ID: 948992619

View in Genome Browser
Species Human (GRCh38)
Location 2:241562494-241562516
Sequence GTCCCATGGGACCTCAGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 236}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948992606_948992619 21 Left 948992606 2:241562450-241562472 CCGTGGCTGGCCACATCTTCTCT 0: 1
1: 0
2: 4
3: 73
4: 599
Right 948992619 2:241562494-241562516 GTCCCATGGGACCTCAGGGAGGG 0: 1
1: 0
2: 2
3: 28
4: 236
948992608_948992619 11 Left 948992608 2:241562460-241562482 CCACATCTTCTCTGCAGGTATGC 0: 1
1: 0
2: 0
3: 12
4: 195
Right 948992619 2:241562494-241562516 GTCCCATGGGACCTCAGGGAGGG 0: 1
1: 0
2: 2
3: 28
4: 236
948992605_948992619 26 Left 948992605 2:241562445-241562467 CCTGGCCGTGGCTGGCCACATCT 0: 1
1: 0
2: 0
3: 12
4: 170
Right 948992619 2:241562494-241562516 GTCCCATGGGACCTCAGGGAGGG 0: 1
1: 0
2: 2
3: 28
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948992619 Original CRISPR GTCCCATGGGACCTCAGGGA GGG Intronic
900401398 1:2474339-2474361 GTCCCTTTGGACCTCAGGGCAGG + Intronic
900468842 1:2840678-2840700 GACCTCTGGGACCTCTGGGAAGG + Intergenic
900964442 1:5948042-5948064 GTCTCTTGGGTCCCCAGGGATGG - Intronic
901025577 1:6277170-6277192 GATCCATGGGCTCTCAGGGAGGG - Intronic
901151752 1:7107985-7108007 GTCCCATGGGGACTGAGCGAGGG - Intronic
902561616 1:17281005-17281027 GGCCCAAGGGGCATCAGGGAAGG + Intronic
903668285 1:25021212-25021234 GGCCGCAGGGACCTCAGGGAGGG + Intergenic
904128323 1:28258368-28258390 GTGCCTTGGGAGCTCAGGGGAGG + Intergenic
904921180 1:34009520-34009542 CTCTCCTGGGACCTCAGTGATGG + Intronic
905300347 1:36982599-36982621 ATCCCATGGGTCTGCAGGGAAGG + Intronic
906282805 1:44565767-44565789 GTCCCATTGGCACCCAGGGAGGG - Intronic
907247382 1:53116748-53116770 GTCCTGTGTGACCTCAGGCAGGG - Intronic
910244990 1:85129116-85129138 GTCAACTGGGCCCTCAGGGAAGG - Intronic
912450205 1:109763759-109763781 GTCACAGGGGATCTCAGGGCAGG - Intronic
912520283 1:110240381-110240403 GTCTCTAGGGATCTCAGGGATGG - Intronic
912558047 1:110530372-110530394 GTCCCATGGGACCTGAGGGCTGG + Intergenic
912648577 1:111418282-111418304 GACCCATAGGACATCAGAGAGGG - Intronic
912696753 1:111847929-111847951 CTGTCATGGGAGCTCAGGGAGGG - Intronic
912869022 1:113286325-113286347 GTCCCAGAGGGCCTGAGGGAGGG + Intergenic
914474447 1:148011736-148011758 GGCCCATGGGTCTTCCGGGAGGG + Intergenic
918313304 1:183302333-183302355 GTGCTATAGGACTTCAGGGAGGG + Intronic
922967615 1:229704243-229704265 GGACCATGGAGCCTCAGGGAAGG - Intergenic
1067246710 10:44553628-44553650 GCCTCAGGCGACCTCAGGGAGGG + Intergenic
1068533076 10:58210554-58210576 TTCACATGGGATCTCAGGGAAGG - Intronic
1069772697 10:70909713-70909735 GTGCCATGGGCTCTCATGGAGGG - Intergenic
1069775167 10:70922652-70922674 GTCCCATGGGCCCTGGGAGAGGG + Intergenic
