ID: 948991796

View in Genome Browser
Species Human (GRCh38)
Location 2:241559244-241559266
Sequence TCCCCGAGGCTGCCAGGGAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 252}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948991796_948991805 21 Left 948991796 2:241559244-241559266 CCGGTCCCTGGCAGCCTCGGGGA 0: 1
1: 0
2: 2
3: 27
4: 252
Right 948991805 2:241559288-241559310 CTCTGAAAGAAGGTGGCGCTGGG 0: 1
1: 1
2: 1
3: 15
4: 186
948991796_948991803 14 Left 948991796 2:241559244-241559266 CCGGTCCCTGGCAGCCTCGGGGA 0: 1
1: 0
2: 2
3: 27
4: 252
Right 948991803 2:241559281-241559303 ATTCGGGCTCTGAAAGAAGGTGG 0: 1
1: 0
2: 0
3: 10
4: 88
948991796_948991801 -2 Left 948991796 2:241559244-241559266 CCGGTCCCTGGCAGCCTCGGGGA 0: 1
1: 0
2: 2
3: 27
4: 252
Right 948991801 2:241559265-241559287 GAATGTCTGTAGCTGAATTCGGG 0: 1
1: 0
2: 1
3: 13
4: 136
948991796_948991804 20 Left 948991796 2:241559244-241559266 CCGGTCCCTGGCAGCCTCGGGGA 0: 1
1: 0
2: 2
3: 27
4: 252
Right 948991804 2:241559287-241559309 GCTCTGAAAGAAGGTGGCGCTGG 0: 1
1: 0
2: 2
3: 6
4: 175
948991796_948991802 11 Left 948991796 2:241559244-241559266 CCGGTCCCTGGCAGCCTCGGGGA 0: 1
1: 0
2: 2
3: 27
4: 252
Right 948991802 2:241559278-241559300 TGAATTCGGGCTCTGAAAGAAGG 0: 1
1: 0
2: 1
3: 4
4: 99
948991796_948991800 -3 Left 948991796 2:241559244-241559266 CCGGTCCCTGGCAGCCTCGGGGA 0: 1
1: 0
2: 2
3: 27
4: 252
Right 948991800 2:241559264-241559286 GGAATGTCTGTAGCTGAATTCGG 0: 1
1: 0
2: 1
3: 11
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948991796 Original CRISPR TCCCCGAGGCTGCCAGGGAC CGG (reversed) Intronic
900527371 1:3135819-3135841 TCCCCGTGGCTCCCTGGGCCGGG + Intronic
902583769 1:17425767-17425789 TTCCCGAGGGTACCAGGGACAGG + Intronic
902698943 1:18158528-18158550 TCCCCGACGCTGCCCTGGTCAGG - Intronic
902715592 1:18270449-18270471 TGCCCGAGGCTGCCCTGGAGAGG - Intronic
903285792 1:22275904-22275926 GCCCCGGGGCTGCCAGGGAGAGG + Intergenic
903926082 1:26831711-26831733 TCTCTGAGGCAGCCAGGGTCAGG + Intronic
904461874 1:30685426-30685448 TCCCAGGGACTGTCAGGGACTGG - Intergenic
904990767 1:34590780-34590802 TTCTGGAGGCTGCCAGGGTCTGG - Intergenic
905457793 1:38100488-38100510 CCCAGGAGGCTGCCAGGGACAGG - Intergenic
906567668 1:46812438-46812460 AGCCCCAGGCTGCCAGGGCCTGG + Intronic
910391905 1:86754620-86754642 ACCCCAAGACTGCCAGGCACAGG + Intergenic
913594156 1:120357270-120357292 TCCCAGAGGCTGCCCCGCACAGG - Intergenic
914093103 1:144521726-144521748 TCCCAGAGGCTGCCCTGCACAGG + Intergenic
914305423 1:146412158-146412180 TCCCAGAGGCTGCCCTGCACAGG - Intergenic
914596636 1:149160645-149160667 TCCCAGAGGCTGCCCTGCACAGG + Intergenic
