ID: 948998555

View in Genome Browser
Species Human (GRCh38)
Location 2:241597688-241597710
Sequence AGCCAGGAAGCACACACAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 442
Summary {0: 1, 1: 0, 2: 5, 3: 37, 4: 399}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948998555_948998558 7 Left 948998555 2:241597688-241597710 CCTTCTGTGTGTGCTTCCTGGCT 0: 1
1: 0
2: 5
3: 37
4: 399
Right 948998558 2:241597718-241597740 TCCTGCTGATGTCAACCCAATGG 0: 1
1: 0
2: 1
3: 20
4: 112
948998555_948998561 9 Left 948998555 2:241597688-241597710 CCTTCTGTGTGTGCTTCCTGGCT 0: 1
1: 0
2: 5
3: 37
4: 399
Right 948998561 2:241597720-241597742 CTGCTGATGTCAACCCAATGGGG 0: 1
1: 0
2: 0
3: 3
4: 110
948998555_948998560 8 Left 948998555 2:241597688-241597710 CCTTCTGTGTGTGCTTCCTGGCT 0: 1
1: 0
2: 5
3: 37
4: 399
Right 948998560 2:241597719-241597741 CCTGCTGATGTCAACCCAATGGG 0: 1
1: 0
2: 0
3: 3
4: 78
948998555_948998562 12 Left 948998555 2:241597688-241597710 CCTTCTGTGTGTGCTTCCTGGCT 0: 1
1: 0
2: 5
3: 37
4: 399
Right 948998562 2:241597723-241597745 CTGATGTCAACCCAATGGGGAGG 0: 1
1: 0
2: 0
3: 9
4: 80
948998555_948998565 26 Left 948998555 2:241597688-241597710 CCTTCTGTGTGTGCTTCCTGGCT 0: 1
1: 0
2: 5
3: 37
4: 399
Right 948998565 2:241597737-241597759 ATGGGGAGGCCCAGCCCCTCAGG 0: 1
1: 0
2: 2
3: 36
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948998555 Original CRISPR AGCCAGGAAGCACACACAGA AGG (reversed) Intronic
900504046 1:3020413-3020435 GGGCAGGCAGGACACACAGAGGG + Intergenic
901029635 1:6299474-6299496 TACCAGGCACCACACACAGAGGG + Intronic
901029646 1:6299521-6299543 TACCAGGCACCACACACAGAGGG + Intronic
901933603 1:12613340-12613362 CCACAGGAAGCACATACAGATGG + Intronic
902761029 1:18580825-18580847 AACCAGGAACCACACACTGAGGG - Intergenic
903824261 1:26131400-26131422 AGACAATATGCACACACAGATGG + Intergenic
904844466 1:33398779-33398801 AGCTAGAAAGCACACACAGATGG + Intronic
904976452 1:34460595-34460617 AGCCAGGATGCAGACAGAGGTGG + Intergenic
905628731 1:39506709-39506731 TGCTAGGAAGTACACAAAGAAGG - Intronic
905747655 1:40432845-40432867 AAACAGGAAGCACACAGAGGAGG + Intergenic
906005798 1:42468943-42468965 ACCCAGGAAGCATACTGAGAAGG + Intronic
906381977 1:45338538-45338560 ATTCAGGAAGTACACACTGATGG - Intronic
906745572 1:48219962-48219984 AGCCAAGATTCACACACATACGG - Intergenic
910538719 1:88330387-88330409 AGGCAGGAAACACACACACACGG + Intergenic
911016150 1:93334963-93334985 TCCCAGGCAACACACACAGAGGG - Intergenic
911040954 1:93590301-93590323 AGCCAGGATGCAAACCCAGGTGG - Intronic
911545481 1:99211175-99211197 AACCAGGAAGCTCTCACTGAAGG - Intergenic
913435044 1:118838370-118838392 TGCCACTAAGCACACACAGCAGG + Intergenic
913984659 1:143553815-143553837 AGCCAGGGGGCACTCACAGGTGG + Intergenic
