ID: 948988930

View in Genome Browser
Species Human (GRCh38)
Location 2:241542007-241542029
Sequence GTAAGCGCGGCCGCTGCGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948988920_948988930 7 Left 948988920 2:241541977-241541999 CCCCCTCTGCAGAGCAGGCTTGG No data
Right 948988930 2:241542007-241542029 GTAAGCGCGGCCGCTGCGGAGGG No data
948988917_948988930 16 Left 948988917 2:241541968-241541990 CCTCCGTTTCCCCCTCTGCAGAG No data
Right 948988930 2:241542007-241542029 GTAAGCGCGGCCGCTGCGGAGGG No data
948988923_948988930 5 Left 948988923 2:241541979-241542001 CCCTCTGCAGAGCAGGCTTGGCC No data
Right 948988930 2:241542007-241542029 GTAAGCGCGGCCGCTGCGGAGGG No data
948988922_948988930 6 Left 948988922 2:241541978-241542000 CCCCTCTGCAGAGCAGGCTTGGC No data
Right 948988930 2:241542007-241542029 GTAAGCGCGGCCGCTGCGGAGGG No data
948988924_948988930 4 Left 948988924 2:241541980-241542002 CCTCTGCAGAGCAGGCTTGGCCG No data
Right 948988930 2:241542007-241542029 GTAAGCGCGGCCGCTGCGGAGGG No data
948988916_948988930 22 Left 948988916 2:241541962-241541984 CCGGAGCCTCCGTTTCCCCCTCT No data
Right 948988930 2:241542007-241542029 GTAAGCGCGGCCGCTGCGGAGGG No data
948988914_948988930 30 Left 948988914 2:241541954-241541976 CCCGCTGGCCGGAGCCTCCGTTT No data
Right 948988930 2:241542007-241542029 GTAAGCGCGGCCGCTGCGGAGGG No data
948988915_948988930 29 Left 948988915 2:241541955-241541977 CCGCTGGCCGGAGCCTCCGTTTC No data
Right 948988930 2:241542007-241542029 GTAAGCGCGGCCGCTGCGGAGGG No data
948988918_948988930 13 Left 948988918 2:241541971-241541993 CCGTTTCCCCCTCTGCAGAGCAG No data
Right 948988930 2:241542007-241542029 GTAAGCGCGGCCGCTGCGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948988930 Original CRISPR GTAAGCGCGGCCGCTGCGGA GGG Intergenic
No off target data available for this crispr