1070786420 10:79164904-79164926 CTCCCCTGGGACCTTTGGGAAGG - Intronic
1070843074 10:79501714-79501736 GTCCCCTGGGATCTCACGGTGGG + Intergenic
1070930607 10:80257924-80257946 GTCCCCTGGGATCTCACGGTGGG - Intergenic
1072105930 10:92273940-92273962 GTACCCTAGGAGCTCAGGGAAGG - Intronic
1075450670 10:122549885-122549907 TTCCCATGTGGCCTCATGGAGGG - Intergenic
1076301157 10:129427378-129427400 GGGCCATGCGACCCCAGGGAGGG + Intergenic
1077173583 11:1178975-1178997 GTTCCAGTGGAGCTCAGGGAGGG - Intronic
1077392049 11:2304718-2304740 GGCCTATGGGACCTCGGGGCTGG - Intronic
1077430398 11:2513349-2513371 GACCCATGGGACTTGAGGGTGGG + Intronic
1077439066 11:2559866-2559888 GTCCCATGGGAAGTCAGGGTGGG + Intronic
1078587906 11:12610056-12610078 CTCACAGGGGTCCTCAGGGAAGG + Intergenic
1079391068 11:20022751-20022773 CTCCCCTGGGACCACATGGAGGG + Intronic
1081742113 11:45448135-45448157 GTTCCTTGGGGACTCAGGGATGG - Intergenic
1083259385 11:61514973-61514995 GTCCTCTGGGAACTGAGGGAGGG + Intergenic
1083372344 11:62192375-62192397 GTCACCTGGGACCACAGGGTGGG + Intronic
1083841849 11:65309144-65309166 CCCCCATGGGACCTGGGGGATGG - Intergenic
1084023874 11:66435801-66435823 CTATCTTGGGACCTCAGGGAAGG - Exonic
1085384344 11:76148569-76148591 GTCCCCTGGGAGCTCTGTGAAGG + Intergenic
1085641908 11:78197980-78198002 CTCCCATTGGAGCTCATGGATGG + Exonic
1086395806 11:86413769-86413791 GTCCCATGGAACCTGAGGGCAGG + Intronic
1087405150 11:97721474-97721496 CTCACAGGGGCCCTCAGGGAAGG + Intergenic
1088889653 11:114034692-114034714 TTCCCATGGGACCTCCGTGAGGG + Intergenic
1090717936 11:129446747-129446769 GTTCCACTGGACCTCAGGCAAGG - Intronic
1091380715 12:56755-56777 CTCACAGGGGTCCTCAGGGAGGG + Intergenic
1093697824 12:22182465-22182487 GACCCATGGTTCCTCAGGGCTGG + Intronic
1094654680 12:32408932-32408954 GTCCCATCTGCCCTCTGGGAAGG + Intronic
1097196777 12:57246755-57246777 GCTCCATGGGATCTCTGGGAGGG + Intronic
1097245984 12:57607784-57607806 GTGCCTTGGGATCACAGGGATGG - Intronic
1100346660 12:93738299-93738321 GGCCCATGAGACCTCAGGCATGG + Intronic
1102457564 12:113080166-113080188 GTCCCATGTGACCTCAGCCTAGG + Intronic
1103256183 12:119543416-119543438 GTCCCAGTGGACATGAGGGAGGG + Intergenic
1103818473 12:123678015-123678037 CTGCCATGGGAACCCAGGGAGGG - Intronic
1108573993 13:51776420-51776442 GTCCCAAGGGTCCTCATGGGAGG - Intronic
1110519840 13:76462569-76462591 GTCCCCTGGGAGCTGAGGGTGGG - Intergenic
1112564473 13:100541339-100541361 GTCCCACAGGTGCTCAGGGATGG - Intronic
1113733122 13:112656937-112656959 TTCACAGGGGAGCTCAGGGAAGG - Intronic
1114532794 14:23405904-23405926 GTCCCAGGGGACATCGGGGTAGG - Intronic
1115515560 14:34181487-34181509 GTCACATGGGTCTTGAGGGAAGG + Intronic
1119854280 14:77887519-77887541 GGCCAAGGGGACCTCAGGGAAGG + Intronic
1122920553 14:104878200-104878222 GCCCCATGTGACCTCAGGCTGGG - Intronic