914980443 1:152410304-152410326 AACCAGCAAGCAGACACAGGAGG - Exonic
916278623 1:163023789-163023811 GGCCAGAATGCACAGACAGAGGG - Intergenic
916310038 1:163388071-163388093 AGCCAAGAATCTCACTCAGATGG - Intergenic
916468690 1:165099693-165099715 AGCCACTAAGCACACACATTGGG + Intergenic
917536864 1:175880703-175880725 AGCCTGGAGGCAACCACAGAAGG - Intergenic
917986741 1:180327241-180327263 AGCCAGCACCCACACATAGAAGG - Intronic
919171890 1:193965090-193965112 AGCCAATTAGCAAACACAGATGG - Intergenic
919873622 1:201844037-201844059 AGGCAGGTAACACCCACAGATGG + Intronic
920507401 1:206526235-206526257 AGCCAGGAAGCAAACAGGAAAGG - Intronic
920670397 1:207999750-207999772 AGGCAGGAAGAACACTAAGAAGG + Intergenic
922159750 1:223070456-223070478 AGCCTGGAAGCAGAGCCAGAGGG + Intergenic
922592536 1:226788442-226788464 AGACAGTAAACTCACACAGACGG - Intergenic
922927588 1:229363212-229363234 AGCCAGATAACACACACTGAGGG + Intergenic
922941078 1:229466718-229466740 CTCCAGTAAGCACTCACAGATGG + Exonic
923028877 1:230230861-230230883 AGCCACGAAGACCAAACAGAGGG - Intronic
923407400 1:233676202-233676224 AGCCACAAACCACACACAGGTGG + Intergenic
923449429 1:234102835-234102857 TGGCAGGAAACACACACAGATGG + Intronic
1063128426 10:3155636-3155658 AGCCACGAAGCTCAAGCAGAAGG - Exonic
1063213639 10:3904374-3904396 AGCCTGGAGGAAGACACAGATGG + Intergenic
1063477981 10:6345333-6345355 GGCCAGCAGGCACAAACAGAAGG - Intergenic
1063499064 10:6536853-6536875 AGCTCGCAAGCAAACACAGATGG - Intronic
1064069015 10:12209343-12209365 ATTCAGGAAGCTGACACAGAAGG - Intronic
1065009277 10:21407002-21407024 AGACAGGAAGTAGACTCAGAGGG - Intergenic
1065053316 10:21817671-21817693 AGTCAGGAACCCCAAACAGAGGG + Intronic
1065998670 10:31083945-31083967 AGACAGGAAGCAGACAGAAAGGG - Intergenic
1067249683 10:44576000-44576022 AGGGAGGAAACACATACAGATGG + Intergenic
1068640576 10:59400974-59400996 AGCCAACAAGAACACACAGTGGG - Intergenic
1069135884 10:64765161-64765183 AGCCAGTTAGCTAACACAGATGG + Intergenic
1069709859 10:70481253-70481275 GGCCAGGAACCAGACACAGGTGG + Intronic
1069782427 10:70965231-70965253 AACCAGCAAGCATAGACAGAGGG - Intergenic
1071348653 10:84717194-84717216 ATTCAGGAAGCACACAAAGAAGG - Intergenic
1071785264 10:88892425-88892447 ATCCAGGAACCACTCCCAGAGGG + Intronic
1072610501 10:97014416-97014438 AGCCAGGGAGCGGGCACAGAGGG + Intronic
1072877717 10:99190980-99191002 AGCCAGGCAGTACTCACAGCAGG + Intronic
1074104512 10:110378345-110378367 AGGCAAGCAGCACACAGAGAGGG - Intergenic
1074819072 10:117165753-117165775 AGCCAGGACGCCCGCACCGACGG + Intergenic
1075549890 10:123384351-123384373 AGTCAGGGAGCACACGCAGGAGG - Intergenic
1076849489 10:133086116-133086138 ATCCGGGTAGGACACACAGAAGG - Intronic