916057456 1:161077669-161077691 TGCAGGAGGCTGCCAGGGTCAGG + Exonic
920109947 1:203580794-203580816 TCCCCGACACAGCCAGGCACAGG + Intergenic
920160780 1:203996341-203996363 TCCTTGAGGCTGACAGGGAGGGG + Intergenic
920345232 1:205301958-205301980 TCCCCTAGGCTGCCAGGGATGGG - Intergenic
921833341 1:219752409-219752431 TACCAGAGGCTGACATGGACTGG + Intronic
922183772 1:223256626-223256648 TTCCAGAGCCAGCCAGGGACAGG + Intronic
922472042 1:225882645-225882667 TCCCGGAGGCGTCCAGAGACTGG - Intergenic
923012196 1:230096643-230096665 GCCCCCAGGCTGCCAAGGATGGG - Intronic
923148091 1:231211567-231211589 CCCCCGAGGGTGCCCGGGGCGGG - Intronic
923354984 1:233145646-233145668 TACCGGAGGCTGCCAGGGGCAGG + Intronic
1063008469 10:1997492-1997514 TCCCCCAGGATGCCAGTGGCAGG - Intergenic
1063112057 10:3046259-3046281 TCCCGGGGGCTCCCAGGGGCAGG + Intergenic
1063592644 10:7408554-7408576 TCCCCGGGGCTGGCGGGGGCAGG - Intronic
1064390248 10:14935946-14935968 TCCCCCAGGCTGCAAGGCAGTGG + Intronic
1064430486 10:15266373-15266395 GCCCCTCGGCTGCCAGGGGCAGG + Intronic
1065095007 10:22271858-22271880 TCCTTGAGGCAGCCAGAGACGGG + Intergenic
1065937026 10:30529686-30529708 TCTCGGAGGCTGCCAGTGGCTGG + Intergenic
1067282858 10:44886030-44886052 CCCCCAAGCCTGGCAGGGACAGG + Intergenic
1068561016 10:58513706-58513728 AACTCGAGGCTGCCAGGGAATGG - Intronic
1069779361 10:70945117-70945139 TCACGGAGACTGTCAGGGACAGG - Intergenic
1070290270 10:75109225-75109247 TCCCAGAGATTGACAGGGACAGG + Intronic
1070692800 10:78540184-78540206 TGCCAGAGGCTGCCAGTGAATGG + Intergenic
1070715610 10:78718883-78718905 TCCCCGAGGTTGGCGGAGACAGG - Intergenic
1071569915 10:86691192-86691214 TCCCTTAGGCTCCCAGGGTCTGG - Intronic
1073480247 10:103782004-103782026 TCCCAGAGGCTGCCCAGGAATGG - Intronic
1076421953 10:130338202-130338224 GCTCCCAGGCTGCCGGGGACTGG + Intergenic
1077297686 11:1833769-1833791 TCTCCCAGCCTGCCAGGGAGTGG + Intronic
1077909000 11:6558166-6558188 TGCCTGAGGTTGCCAGGGCCAGG - Exonic
1078108344 11:8372672-8372694 TTCCCAAGGCTGACTGGGACAGG + Intergenic
1078132254 11:8622528-8622550 TCCCAGTGGCTGACAGGGCCTGG - Intronic
1078189024 11:9076200-9076222 TCCCGGACCCTGCCAGGGGCAGG + Intronic
1078246111 11:9574174-9574196 TCGCCGGGGCTGCCGGGGGCCGG - Exonic
1078491443 11:11772880-11772902 TCTCAGAAGCAGCCAGGGACAGG + Intergenic
1078606918 11:12785138-12785160 TCCCCACGGCTCCCAGGCACAGG - Intronic
1078986433 11:16603962-16603984 TCCCCGAGGCCCGCAGGCACGGG - Intronic
1079175146 11:18133253-18133275 TCCCCTAGGCTGAAACGGACAGG + Intronic
1079176721 11:18148815-18148837 TCCCCTAGGCTTACAGGGACAGG + Intronic
1079178708 11:18169318-18169340 TCCCCTAGGCTGAAAGGCACAGG + Intronic