1123774786 15:23567239-23567261 GTCCCACTGGTCCTCAGAGAAGG - Exonic
1124012314 15:25848827-25848849 TTCTCATGGGACCTAAGGGAGGG + Intronic
1124149768 15:27167190-27167212 GGCCCAGGGGACCTCGGGCATGG - Intronic
1124254315 15:28128770-28128792 CTCCCCTGGGGCCTCTGGGAAGG - Intronic
1127617340 15:60700265-60700287 GTCCCTTAGTACCTCTGGGATGG - Intronic
1129460608 15:75698410-75698432 GGGCCAGGTGACCTCAGGGAGGG - Intronic
1129724253 15:77893625-77893647 GGGCCAGGTGACCTCAGGGAGGG + Intergenic
1129747463 15:78034413-78034435 GTCACATGCCACCTGAGGGAAGG - Intronic
1130094020 15:80842889-80842911 GACCCCTGGGACCTCCTGGAAGG - Intronic
1130559285 15:84945690-84945712 GTGCCATGGGACCTCAGTTTGGG - Exonic
1130560681 15:84955855-84955877 CTCCCATTGGACCTGAGGTAGGG + Intergenic
1130605018 15:85307814-85307836 TTCCCATGGGAACTCAGTGTGGG + Intergenic
1132284738 15:100654657-100654679 GCGCCATGGGGGCTCAGGGAGGG - Intergenic
1132723315 16:1327495-1327517 GTCCCAAGGGACCTGAGAGACGG - Intergenic
1134105802 16:11485336-11485358 GTGACATGGGAGTTCAGGGAGGG - Intronic
1136035247 16:27534309-27534331 GTCTAGTGGGAGCTCAGGGAGGG + Intronic
1137434332 16:48443342-48443364 GGACCAGGGGACCTCAGGGAAGG + Intronic
1137528540 16:49261026-49261048 GTCCCACGGGATCTCGGGGGAGG - Intergenic
1137562060 16:49509246-49509268 GTCCCAGGGGACAGCAGGGATGG - Intronic
1138298508 16:55907622-55907644 GTGACATAGGCCCTCAGGGAAGG + Intronic
1138463921 16:57173034-57173056 TTCCCTTTGGACCTCAGAGAGGG + Intronic
1139485647 16:67255265-67255287 GCCCCAGGGGACCCAAGGGAAGG - Intronic
1141712014 16:85705191-85705213 GTGCCATGGGGCCTCTGGGGAGG - Intronic
1142894176 17:2963808-2963830 CTCCCCTGGGACCGCAGGGGAGG - Intronic
1143662767 17:8336931-8336953 GTGCAGTGGGACCTCAGGAATGG - Intergenic
1144931747 17:18864702-18864724 TTCACCTGGGACCTCTGGGAAGG - Intronic
1145798099 17:27667471-27667493 GGCCCATCGGTCCTCAGGGCAGG - Intergenic
1147244062 17:39109113-39109135 GTCCCATGGGAACCCCTGGAAGG + Intronic
1147628001 17:41912302-41912324 GTCTCATTGTAGCTCAGGGAAGG - Intronic
1149494775 17:57110216-57110238 GGGCCATTAGACCTCAGGGAGGG + Intronic
1151460084 17:74249233-74249255 CTCCCTTGGGAGCTCAGGGACGG + Intronic
1151577587 17:74960456-74960478 CTCCCTTGGGTCCTCAGAGATGG + Intronic
1151661518 17:75521627-75521649 GTCCCATGGGAGCTGAAGGCAGG - Intronic
1151970927 17:77457005-77457027 GTCCCCTGAGACCGCAGTGATGG - Intronic
1152562199 17:81084156-81084178 GTCCCCAGGGCCCTCAGCGATGG + Intronic
1155918161 18:31576247-31576269 GCCCCATGGCACCACAGGGATGG + Intergenic
1157431561 18:47632044-47632066 GACTCATAGGATCTCAGGGATGG + Intergenic
1160178153 18:76612705-76612727 GTTCCATGGGACTTCAGGGGAGG - Intergenic
1160670794 19:361944-361966 GTCCCGTGGGCCCTCAGGAATGG + Intronic
1161298652 19:3532361-3532383 GGCCTATGGGACCACAGGGCTGG + Intronic