1077364773 11:2157182-2157204 AGGCAGGACGCCCAGACAGAAGG + Intronic
1077708296 11:4510162-4510184 AGCCAGGAACCACAGAGGGAAGG + Intergenic
1078459437 11:11502483-11502505 AGCCAGGAAGCAAACAGAGAAGG + Intronic
1079003186 11:16774538-16774560 AGCCAGGAAGCACTTGCTGAGGG - Intergenic
1079336819 11:19577442-19577464 GGCCAGGTGGCTCACACAGATGG - Intronic
1079589073 11:22160304-22160326 GGCCAGTTAGCAAACACAGATGG - Intergenic
1079625778 11:22615930-22615952 AGACAGGAAGAAAACAAAGAAGG - Intergenic
1079848659 11:25501637-25501659 AGCCAGGAAGCACGAACTGGGGG - Intergenic
1080155380 11:29104864-29104886 AGTCAGGGAGCCCAAACAGAGGG + Intergenic
1081591589 11:44426919-44426941 AGCCAGGCTGGACAGACAGAGGG - Intergenic
1081620852 11:44618533-44618555 AGCCCGGAAGCCCCTACAGAGGG - Intronic
1081648297 11:44805280-44805302 AGCCAGGGAGAACGTACAGAGGG + Intronic
1082803872 11:57434245-57434267 AGCCAGGATTCAAACCCAGACGG - Intergenic
1083458420 11:62794744-62794766 AGCCAGGATGAAAACCCAGACGG + Intronic
1083591222 11:63896143-63896165 GGCCAGGAAGCCCACTCAGGAGG - Intronic
1084485496 11:69445431-69445453 AGCCAGGACGCAGAGGCAGAAGG - Intergenic
1085296449 11:75434313-75434335 AGCTAGGAATGACACGCAGAGGG - Intergenic
1086901227 11:92370008-92370030 ATCCAGGAAGCACACTAAAAGGG + Intronic
1089647476 11:119889694-119889716 AGCCTGGAAGGACTCCCAGAGGG - Intergenic
1089958977 11:122599097-122599119 GCCCAGGAAGGACACAGAGAAGG + Intergenic
1090467694 11:126949793-126949815 TGGCAGGAACCACCCACAGATGG + Intronic
1091171066 11:133520196-133520218 AGCCTGGTAACACAGACAGAAGG + Intronic
1091782766 12:3224445-3224467 AGCTAGGAAGAACCTACAGAAGG + Intronic
1091790742 12:3270573-3270595 GGCCAGGAAGCCCAAACAGATGG + Intronic
1092100046 12:5875549-5875571 AGCCTGGAAGCTCCCACAGATGG - Intronic
1092582075 12:9852696-9852718 AGCCAGTTAGCAAACACATACGG + Intergenic
1092950435 12:13498558-13498580 AGCCAGGAAAGACACTCTGAGGG - Intergenic
1095951472 12:47784087-47784109 AGCCAGGATGCCCACAGAGAGGG + Exonic
1096449090 12:51722066-51722088 GGCCAGGAAGAACACAGAAATGG - Intronic
1096670248 12:53194170-53194192 AGCCAGCAAGCACAGGCAGAAGG - Exonic
1097506866 12:60484406-60484428 TGCCAGTTAGCAAACACAGATGG - Intergenic
1097885271 12:64722591-64722613 AGCCAGGCAGGTCACAAAGAGGG - Intronic
1098178533 12:67820064-67820086 AGTCAGGACTCACACACACATGG + Intergenic
1098446036 12:70566443-70566465 AGCAAGGAAGCCCAGACTGAAGG - Exonic
1098649031 12:72941190-72941212 AGCCAGGCAGTACTCACTGAGGG - Intergenic
1102072653 12:110034709-110034731 AGCCAGGAGGCACAGAAGGAAGG - Intronic
1103746799 12:123130442-123130464 AGCCAAGAAGGACACAAGGATGG - Intronic
1104285310 12:127419370-127419392 AGCCAATTAGCAAACACAGATGG - Intergenic
1106259825 13:28056588-28056610 AGCCAGAAAGCACACGCAGGTGG + Intronic