1079236688 11:18696162-18696184 TCCCCCAGGCTGCCATGCAGTGG - Intronic
1079246364 11:18755189-18755211 GCCCAGAGGCTGCAAGGAACTGG + Intronic
1079268699 11:18960938-18960960 TCCCCTAGGCTGAAAGGGACAGG - Intergenic
1079270125 11:18976607-18976629 TCCCCTAGACTGAAAGGGACAGG - Intergenic
1081640667 11:44751283-44751305 TCTGCCAGGCTGCCAGGGTCAGG - Intronic
1081963078 11:47152514-47152536 TCCGCGAGGCTGCGAGGCAGGGG + Intronic
1082086851 11:48057512-48057534 TACCCAAGGCTGCCCGTGACTGG - Intronic
1083233097 11:61335543-61335565 TCTCAGAGCCTACCAGGGACTGG - Intronic
1083485692 11:62981781-62981803 GCCCAGAGGCTGCAAGGGACAGG - Intronic
1083815085 11:65128184-65128206 TCCCCATGGCTGCCTGGGACTGG + Exonic
1084410712 11:69004600-69004622 TCCCGGAGGCAGCCTAGGACTGG + Exonic
1085256250 11:75175252-75175274 TCCCTGAGGCTGCCTTGGCCGGG + Intronic
1085512598 11:77095872-77095894 TCTGGGAGGCTGCCAGGGCCAGG + Intronic
1085533061 11:77203007-77203029 TCCCCGGGGCTGCCAGCGATGGG + Intronic
1085810072 11:79671972-79671994 TGCCCGAGGCTGCCACTGTCAGG + Intergenic
1086899612 11:92352200-92352222 TCCCAGGGGCTGCCAGGGACTGG + Intronic
1087169639 11:95037798-95037820 ACGCCGAGGCCGCCATGGACGGG + Intergenic
1087172775 11:95067435-95067457 ACGCCGAGGCCGCCATGGACGGG + Exonic
1089649218 11:119901554-119901576 TTGCCTAGGCTGCCAGGAACTGG - Intergenic
1090333543 11:125948407-125948429 TGCCCGATGCTGCCAGGCAAAGG - Intergenic
1091974219 12:4811543-4811565 TCCCCGAGGCTAACCGGGAACGG + Exonic
1092217611 12:6694101-6694123 CCACCTAGGCTGCCAGGGACCGG - Exonic
1095949943 12:47776408-47776430 TCCCCAAGTGTGCCAGGGAAGGG + Intronic
1096557454 12:52412056-52412078 TCCCCGAGGCTCTCAGGGAAGGG - Intergenic
1097263605 12:57733509-57733531 TCCCAGACTCTGCCAGGGCCAGG - Intronic
1100386466 12:94109007-94109029 TCCCTGAGGCTGCCTGGGTGTGG - Intergenic
1102497710 12:113330842-113330864 GCCCTGTAGCTGCCAGGGACTGG - Intronic
1103779658 12:123389871-123389893 TCCCCGAGGCGGCGAGGGCCCGG + Intronic
1103903726 12:124316640-124316662 CCCCAGAGGCTGCTGGGGACAGG + Intergenic
1104850625 12:131871887-131871909 GCCCCGCGGCTGCCAGGTGCAGG + Intergenic
1104918396 12:132278131-132278153 TCCCCGAGGCCCCCGGGGGCTGG + Intronic
1104953178 12:132451486-132451508 TCCCCGAAGCCTCCAGGGTCAGG - Intergenic
1106758127 13:32842590-32842612 TCTCAGAGGCTGCCAGCCACAGG - Intergenic
1111772929 13:92622189-92622211 ACCCAGAGCCTGGCAGGGACAGG - Intronic
1113739282 13:112700333-112700355 TCCGGGAGGCAGCCTGGGACAGG + Intronic
1113794016 13:113046334-113046356 TCCCAGAGCCTGGGAGGGACGGG - Intronic
1118370729 14:65135324-65135346 ACCCTGAGGCTGCCAGGTCCAGG - Intergenic
1118719832 14:68586139-68586161 TCTCCGAGGCTGGCACGGAGAGG + Intronic