1161579118 19:5071067-5071089 GTCCCTGGGGCCCTCAGGGCAGG - Intronic
1161857508 19:6773949-6773971 GTCCCCTCAGACCTCAGGGCAGG - Intronic
1162906481 19:13826904-13826926 GTGCCATGGGACCTGGAGGAGGG + Intronic
1163432956 19:17279119-17279141 GTTCCTTGGGACCTCCGGGGTGG + Exonic
1163587731 19:18173204-18173226 GTCCCACGGGACCACGGTGAGGG + Intronic
1163827034 19:19529581-19529603 GTGACATGGGACCCCAGGCAAGG + Intronic
1164588867 19:29495200-29495222 GACCACTGTGACCTCAGGGATGG - Intergenic
1165347388 19:35257423-35257445 GGACTATGGGACCTTAGGGAAGG + Intronic
1166253731 19:41587747-41587769 CTCCCCAGGGCCCTCAGGGAAGG - Intronic
1166257654 19:41618118-41618140 CTTCCAGGGGCCCTCAGGGAAGG + Intronic
1166300207 19:41908603-41908625 GTTCCAGGGGTACTCAGGGAAGG + Intronic
1166410292 19:42552248-42552270 CTTCCAGGGGCCCTCAGGGAAGG + Intronic
1167077980 19:47260603-47260625 GTCCCAGGAGACCTCCGGGAAGG - Exonic
1167404089 19:49292814-49292836 GTCACATACGACTTCAGGGAGGG - Intronic
925864735 2:8217511-8217533 GTCCCATGCGTCCTCATGGGTGG + Intergenic
927283407 2:21331680-21331702 GTCACATTGGAACTCAAGGAAGG + Intergenic
927430834 2:23025018-23025040 GTCCCATGGGAAGACATGGACGG - Intergenic
927640376 2:24841879-24841901 GTCCCCAGGCACCACAGGGAGGG - Intronic
927853621 2:26514620-26514642 GTCCCTTAGGACCTCAGAGTTGG + Intronic
928859215 2:35835717-35835739 GTCCCATGGGACCTTATAAAGGG + Intergenic
929055548 2:37873357-37873379 ATCCCAGGGGACTTCAGGGAGGG - Intergenic
929568016 2:43001807-43001829 GTACCATGGGTGCTCAGGGAAGG + Intergenic
932092376 2:68817786-68817808 TTCCAATGAGAACTCAGGGATGG - Intronic
932474635 2:71995013-71995035 CCCCCATGTGACTTCAGGGAAGG - Intergenic
933754058 2:85623827-85623849 GTCCCCTGGGAGCCCTGGGATGG - Intronic
934992739 2:98932995-98933017 TTCCTGTGGGAACTCAGGGAAGG + Intronic
936085816 2:109468473-109468495 GTCCCACTGGATCTCAGAGAGGG + Intronic
940237484 2:151526835-151526857 GTCCCCAGGGACACCAGGGAAGG - Intronic
940710671 2:157159934-157159956 GTCAACTGGGAGCTCAGGGAAGG - Intergenic
942712093 2:178848081-178848103 GTGGCATGGGAGATCAGGGAGGG + Intronic
943343989 2:186715602-186715624 GTGCTGTGGGAACTCAGGGAAGG + Intronic
945003155 2:205373792-205373814 ATTCCATGTGACCACAGGGATGG + Intronic
946136755 2:217653885-217653907 GTCTAATGGGATCTCAGGTAGGG - Intronic
948988400 2:241539927-241539949 GTTCCATGGGCCCTCAAAGAGGG + Intergenic
948992619 2:241562494-241562516 GTCCCATGGGACCTCAGGGAGGG + Intronic
949073768 2:242042054-242042076 GGGCCAGGGGACCTCAGGGGTGG - Intergenic
1168806786 20:676352-676374 GGCACATGGGGCCGCAGGGAAGG + Intergenic
1170012108 20:11735550-11735572 CTTCCATTTGACCTCAGGGAGGG - Intergenic
1171749047 20:29029437-29029459 GCCCCACGGGACCTGAGTGAAGG + Intergenic
1171936180 20:31277482-31277504 GTCACATGGGTCCACTGGGATGG + Intergenic
1172846189 20:37931127-37931149 CTCCCCTGGGACCCCAGGTATGG - Intronic