1107134541 13:36929503-36929525 AGACAGGCAGCACACAGACAGGG - Intergenic
1107762585 13:43696426-43696448 AACCAGAAAGCAGACACAGAAGG - Intronic
1107812146 13:44210725-44210747 AGCATGCATGCACACACAGATGG - Intergenic
1108274931 13:48798377-48798399 AAACAGAAAGCAAACACAGAAGG + Intergenic
1108287304 13:48921145-48921167 AGACAGAAAGGACACACAGGTGG + Intergenic
1108834206 13:54520654-54520676 AGCCAATAAGCAAACACAGATGG - Intergenic
1111205348 13:85000892-85000914 AGCAAAGAAACATACACAGAAGG + Intergenic
1111380060 13:87438265-87438287 ACCCAGGAAGCACATCCAGGAGG - Intergenic
1111650804 13:91088536-91088558 ATCCAGGAAAAACACATAGATGG - Intergenic
1112306611 13:98280223-98280245 ACCCCGGAAGCACACCCAGGAGG - Intronic
1112788692 13:102980085-102980107 AGACAGGAAACACAGAGAGAAGG + Intergenic
1114972419 14:28049713-28049735 AGACAGGAAGCAGATACTGAGGG - Intergenic
1115389402 14:32837572-32837594 AGCAAACAAACACACACAGAGGG - Exonic
1115935550 14:38548309-38548331 AGCCAGGAGGAATTCACAGAAGG - Intergenic
1116346125 14:43796808-43796830 AGCCAAGTAGCTAACACAGATGG - Intergenic
1116677730 14:47926964-47926986 ACCCAGGCAGCACTCACAGTGGG - Intergenic
1117513516 14:56476849-56476871 AGCCAGGAAAAACACAGAGGTGG - Intergenic
1119288651 14:73476608-73476630 AGCCAGCAAGACCATACAGAGGG - Intergenic
1119355415 14:74002211-74002233 AGCCAGAAATCAAACCCAGATGG + Intronic
1120074677 14:80141935-80141957 AGCAAGGCTGCACACACAGGAGG - Intergenic
1120460403 14:84787690-84787712 AGACTGGTAGCACACACAGGTGG + Intergenic
1120788803 14:88560836-88560858 AGCCAGGATTCAGACCCAGACGG + Intergenic
1120850158 14:89162677-89162699 CGACAGGAAGCACAGCCAGAAGG - Exonic
1121100288 14:91245542-91245564 AGCCAGGAAGCCAACAGATACGG + Intronic
1121194606 14:92058719-92058741 AACGAGGGAGCACACACAGAAGG + Exonic
1123122744 14:105925612-105925634 ACCCAGGCAGCAGCCACAGAGGG + Intronic
1123405387 15:20017033-20017055 ACCCAGGCAGCAGCCACAGAGGG + Intergenic
1123514717 15:21023681-21023703 ACCCAGGCAGCAGCCACAGAGGG + Intergenic
1124186191 15:27531519-27531541 TGCCAGGAAGCCCACTGAGAAGG + Intronic
1124231826 15:27952526-27952548 GGCAGGGAAGCACGCACAGATGG + Intronic
1125461011 15:39906721-39906743 AGCCAGGATTCAAACACACATGG - Intronic
1126054719 15:44719372-44719394 AGCCAGGAAGGACAGCCACATGG + Intergenic
1128559982 15:68658379-68658401 AGGCAGGAAGGAGGCACAGATGG - Intronic
1129561738 15:76577699-76577721 AGCCAGGAAGCACTCGCCAAGGG + Intronic
1130541674 15:84824823-84824845 AGCCAGGAAGTCCACACATCTGG - Intronic
1130843133 15:87720486-87720508 AGCCAGGAAGGAGTCACAGCTGG + Intergenic
1130910111 15:88265003-88265025 AGCCTGGAAGCACACCTGGAAGG + Intergenic
1131677290 15:94683403-94683425 AGCCAGGATGGGAACACAGATGG + Intergenic
1131720265 15:95160584-95160606 AGACAGGAAGCACTGACATATGG + Intergenic