1120874977 14:89367523-89367545 TGCCCGAGGTTGCCAGGGAGAGG + Intronic
1121539104 14:94711726-94711748 TCTCCAAGGCTGCCTGGGACAGG + Intergenic
1122640153 14:103155240-103155262 GCCTCCAGGCTGCCAGGGCCCGG - Intergenic
1122856552 14:104562995-104563017 TCCCTCTGGCTGCCAGGGAGTGG - Intronic
1122920956 14:104879928-104879950 TCCCCCAGCCTGCAAGGGGCAGG + Intronic
1122979343 14:105184652-105184674 TCACCGTGGCTGCCTGGGGCCGG + Intergenic
1123630073 15:22255052-22255074 TACCAGAGGCTGCAAGAGACAGG - Intergenic
1124385866 15:29207806-29207828 TCCCCAGGCCTGGCAGGGACTGG - Intronic
1124645247 15:31433821-31433843 TGGCCTCGGCTGCCAGGGACTGG - Intronic
1124955303 15:34356357-34356379 TCAGGAAGGCTGCCAGGGACTGG + Exonic
1127994183 15:64143091-64143113 CCCCCTAGGCTGCCAAGTACTGG - Intronic
1128187578 15:65656103-65656125 TCCCCGAGGCTAACGGGAACGGG - Exonic
1129928336 15:79385653-79385675 TCTTCGAGGTTGCCAGGAACAGG - Intronic
1130106542 15:80932655-80932677 TCCCTCAGCCTGCCAGGAACTGG - Intronic
1130642402 15:85690759-85690781 TGCACTATGCTGCCAGGGACTGG - Intronic
1130678253 15:85973535-85973557 TCCCTGGGGCTGCCAGAAACTGG + Intergenic
1130685065 15:86030149-86030171 TCACCGAGGCTGCCAGGAGAAGG - Intergenic
1132799730 16:1746083-1746105 ACCCAGCGGCTGCCTGGGACAGG + Intronic
1133018693 16:2956416-2956438 ACCCCAAGGCTGGCAGGGCCCGG - Intergenic
1133023903 16:2979570-2979592 TCCCCGAGTGTGCCAGGGTTGGG - Intronic
1134113470 16:11530831-11530853 TACCCGAGTCTGCCTGGGAAGGG + Intergenic
1134485637 16:14656160-14656182 TCCCCTAGGCTGCCATGCAGCGG - Intronic
1134596552 16:15500403-15500425 ACCCATAGGCTGCCAGGGGCTGG + Intronic
1138586837 16:57976099-57976121 TCCCTGAGGGTTCCAGGGAGGGG + Intergenic
1139356631 16:66370858-66370880 TCCTCGAGGCTGGAAGGGGCAGG + Intronic
1139606633 16:68023383-68023405 TCCCCAAGGCTGGCCGGGTCTGG - Exonic
1140454763 16:75098575-75098597 TGGCCCAGTCTGCCAGGGACAGG - Intronic
1141647178 16:85373784-85373806 TCCCCGAGGCAGCCCAGGGCAGG + Intergenic
1141877780 16:86837953-86837975 CCCCTGAGGCTACCAGGAACTGG + Intergenic
1141973018 16:87495605-87495627 TACCAGAGGCTGCAAGAGACAGG + Intergenic
1142641033 17:1286109-1286131 TCCTTCAGGCTGCCAGGGACAGG - Intronic
1142749886 17:1980985-1981007 TCCAGGAAGCAGCCAGGGACAGG - Intronic
1143016306 17:3892856-3892878 GCCCCGAGCCTGCAAGGGAGAGG - Intronic
1145041308 17:19579973-19579995 TCCCCGCCGCCGCCAAGGACCGG + Intergenic
1145979318 17:29002514-29002536 ACCCAGAGACTGCCATGGACAGG - Intronic
1145981858 17:29017531-29017553 TCCTCTAGGCTCCCAGGGAAGGG + Intronic
1146009154 17:29180129-29180151 TCCACGGCGCCGCCAGGGACGGG + Intronic
1146370327 17:32262105-32262127 TCCCCCAGGAGGCCAGGGCCCGG + Intergenic