1173540797 20:43849317-43849339 GTCCCAGGAGGCCTAAGGGATGG - Intergenic
1173566027 20:44039290-44039312 GTCCCCAGGGAGCTCTGGGAAGG + Intronic
1173589966 20:44217033-44217055 GTCCCATGGGACAACGGGGTCGG - Intergenic
1173726700 20:45303506-45303528 GTCCTGTGTGTCCTCAGGGAAGG - Intronic
1173865963 20:46312778-46312800 GGCCGACGGGACCGCAGGGAGGG + Intergenic
1174446557 20:50594843-50594865 GTCACATGGGAATGCAGGGAAGG - Intronic
1176316136 21:5246267-5246289 GCCCCACGGGACCTGAGTGAAGG - Intergenic
1176946575 21:14989508-14989530 CTCCCAGGGTAGCTCAGGGAAGG - Intronic
1179990660 21:44946824-44946846 GGACCATGGGACCTCACAGAGGG + Intronic
1180393940 22:12312193-12312215 GCCCCACGGGACCTGAGTGAAGG - Intergenic
1180405807 22:12552557-12552579 GCCCCACGGGACCTGAGTGAAGG + Intergenic
1180937873 22:19637892-19637914 GGCCCGAGGGACCCCAGGGAAGG + Intergenic
1181026264 22:20129525-20129547 GCCCCACGGGACCACAGGGTAGG + Intronic
1181103193 22:20555084-20555106 GCCTCCTGGGACCTCGGGGATGG + Exonic
1181468296 22:23122563-23122585 GTCCGATGGTACCACATGGAAGG + Intronic
1182552397 22:31107316-31107338 CTCCCATGGGGCCGCAGGGTTGG + Intronic
1182719499 22:32386008-32386030 GTCCCTTGGGTCCTGAAGGAGGG + Intergenic
1184425333 22:44405937-44405959 GTCCCAGGGGGGCACAGGGAGGG - Intergenic
1184655532 22:45940209-45940231 TACCCATGGGGCCTCAGAGAGGG - Intronic
1185077861 22:48692899-48692921 CTCCCAGGCCACCTCAGGGATGG + Intronic
949928231 3:9058583-9058605 GTGCCTTGGGGCCTCCGGGATGG - Intronic
949954692 3:9258162-9258184 GTCCCATGGGATCTCATGTAAGG + Intronic
950138239 3:10598105-10598127 GTCTCATGGGAATTCAGGGAAGG + Intronic
950443082 3:13021193-13021215 GTCCCTTGTGATCTCAGGCAAGG - Intronic
951507171 3:23460173-23460195 GTGCCAGAGGACCTCTGGGAGGG - Intronic
952238516 3:31505845-31505867 GTCCCCTGTGGCCTCAGTGAAGG - Intergenic
955474569 3:59322640-59322662 GTGCCTTGGGAAGTCAGGGAAGG + Intergenic
956490271 3:69763826-69763848 GTCCCATTTGACTTCAGAGATGG - Intronic
957681293 3:83439623-83439645 CTCACATGGACCCTCAGGGAAGG + Intergenic
958819180 3:98952836-98952858 CTCACAGGGGCCCTCAGGGAAGG - Intergenic
961556161 3:127697889-127697911 CTCCCATGGGACCTGTGGGGTGG + Intronic
961610290 3:128132044-128132066 GTGCCATGAGGCCTCAGGCAGGG - Intronic
962804344 3:138916084-138916106 GTCCCAGGGATCCGCAGGGAGGG + Intergenic
962862280 3:139415006-139415028 CTCACATGGGCCCTTAGGGAAGG - Intergenic
965877954 3:173351180-173351202 CTACCAGGGAACCTCAGGGAAGG - Intergenic
966194289 3:177298036-177298058 GTCCCATGGCACCACGGGAAAGG - Intergenic
966479530 3:180390542-180390564 GTTCCATGGGAGCCCAGAGAAGG - Intergenic
969059373 4:4423015-4423037 GGTCCATGCCACCTCAGGGATGG - Intronic
969230408 4:5826610-5826632 AGCCCAGGTGACCTCAGGGATGG + Intronic
969514160 4:7637316-7637338 GTCCCCAGGGAACTCAGGGCAGG - Intronic
