ID: 948997852

View in Genome Browser
Species Human (GRCh38)
Location 2:241592857-241592879
Sequence GGGCCACGGGACGTCTGTAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 42
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 40}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948997843_948997852 14 Left 948997843 2:241592820-241592842 CCCAAACAGCAGTCAGCGGGGCC 0: 1
1: 0
2: 0
3: 8
4: 91
Right 948997852 2:241592857-241592879 GGGCCACGGGACGTCTGTACGGG 0: 1
1: 0
2: 0
3: 1
4: 40
948997847_948997852 -7 Left 948997847 2:241592841-241592863 CCACAGTGCCTAACAAGGGCCAC 0: 1
1: 0
2: 0
3: 14
4: 147
Right 948997852 2:241592857-241592879 GGGCCACGGGACGTCTGTACGGG 0: 1
1: 0
2: 0
3: 1
4: 40
948997838_948997852 30 Left 948997838 2:241592804-241592826 CCAAGGAGGGAAATGCCCCAAAC 0: 1
1: 0
2: 2
3: 13
4: 146
Right 948997852 2:241592857-241592879 GGGCCACGGGACGTCTGTACGGG 0: 1
1: 0
2: 0
3: 1
4: 40
948997842_948997852 15 Left 948997842 2:241592819-241592841 CCCCAAACAGCAGTCAGCGGGGC 0: 1
1: 0
2: 0
3: 7
4: 110
Right 948997852 2:241592857-241592879 GGGCCACGGGACGTCTGTACGGG 0: 1
1: 0
2: 0
3: 1
4: 40
948997844_948997852 13 Left 948997844 2:241592821-241592843 CCAAACAGCAGTCAGCGGGGCCA 0: 1
1: 0
2: 1
3: 10
4: 112
Right 948997852 2:241592857-241592879 GGGCCACGGGACGTCTGTACGGG 0: 1
1: 0
2: 0
3: 1
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948997852 Original CRISPR GGGCCACGGGACGTCTGTAC GGG Intronic
901417828 1:9129346-9129368 GGGCCGGGGGACGTGTGTCCGGG - Intergenic
916497042 1:165355921-165355943 GGCCCTCGGGACGTCTCTGCAGG + Intronic
1067163348 10:43845414-43845436 GGGCCACTGCCCGTCTGGACAGG - Intergenic
1076581486 10:131514988-131515010 GTCCCACTGGACGTCTGTGCTGG + Intergenic
1077218337 11:1404410-1404432 GGCCAAAGGGACGTCTGTCCTGG - Intronic
1081713679 11:45233917-45233939 GGGCCACGGGGCCTCTGTGAGGG - Intronic
1084668879 11:70593527-70593549 GCCCCACGGGACGTCTGAGCAGG + Intronic
1089110972 11:116055761-116055783 GGGCCACGGGACCACTGTGGAGG + Intergenic
1090976994 11:131687368-131687390 GGGACACGGGACATCAGTGCTGG + Intronic
1122925590 14:104898048-104898070 GGGCCCTGGGACGTCTGTTGAGG - Intergenic
1125508802 15:40282073-40282095 CGGCCACGGGACCTGTGTGCAGG - Exonic
1130902678 15:88218932-88218954 GTGCCAAGGACCGTCTGTACTGG + Intronic
1132231088 15:100184769-100184791 GGGCTACGGGAAGTCTGATCTGG - Intronic
1138178666 16:54928653-54928675 AGCCCACGGGACGTCTGGTCGGG + Intergenic
1144864917 17:18329322-18329344 AGTCCACGGGACGTCAGTGCTGG + Exonic
1150246130 17:63676748-63676770 GGGGCACTGGACTTCTGGACCGG - Intronic
1154168409 18:12033449-12033471 GTGCCAGGTGAAGTCTGTACTGG + Intergenic
934787912 2:97028509-97028531 GGGCCACTGGACTTCTGTCTGGG + Intergenic
948818969 2:240528808-240528830 GGGGCCCTGGACGTCTGTGCAGG - Intronic
948997852 2:241592857-241592879 GGGCCACGGGACGTCTGTACGGG + Intronic
1183648412 22:39140093-39140115 TGTCCACGTGACCTCTGTACTGG - Intronic
953854262 3:46488902-46488924 GGGCCACGGGAGGGCGGTCCGGG + Intergenic
954593576 3:51805062-51805084 GGGCCAAGGGACGCATGTCCAGG + Intergenic
964385483 3:156143198-156143220 GGGGCTCGGGATGTCTGCACAGG - Intronic
968528913 4:1079866-1079888 GGGCCACCCGCCGTCTGTACTGG + Intronic
968671816 4:1856129-1856151 GCGCCTCCGGACGTCTGTGCCGG - Exonic
985071297 4:186169389-186169411 GGGCCTGGGGACGTCTGCATGGG - Intronic
991921118 5:71657893-71657915 GGTCTACTGGACATCTGTACTGG + Exonic
992473228 5:77077660-77077682 GGGCCACCTGCCGTCTGTGCGGG - Exonic
1000072233 5:157751473-157751495 GGACTTCGGGGCGTCTGTACAGG + Exonic
1001581072 5:172798882-172798904 GGGCCAGGGGGCATCTGTCCGGG + Intergenic
1002899766 6:1400827-1400849 GGGCCACGGGACGGCCGCAGGGG - Intergenic
1006448169 6:34091418-34091440 GGGCCGCGGGTGGTCTGTGCTGG - Intronic
1007506399 6:42338364-42338386 GGGTCACGGGACGTGGGTAGGGG + Intronic
1019079274 6:169418704-169418726 GGGACTTGGGACGTCAGTACTGG - Intergenic
1025002262 7:55326284-55326306 GGCCCACAGGACATCTGTTCTGG + Intergenic
1034514300 7:151562287-151562309 GGGCCACGGCAGCTCTGTGCCGG + Intronic
1035113908 7:156506795-156506817 CTGCCACAGGACGTCTGCACTGG - Intergenic
1038584554 8:28777298-28777320 GGGCCACGGAACCACTGTGCTGG - Intronic
1042160331 8:65887595-65887617 TGGCCACTGAAGGTCTGTACGGG - Intergenic
1052853683 9:33393786-33393808 GGGCCACGCGAGGTGAGTACTGG - Intronic
1062092214 9:134684300-134684322 GGGCTGCTGGACATCTGTACAGG - Intronic