1147917844 17:43899329-43899351 TCCTTGAGCCTGCCAGGTACAGG - Intronic
1149772402 17:59331976-59331998 TCCCCGTGGGCGCCGGGGACGGG + Intronic
1150639834 17:66942140-66942162 TTCCTGAGGTTGACAGGGACGGG - Intergenic
1151627782 17:75288285-75288307 TCCCCGAGTTTTCCAGGAACTGG - Intronic
1155997307 18:32343832-32343854 TCTCCCAGGCTGCCAGGAGCGGG - Intronic
1160882967 19:1330734-1330756 TCCACGTGGCCGCCATGGACTGG + Intergenic
1161535895 19:4818257-4818279 ACGCCCAGGCTGCCAGGGGCAGG - Exonic
1161582539 19:5088628-5088650 CCCCTGAGGCTGCAGGGGACAGG + Intronic
1162042474 19:7979115-7979137 TCCCCGAGGCTCCCTGGGCCTGG - Intronic
1162917366 19:13881611-13881633 TCCCAGCGGCTCCCAGGGTCTGG + Intergenic
1163590770 19:18193101-18193123 TCCCCGAGGCTGCCTGCGATTGG + Intergenic
1163722270 19:18903942-18903964 GCCCCGTGGCGGGCAGGGACGGG + Intronic
1163885742 19:19963246-19963268 TGCCGGAGGCTGCCTGGGATGGG + Intergenic
1163935195 19:20436174-20436196 TGCCAGAGGCTGCCAGGAATGGG + Intergenic
1164577918 19:29416963-29416985 TCCCCGAGGCAGGAAGGCACTGG - Intergenic
1166706863 19:44912910-44912932 CCCCTGGGGCTGACAGGGACTGG + Intergenic
1166747338 19:45147605-45147627 CACCTGGGGCTGCCAGGGACAGG - Intronic
1167134955 19:47610271-47610293 TCCCCGCGGCCGCCCGTGACAGG - Intronic
1167386235 19:49165876-49165898 TCCCCGAGGCCGTCAGAGCCAGG + Intronic
1167443741 19:49525358-49525380 TCTCCGAGGCTGGGAGGGACTGG + Intronic
1168107629 19:54174136-54174158 GCCCCAGGGCTGCCAGGGCCAGG + Exonic
925103956 2:1273105-1273127 TCCCCGAGGCGGGCAGGCAGGGG - Intronic
926742592 2:16125145-16125167 TCCCTGGGGCTGCCAGGAGCTGG + Intergenic
927112116 2:19870917-19870939 TCCACGTTGCTGCAAGGGACAGG - Intergenic
927927558 2:27024380-27024402 TCCTCCAGGCTGGCAGGGCCGGG - Intronic
927967867 2:27282895-27282917 TCCAGGTGGGTGCCAGGGACGGG + Exonic
928007789 2:27579387-27579409 TCCCAGAGCCTGCCAGAGAAGGG + Exonic
928282801 2:29963913-29963935 TCCTGGAGCCTGCCAGGCACAGG + Intergenic
928311431 2:30213659-30213681 GCCACCAGGCTGCCAGGGAACGG - Intergenic
933864991 2:86508223-86508245 TCCTGCAGGCTGCCAGGCACAGG - Intronic
933977126 2:87520628-87520650 TCACCGAGGCTGCTAGGCCCAGG + Intergenic
935820146 2:106886399-106886421 TCCCGCAGGCCGCCTGGGACGGG - Exonic
936316691 2:111430177-111430199 TCACCGAGGCTGCTAGGCCCAGG - Intergenic
937569007 2:123333845-123333867 CCTCCGAGGCTACTAGGGACTGG + Intergenic
941203956 2:162548292-162548314 TCCCTAAGGCTGCCAGAGGCAGG + Intronic
944932231 2:204531399-204531421 TTCCCGGGGATGCTAGGGACAGG + Intergenic
945499809 2:210557925-210557947 TTCCTGTGGCTGCCAGGGATAGG + Intronic
947397904 2:229704640-229704662 GACCAGTGGCTGCCAGGGACTGG + Intronic
948179561 2:235968917-235968939 TCGCCCAGGCTGCCAGGGTGGGG - Intronic