1131800104 15:96059743-96059765 AGCCAGGCATCTCACAGAGAAGG + Intergenic
1132326413 15:100973776-100973798 CGGGAGGAAGCACACACACACGG - Intronic
1133333947 16:4994643-4994665 AGCCAACCAGCACACACAGTCGG - Intronic
1134368889 16:13605252-13605274 ACCCAGGAAGAACATCCAGATGG + Intergenic
1134377325 16:13689384-13689406 AGCCATGATTCACACACAGCAGG - Intergenic
1135803711 16:25523075-25523097 AGCCAAGCAGCCAACACAGATGG - Intergenic
1136619832 16:31421203-31421225 AACCAGGAATCAGACCCAGACGG + Intronic
1136910033 16:34136975-34136997 AGCCAGAAACCACAGACACAGGG + Intergenic
1137829330 16:51528541-51528563 AGCCAGCAAACAGAAACAGAAGG + Intergenic
1138162021 16:54763218-54763240 TCCCAGGAAACACAGACAGAGGG - Intergenic
1139264190 16:65623838-65623860 AGCCAGCATCCATACACAGAGGG - Intergenic
1140600932 16:76474140-76474162 CACCAAGAAGCAAACACAGATGG - Intronic
1140865613 16:79058718-79058740 TGCCAGGATGCACACAGATACGG - Intronic
1142795473 17:2303769-2303791 AGCCAGGAAACCACCACAGACGG + Exonic
1143385423 17:6526930-6526952 AGCCAGGCACCACACACATTCGG + Intronic
1143496652 17:7316257-7316279 AGCCAGGGCGCACACACACCTGG + Exonic
1143783072 17:9239616-9239638 TGCAAGGAAGCACAGGCAGACGG - Intronic
1143860343 17:9885983-9886005 AGCCAGAAAACACACTTAGAGGG + Intronic
1144222559 17:13113199-13113221 TACCAGGCAGCACACACACAGGG + Intergenic
1144773888 17:17774493-17774515 AGCCAGGGAACACAGACAGCCGG + Intronic
1144837857 17:18166728-18166750 AGTCAGGAAGCACAGATGGAGGG - Intronic
1145010821 17:19366687-19366709 AGCCAAGAGGCAAAGACAGAAGG - Intronic
1145141394 17:20451087-20451109 AGTCATGAAGCAGACACATAGGG - Intronic
1145794517 17:27647795-27647817 AGTCATGAAGCACACAGACAGGG + Intronic
1146423040 17:32707261-32707283 AGCCAATAAGCACACACTCAAGG + Intronic
1147653618 17:42076049-42076071 AGCCAGCAAGCCCAAACATACGG - Intergenic
1147873369 17:43603393-43603415 AGGCAGGAACCCCACACTGATGG - Intergenic
1148639607 17:49176590-49176612 GGCCATGATGCACACACTGAAGG - Intergenic
1149665518 17:58362586-58362608 AGCCAGGATGATCACAAAGATGG + Exonic
1150583134 17:66493548-66493570 AGGCAGGGAGGACAGACAGATGG - Intronic
1150708239 17:67507798-67507820 ACCCAGGAAGGACACTGAGAAGG - Intronic
1150806183 17:68320892-68320914 TTCAAGGAAGCACACACACAAGG - Intronic
1150990513 17:70252274-70252296 AGCAAGCAAGCACACAGACATGG - Intergenic
1151090277 17:71431491-71431513 AGCCAGTAAGAAGAAACAGAAGG + Intergenic
1151758065 17:76085998-76086020 AGCCAGAGAGCACAGACAGAAGG + Intronic
1151991466 17:77577661-77577683 AGCCAAGTACCACACACCGAGGG + Intergenic
1153363293 18:4224188-4224210 AGCCAGGTAGCACACACTGTGGG + Intronic
1154259061 18:12813100-12813122 AGCCAGGAAGCAGGCAGGGAAGG + Intronic
1155640163 18:28004156-28004178 AACAAGGAAGTACACACTGAAGG - Intronic
