ID: 948988662

View in Genome Browser
Species Human (GRCh38)
Location 2:241541118-241541140
Sequence ACCGCTCGCTCGCGACGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948988653_948988662 8 Left 948988653 2:241541087-241541109 CCCGCCCTGCTTGCACCCAGCCG No data
Right 948988662 2:241541118-241541140 ACCGCTCGCTCGCGACGCCAAGG No data
948988656_948988662 4 Left 948988656 2:241541091-241541113 CCCTGCTTGCACCCAGCCGGCAA No data
Right 948988662 2:241541118-241541140 ACCGCTCGCTCGCGACGCCAAGG No data
948988658_948988662 -7 Left 948988658 2:241541102-241541124 CCCAGCCGGCAAGTCCACCGCTC No data
Right 948988662 2:241541118-241541140 ACCGCTCGCTCGCGACGCCAAGG No data
948988648_948988662 29 Left 948988648 2:241541066-241541088 CCAGATGAGCCCCGCTCCGCGCC No data
Right 948988662 2:241541118-241541140 ACCGCTCGCTCGCGACGCCAAGG No data
948988659_948988662 -8 Left 948988659 2:241541103-241541125 CCAGCCGGCAAGTCCACCGCTCG No data
Right 948988662 2:241541118-241541140 ACCGCTCGCTCGCGACGCCAAGG No data
948988651_948988662 18 Left 948988651 2:241541077-241541099 CCGCTCCGCGCCCGCCCTGCTTG No data
Right 948988662 2:241541118-241541140 ACCGCTCGCTCGCGACGCCAAGG No data
948988654_948988662 7 Left 948988654 2:241541088-241541110 CCGCCCTGCTTGCACCCAGCCGG No data
Right 948988662 2:241541118-241541140 ACCGCTCGCTCGCGACGCCAAGG No data
948988657_948988662 3 Left 948988657 2:241541092-241541114 CCTGCTTGCACCCAGCCGGCAAG No data
Right 948988662 2:241541118-241541140 ACCGCTCGCTCGCGACGCCAAGG No data
948988647_948988662 30 Left 948988647 2:241541065-241541087 CCCAGATGAGCCCCGCTCCGCGC No data
Right 948988662 2:241541118-241541140 ACCGCTCGCTCGCGACGCCAAGG No data
948988652_948988662 13 Left 948988652 2:241541082-241541104 CCGCGCCCGCCCTGCTTGCACCC No data
Right 948988662 2:241541118-241541140 ACCGCTCGCTCGCGACGCCAAGG No data
948988650_948988662 19 Left 948988650 2:241541076-241541098 CCCGCTCCGCGCCCGCCCTGCTT No data
Right 948988662 2:241541118-241541140 ACCGCTCGCTCGCGACGCCAAGG No data
948988649_948988662 20 Left 948988649 2:241541075-241541097 CCCCGCTCCGCGCCCGCCCTGCT No data
Right 948988662 2:241541118-241541140 ACCGCTCGCTCGCGACGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948988662 Original CRISPR ACCGCTCGCTCGCGACGCCA AGG Intergenic
No off target data available for this crispr