948314326 2:237015595-237015617 TGCCCGAGGTCGCCAGGAACAGG + Intergenic
948663920 2:239523005-239523027 TCCCCGAAGGTGCCAGTGGCTGG - Intergenic
948991796 2:241559244-241559266 TCCCCGAGGCTGCCAGGGACCGG - Intronic
949043157 2:241858646-241858668 ACCCCTGGGCTGCCAGGGCCAGG + Intronic
1168991751 20:2102083-2102105 TCCCGGAGGCAGCCCGGGCCCGG + Exonic
1169299893 20:4432838-4432860 TCCCCAAGGATGGCAAGGACAGG + Intergenic
1169330352 20:4711282-4711304 TCCCCCAGGCTGCCAGGACATGG + Intergenic
1170968713 20:21099922-21099944 TCTCCGCGGCTGCCAGAGAGGGG - Intergenic
1171975797 20:31593908-31593930 CCTCCCAGGCTGCCAGGGTCAGG + Intergenic
1172508242 20:35479957-35479979 TCCCCTAACATGCCAGGGACAGG - Exonic
1176066818 20:63202116-63202138 CCCACGAGGCTGCCAGGACCTGG + Intronic
1176288722 21:5033278-5033300 TCCCCGAGGCTCCCAGCTCCAGG - Intronic
1176378830 21:6101639-6101661 TCCCGGAAGGGGCCAGGGACAGG - Intergenic
1179323101 21:40312215-40312237 ACCCCAAGGCTCCCAGGGATTGG + Exonic
1179494671 21:41764120-41764142 TTAGCGAGGCTCCCAGGGACAGG - Intronic
1179744644 21:43436598-43436620 TCCCGGAAGGGGCCAGGGACAGG + Intergenic
1180843911 22:18971301-18971323 TCACGAAGGCTGCCAGGGAGGGG - Intergenic
1181312523 22:21952870-21952892 CGCCCGCGGCGGCCAGGGACGGG - Intergenic
1181520658 22:23447761-23447783 CCCGCGAGGCTGCCGGAGACAGG + Intergenic
1181635419 22:24172152-24172174 CCACCGAGGCTGCCAGTGACTGG - Intronic
1182354336 22:29715594-29715616 GCCCAGAGGACGCCAGGGACAGG + Intergenic
1182470000 22:30542587-30542609 GGCCCGAGGCGGCCGGGGACCGG - Intronic
1183253466 22:36745914-36745936 TCCCAGAGGCTGCAAGAGAAGGG + Intergenic
1183280243 22:36928355-36928377 CCCCCGAGGCTGTCATGGAGGGG - Intronic
1184511468 22:44935864-44935886 TCCCCGAGGCGGGCAGAGACAGG - Intronic
1185066256 22:48633077-48633099 TCCCAGGGGCTCCCAGGGGCTGG + Intronic
1185322173 22:50206650-50206672 CTTCTGAGGCTGCCAGGGACAGG - Intronic
950447415 3:13046380-13046402 TCCCTGAGCCAGCTAGGGACTGG - Intronic
952507818 3:34023749-34023771 TCCTCGAGGCAGCCAGGCAGAGG + Intergenic
952941478 3:38448079-38448101 TCCACGATGCTGCCAATGACAGG - Intergenic
954271188 3:49510638-49510660 CCTCAGAGGCTGTCAGGGACTGG + Exonic
954627797 3:52032086-52032108 GCCCCCAGACTGCCATGGACCGG - Intergenic
956749932 3:72337177-72337199 TCTCCCAGGCTGCCTGGAACAGG + Intergenic
960938555 3:122918709-122918731 CCCCTCAGGCTGCCAGGGAAGGG - Intronic
961380910 3:126496041-126496063 TCCGGGAGGCCGCCAGGCACCGG - Exonic
961666559 3:128496605-128496627 TCCCGGAGGCTGCCCGAGAATGG + Intergenic
961692630 3:128681012-128681034 TCACCGCGTCTCCCAGGGACAGG - Intronic
963236637 3:142963264-142963286 CCCCCGAAGCTGCCGGGGCCGGG + Exonic
