ID: 948988651

View in Genome Browser
Species Human (GRCh38)
Location 2:241541077-241541099
Sequence CAAGCAGGGCGGGCGCGGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948988651_948988662 18 Left 948988651 2:241541077-241541099 CCGCTCCGCGCCCGCCCTGCTTG No data
Right 948988662 2:241541118-241541140 ACCGCTCGCTCGCGACGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948988651 Original CRISPR CAAGCAGGGCGGGCGCGGAG CGG (reversed) Intergenic
No off target data available for this crispr