970429489 4:15975632-15975654 GACCCCTGGGACCTCTAGGAGGG + Intronic
970458888 4:16253156-16253178 GCACCATGGGAGCCCAGGGAAGG - Intergenic
971058219 4:22937424-22937446 ATCCCTTGGGCCCTCAGTGAGGG + Intergenic
979828976 4:125276990-125277012 GTCTCTTGGGAACTCAGAGAAGG + Intergenic
982753349 4:159189664-159189686 TTCTCATAGGAACTCAGGGAAGG + Intronic
985409490 4:189668424-189668446 GTCACATCATACCTCAGGGAAGG - Intergenic
985624481 5:977784-977806 CTCCCTTGGGTCCTCTGGGAAGG - Intergenic
986719592 5:10551587-10551609 GTTCCAGGCGTCCTCAGGGAGGG - Intergenic
988606008 5:32678830-32678852 GTCCCATTGGACCTCTGGTGAGG + Intergenic
989124284 5:38036272-38036294 GTCCCAAGAAACATCAGGGAGGG - Intergenic
989425733 5:41293453-41293475 GTCCCATGGGGCCCTTGGGATGG - Intergenic
989526075 5:42454983-42455005 CTCACAGGGGCCCTCAGGGAAGG - Intronic
991456950 5:66814128-66814150 CTCCCCTGGGACCTTAGGGAAGG + Intronic
991701545 5:69320866-69320888 GTCACTTGGGACATCATGGATGG + Intronic
993685380 5:90930979-90931001 GTGCCATGAGACCTCAGAGAAGG + Intronic
994205594 5:97032036-97032058 GTTTCATGGGGCTTCAGGGAAGG + Exonic
995141577 5:108741198-108741220 GTCCCATTTGACTTCAGGGAAGG + Intergenic
997341046 5:133144813-133144835 CTCCCCAGGGCCCTCAGGGATGG - Intergenic
999065756 5:148683896-148683918 GTCCAGTGGGGCCTCAGTGAGGG - Intergenic
999241010 5:150127342-150127364 GTTCCATAGGACCTCATGGGTGG - Intronic
999625635 5:153517470-153517492 GTCCCCTGGGCCCTCAGAAAGGG + Intronic
1000318917 5:160118754-160118776 GTCCGCTGGGTCCCCAGGGAGGG - Intronic
1003267886 6:4582447-4582469 GTCCCATCTGACCTCCGTGATGG + Intergenic
1003977388 6:11356907-11356929 GTCTCATGGGACCTCAGCTGAGG + Intronic
1006322627 6:33329181-33329203 GTCGCACGGGACCCCTGGGAGGG + Intronic
1006796893 6:36737664-36737686 CTCCCATGGGACCTTGGGGCTGG - Intergenic
1006946442 6:37787612-37787634 TTCTCATGGTACCTCAGGGCTGG + Intergenic
1007126920 6:39433258-39433280 GCCCCAGTGCACCTCAGGGAAGG - Intronic
1009267029 6:61568802-61568824 CTCACAGGGGCCCTCAGGGAAGG + Intergenic
1009779897 6:68256254-68256276 CTCACAGGGGCCCTCAGGGAAGG - Intergenic
1012829646 6:104188168-104188190 CTCCCATGGGAGCTCAGTGTGGG + Intergenic
1014177833 6:118349502-118349524 GCCCCAGATGACCTCAGGGAGGG + Intergenic
1018901825 6:168055484-168055506 GTCCCATGGACCATGAGGGAAGG - Intergenic
1019646368 7:2131545-2131567 GTCCCAGGGGACCTCTGCGCAGG + Intronic
1019684824 7:2375600-2375622 CTGTCCTGGGACCTCAGGGAAGG + Intronic
1020005854 7:4783510-4783532 CCACCATGGGCCCTCAGGGAAGG - Intronic
1020685713 7:11291062-11291084 GTCCCATGTCACCCCAGGGGAGG + Intergenic
1022663046 7:32384419-32384441 GTACCATGGGAACACATGGAAGG + Intergenic
1024996742 7:55278226-55278248 GTGCCCTGGGACCTCAGGGGTGG + Intergenic
1027774315 7:82444527-82444549 GTCCAATGGAACCACAGGGCTGG - Intergenic
1029381907 7:100220408-100220430 CTCCCAGGAGCCCTCAGGGAAGG - Exonic