966778994 3:183567356-183567378 TAGCAGAGGGTGCCAGGGACGGG + Intergenic
968735170 4:2291511-2291533 TCCCTGATGCTGCCAGGAGCAGG + Intronic
970147979 4:13056963-13056985 TCACCAAGGCAGCCAGGGGCTGG - Intergenic
970193326 4:13534723-13534745 TCCCCGAAGCTTCGAGGGATCGG - Intergenic
972883439 4:43454950-43454972 TTCCAGAGGCTGGCAGGGAGAGG - Intergenic
976273630 4:83254169-83254191 GACCAGTGGCTGCCAGGGACTGG - Intergenic
978615583 4:110591824-110591846 TCCCAGTGGATCCCAGGGACTGG + Intergenic
979693378 4:123584305-123584327 TCCCAGAGGCAGCCAGGGCAGGG - Intergenic
980030217 4:127819652-127819674 TCCCTGTGGCTGGCAGGGAGAGG - Intronic
981936220 4:150242686-150242708 TCCCCAAAGCAGCCAGAGACAGG + Intronic
982099172 4:151951879-151951901 TCTCCGAGGGAGCCAGGGAGTGG - Intergenic
982181369 4:152751358-152751380 TCCCCTAGTCTGCCAGGGTCTGG - Intronic
983902298 4:173148161-173148183 TCACCGAGGCTGCCGGGCAGTGG - Intergenic
985675045 5:1226630-1226652 GCCCCGAGGGTGGCAGTGACGGG - Intronic
985676178 5:1232384-1232406 TGACTGAGGCTGCCAGGGACAGG + Intronic
986942838 5:12976563-12976585 TCCCTCCTGCTGCCAGGGACAGG - Intergenic
996800824 5:127400772-127400794 TCCCTTAGGCTGCTAGGGAGGGG - Intronic
996862780 5:128084133-128084155 GCCCCGCGGCGGCCGGGGACGGG + Exonic
997976688 5:138445336-138445358 TCCAGGAGGCTGCCAGGGCTGGG - Exonic
1000086208 5:157889547-157889569 TCCCCATGACTGCCTGGGACAGG - Intergenic
1000637356 5:163659455-163659477 TCCCCAAGGCTGGAAGGCACTGG + Intergenic
1001437294 5:171710062-171710084 TCCCCAAGGCTCTCAGGCACCGG + Intergenic
1001638393 5:173228873-173228895 TCCCGGAGGATGCGAGGGGCGGG + Intergenic
1002382373 5:178839974-178839996 TCCCAAAGGCTCTCAGGGACCGG - Intergenic
1002648203 5:180672701-180672723 TCCCAAAGGCTCTCAGGGACCGG + Intergenic
1002678283 5:180936979-180937001 TCCCCCAGGGTTCCAAGGACTGG + Intronic
1002954267 6:1846544-1846566 TCTAAGAGGCTGGCAGGGACAGG + Intronic
1004126809 6:12882103-12882125 CACCCGAGGCTGAGAGGGACAGG + Intronic
1006340364 6:33443372-33443394 TCCCCCAGGCGGCCATGGAGGGG + Exonic
1007180105 6:39923536-39923558 TGCCCGCGGGTGCCAGGGAGAGG + Intronic
1007687647 6:43676517-43676539 CCCACCAGGCTGCCTGGGACAGG + Intronic
1010152989 6:72758082-72758104 TCCCCCAGGCAGCCAGGGAAGGG + Intronic
1010188896 6:73174647-73174669 TCCCTGAAGCTGCTAGGGAGAGG + Intronic
1013226059 6:108119930-108119952 CCCCAGAGGCCGCCAGGGCCAGG - Intronic
1017971352 6:159315223-159315245 CCCACGACGCTCCCAGGGACAGG - Intergenic
1018259851 6:161959276-161959298 TCGGTGCGGCTGCCAGGGACAGG - Intronic
1018971701 6:168534424-168534446 TCCCTGCGTCTGCCAGGGCCCGG + Intronic
1019273523 7:163976-163998 TCCTCGTGGCTGCCTGGGACTGG - Intergenic
