Exonic
969436645 4:7192766-7192788 GCTGCTGCTGGGCGCCTGCGGGG + Exonic
969486076 4:7473241-7473263 GCTGCAGCCGGGAGCCTGCGGGG + Intronic
971018976 4:22515785-22515807 GCTGCGGGCCGGGGCCTGCGGGG + Exonic
972474335 4:39436251-39436273 GCTGCTGGAGAGAGCCTTCAGGG + Intronic
977749588 4:100593198-100593220 GCTGAGGCTGGGAACCTTGGTGG - Intronic
985651310 5:1109033-1109055 GCTGAGGGTGGGAGACCTGGGGG + Intronic
986256183 5:6102808-6102830 GCTGGGAGTGTGAGCCTTGGGGG + Intergenic
988605222 5:32673445-32673467 GGTGCGGGTGGGAGCCGGGGCGG - Intergenic
989010350 5:36864595-36864617 GCTGAGGGTGGGAGCATGGGTGG - Intergenic
992778752 5:80109840-80109862 GCTGGGGGAGGGAGCCTGGGAGG - Intergenic
1002784834 6:392854-392876 CAGGCGGGTAGGAGCCTTCGCGG + Intronic
1004506356 6:16249969-16249991 GGTGTGGGTGGGAGCCTGGGTGG + Intronic
1005954292 6:30652840-30652862 GCTGCTAGTGGGAGCCCTGGTGG + Exonic
1007584234 6:42978976-42978998 GCTGCTGGTGGCAGCCCTGGAGG - Exonic
1012902964 6:105029118-105029140 GGTGGGGGTGAAAGCCTTCGTGG + Intronic
1018975088 6:168558448-168558470 GCTGCTGCTGGGAGCCTCCCTGG + Intronic
1019414698 7:921936-921958 TGTGCGGGTGTGAGCCTTGGGGG - Intronic
1019748739 7:2715452-2715474 GCTGAGGGTGGGAGCCCACTGGG + Exonic
1026451585 7:70534029-70534051 GCAGGGGCTGGGAGCCTTCTGGG + Intronic
1030262455 7:107580168-107580190 CCCGCGGGCGGGAGCCTGCGGGG + Intronic
1035314470 7:157989614-157989636 GAGGGGGGTGGGTGCCTTCGTGG + Intronic
1035467915 7:159091738-159091760 GCTGCGGCTGGGAGCCTGCCTGG + Intronic
1043383056 8:79723308-79723330 GCTGCAGGTGGGAGATTGCGTGG + Intergenic
1044304994 8:90628742-90628764 ACTTCGGGTTGGAGCCTTTGAGG - Intronic
1049575782 8:143389028-143389050 GCTTTGGGTGGGAGCCCTTGCGG + Intergenic
1053198773 9:36138827-36138849 GCTCCGCGTGGGAGCCGACGAGG + Intronic
1060109190 9:120894514-120894536 GAGGCGGGTGGGAGGCGTCGTGG - Intronic
1061853702 9:133429953-133429975 GCTGCGTGTGGGACCCGCCGCGG + Exonic
1061968652 9:134031269-134031291 GCTGCCTGTGTGAGCCGTCGGGG - Exonic
1062303667 9:135889881-135889903 GCTACGGGTGGGAGCTTACGGGG - Intronic
1062507821 9:136886950-136886972 GCTGAGGGTGCGGGGCTTCGGGG - Intronic
1062606428 9:137350728-137350750 GCTGCGGGAGGGAGCCCCTGGGG - Intronic
1062645164 9:137544088-137544110 GGAGCGGGTGTCAGCCTTCGGGG - Intronic
1203794298 EBV:168253-168275 GGTGCGGGAGGGAGTCATCGTGG + Intergenic
1187392327 X:18894305-18894327 GCTGCTGGTGGAAGCCATCATGG - Exonic
1192885020 X:75327857-75327879 GGTGCAGGTGGGAGCCCCCGAGG - Intergenic
1195197739 X:102516360-102516382 GCTGCAGGTCGGAGGCTTAGAGG - Intronic
1195347297 X:103963024-103963046 GCTGCAGGTCAGAGGCTTCGAGG + Exonic
1195360145 X:104075817-104075839 GCTGCAGGTCAGAGGCTTCGAGG - Intergenic