1029402071 7:100352858-100352880 CTCCCAGGAGCCCTCAGGGAAGG - Exonic
1029882414 7:103829348-103829370 GTCCCAAGGGGCCTGGGGGAAGG - Intronic
1033022394 7:137739516-137739538 TTCCTATGGGACCTCATGCAGGG + Intronic
1033423456 7:141222595-141222617 CTCCCATGGGACCTCAGTATGGG - Intronic
1034791760 7:153976928-153976950 GTGGCCTGGGACCTCAGGGTCGG + Intronic
1036616966 8:10395753-10395775 GTTTCATTGGACTTCAGGGAGGG - Intronic
1039647821 8:39306282-39306304 CACCCATGGGACCTCAGGGCTGG - Intergenic
1040287815 8:46109421-46109443 GGCCCAGGGGACATCTGGGATGG + Intergenic
1042224560 8:66505302-66505324 GACCCATGGAACCCCAGGGCAGG - Intronic
1043616282 8:82129825-82129847 CTCACAGGGGCCCTCAGGGAAGG + Intergenic
1045292167 8:100842957-100842979 TACCCATGGGCACTCAGGGATGG + Intergenic
1045431808 8:102122104-102122126 GTAGCATGGCACCTCTGGGAGGG + Intronic
1045664446 8:104469780-104469802 GCCACATGTGACCTCAGAGATGG + Intergenic
1047384224 8:124394748-124394770 CTCCCATGGGACCTCAGTGAGGG - Intergenic
1047741431 8:127810045-127810067 GTCCCAGGTGTTCTCAGGGAAGG - Intergenic
1048424836 8:134313430-134313452 GTGCCAAGAGACCTCAGAGAAGG + Intergenic
1048558360 8:135505369-135505391 GTCCCAAGGGACCACAAGCAGGG - Intronic
1048941495 8:139404275-139404297 GTCAGCTGGGACCTCAGGGAGGG + Intergenic
1051059800 9:13032775-13032797 TCCACATGGGACTTCAGGGAGGG + Intergenic
1052037222 9:23696273-23696295 TTCCCATGGGAGCTCAGAAAAGG + Intronic
1053350848 9:37412395-37412417 GTGTCATGGGACCTCAGTGCAGG - Intergenic
1053720015 9:40935984-40936006 TCCCCATGGGACCTGAGTGAAGG + Intergenic
1056605144 9:88079189-88079211 GGTCCATGGGGCCTCAGGGAAGG - Intergenic
1057045817 9:91885536-91885558 ATGACATGGGACCTAAGGGAAGG + Intronic
1058781236 9:108337577-108337599 GGCTCAGGGGTCCTCAGGGATGG + Intergenic
1059418894 9:114178918-114178940 GTCCCATGGGAACTTGGGGTGGG - Intronic
1060223095 9:121774670-121774692 GACTCCTGGGACCTCTGGGAAGG + Intronic
1060933554 9:127503524-127503546 TTCTCATGGGAGCCCAGGGAGGG + Intergenic
1061184122 9:129042218-129042240 GCCCCAGAGCACCTCAGGGACGG - Intronic
1061398892 9:130357825-130357847 GACCGATGGGAACTCTGGGAAGG - Intronic
1061888749 9:133606541-133606563 GTCCCATGTGCCAGCAGGGAAGG + Intergenic
1062406994 9:136401346-136401368 CTCCCAAAGGGCCTCAGGGAAGG + Intergenic
1203454990 Un_GL000219v1:158587-158609 TCCCCATGGGACCTCAGTGAAGG - Intergenic
1186635958 X:11405231-11405253 GTCACCTGGGACCTCAAGGTGGG - Intronic
1188870541 X:35365601-35365623 CTCCCATGGGAGCTCAGTGTGGG + Intergenic
1191148863 X:57198737-57198759 TTCCCAGGGAAGCTCAGGGATGG - Intergenic
1194181343 X:90715143-90715165 CTCACAGGGGCCCTCAGGGAAGG + Intergenic
1199424111 X:147681543-147681565 CTCGCAGGGGCCCTCAGGGAAGG + Intergenic
1199563338 X:149187486-149187508 ATGCCATAGGAGCTCAGGGAAGG - Intergenic