1019590584 7:1828486-1828508 CCCGCGAGGCTGCCGGAGACAGG - Intronic
1022473265 7:30694574-30694596 GGGCCCAGGCTGCCAGGGACCGG + Intronic
1023852330 7:44157430-44157452 TCCCAGAGGCTGCCAGGGGGAGG - Intronic
1024195288 7:47053001-47053023 ACGCCGAGGCCGCCATGGACTGG + Intergenic
1029460967 7:100693857-100693879 TCCCCGAGGCTGGCCGGCTCTGG + Intergenic
1029655861 7:101924047-101924069 TCACCGTGCCTGCCAGGGTCGGG - Intronic
1032889845 7:136182495-136182517 TCCCTGAAGCAGCCAGGGAAGGG - Intergenic
1034317192 7:150143668-150143690 AACGCGAGGCTGCCGGGGACTGG + Intergenic
1035331170 7:158098342-158098364 TCCCGAAGGCTCCGAGGGACGGG + Intronic
1035357335 7:158284281-158284303 TCTCCGAGTCAGCCAGGCACTGG + Intronic
1035828293 8:2668196-2668218 TCCCAGAGGGTGGCAGGGGCGGG + Intergenic
1037734250 8:21554306-21554328 CCCCCGAGGCAGGCAGGAACTGG - Intergenic
1037769345 8:21789563-21789585 TCCCCGATGGTGCCAGGGAAAGG + Intronic
1038870691 8:31489968-31489990 TCCCCAGGGCTGGCAGGGCCAGG - Intergenic
1039595377 8:38786765-38786787 TCCCCCACGCTGCCAGGGTTAGG + Intronic
1039824309 8:41160044-41160066 TACCAGAGGCTGCCAGAGGCTGG - Intergenic
1040106572 8:43545407-43545429 TCCCCCTGGGTGACAGGGACAGG - Intergenic
1040110469 8:43564955-43564977 TCCCTGTGGGTGACAGGGACAGG - Intergenic
1041496512 8:58491528-58491550 TGCCCAAGCCTGCCCGGGACTGG + Exonic
1044776447 8:95693748-95693770 TCTCAGAAGCTGCCAGGGCCGGG + Intergenic
1049107147 8:140621242-140621264 GGCCAGAGGCTGCCAGGGAACGG - Intronic
1049108804 8:140629985-140630007 TCCCTGGGTCTGCCAGGAACCGG - Intronic
1049256362 8:141616010-141616032 TCTCCAATGCTGCCATGGACGGG - Intergenic
1049449882 8:142654935-142654957 ACCCCGAGGCTGGCAGGGCAAGG - Intergenic
1057159966 9:92882537-92882559 TCCCCGTGGAGGCTAGGGACTGG - Intergenic
1060251958 9:121994010-121994032 TCCCTGAGGCTGGCAGGGGCTGG - Intronic
1061478955 9:130887012-130887034 TCCCCGAGGCTGCCCCAGGCCGG + Intronic
1061589382 9:131588811-131588833 CCCCCCGGGCTGCCAGGGGCTGG + Exonic
1061836149 9:133331565-133331587 TCCCCGAGGTTTGCAGGGTCAGG - Exonic
1062339798 9:136088865-136088887 TCCCCCAGGATGCCGGGGGCTGG - Intronic
1062458691 9:136653781-136653803 TCCCGGGGGCTGGCAGGGAGTGG + Intergenic
1062597381 9:137305400-137305422 TGGCCGAGGCTGCCAGTGCCAGG - Intergenic
1062636696 9:137495204-137495226 CACCGGAGGCTGTCAGGGACAGG - Intronic
1062686393 9:137815624-137815646 TCACCGAGGCTGCCAGCTCCTGG - Intronic
1186508034 X:10109834-10109856 CGGCCGAGGCTGACAGGGACCGG + Exonic
1192167395 X:68834543-68834565 CCCCCGAGGCTGGCAGGAGCAGG - Intronic
1197728547 X:129792351-129792373 TCCCCGAAGCTGCCAGAACCTGG - Exonic
1200056825 X:153465959-153465981 TCCACCAGGCTGCCAGAGCCTGG + Intronic