1155812327 18:30252766-30252788 AGCCACTTAGCAAACACAGATGG - Intergenic
1156658386 18:39315027-39315049 AGCAAGTCAGCACACACACAAGG + Intergenic
1157280485 18:46343877-46343899 AACCTGGAAGCACAGACACAGGG + Intronic
1157287193 18:46384932-46384954 AGCCAGGGCACACACACAGCTGG + Intronic
1159339698 18:67119150-67119172 AGCCAGGCAGTACTCACTGAGGG - Intergenic
1161237169 19:3203928-3203950 AGCCAGGAGGCACAGAGGGAGGG + Intronic
1161934772 19:7364864-7364886 CTCCAGGAAGCAGACTCAGACGG + Intronic
1161949041 19:7457250-7457272 AGCACAGAGGCACACACAGAGGG - Intronic
1162895664 19:13763524-13763546 GGCCAGGAACCACACACACAAGG + Intergenic
1162915331 19:13871602-13871624 AGGCAGAAAGGACACACAGGAGG + Intronic
1163149646 19:15403370-15403392 GGGGAGGAAGCAGACACAGAGGG + Intronic
1163311365 19:16516901-16516923 AGCCAGGTGGCACAGTCAGATGG - Intronic
1163311735 19:16519099-16519121 AGCCAGGAAGGTCCCACAGCCGG + Exonic
1163896071 19:20060610-20060632 AGACATGATGTACACACAGAAGG - Intergenic
1164428787 19:28168743-28168765 AGGCAGGAAGCTCAGACAGCAGG - Intergenic
1164983009 19:32628238-32628260 AGGCAGGTACCACAGACAGAAGG + Intronic
1165621417 19:37251798-37251820 ATCCAGGCAGCACAGAAAGAAGG - Intergenic
1165975249 19:39670736-39670758 AGCCTAGAAACACTCACAGAGGG - Intergenic
1166159885 19:40944544-40944566 ATCCAGGATGCCCACACAGGAGG - Intergenic
1168174021 19:54609645-54609667 AGCGTGGAAGTGCACACAGAGGG + Intronic
1168678373 19:58295489-58295511 AACATGGAAGCACCCACAGAAGG - Exonic
1202713948 1_KI270714v1_random:32210-32232 AGCCAGGATGGACACAGGGAAGG - Intergenic
925104503 2:1279143-1279165 AGCCTGGATGCACTGACAGAGGG - Intronic
925501998 2:4515281-4515303 AGCTAGGAAGGTCACCCAGAAGG - Intergenic
926286479 2:11492829-11492851 TGCCAGGCAGTACCCACAGAGGG + Intergenic
926435421 2:12832871-12832893 GGACAGGAATCACACACAGCTGG - Intergenic
928538594 2:32263182-32263204 AGACAGGAAGCACACAGAAATGG + Intronic
928954531 2:36849892-36849914 ATACAGTAAGCACACAGAGAGGG - Intronic
929658911 2:43763283-43763305 GGCCAGGAAGCACACACAGGTGG + Intronic
930326132 2:49921164-49921186 GTCCAGAAAGCACACAGAGATGG + Exonic
930359247 2:50357958-50357980 ACCCAGGAAGCACAAGGAGATGG + Intronic
932233689 2:70103710-70103732 GGCCAAGAAGCCCACCCAGATGG - Intergenic
932396207 2:71450303-71450325 AGCCAGGAACAACAACCAGAAGG + Intergenic
932601688 2:73131529-73131551 ACCCACAAACCACACACAGATGG - Intronic
935290256 2:101604270-101604292 AGTGAGAAAGCACACTCAGAGGG + Intergenic
935294713 2:101638958-101638980 AGCCTGGAGGAACACAGAGAAGG + Intergenic
935697147 2:105779975-105779997 CCCAAGGAAGCACACACAGGAGG - Intronic
935835559 2:107048955-107048977 AGACAGGAAGGACAGAAAGAAGG - Intergenic
936063688 2:109314415-109314437 AGCCAGGGAGCAGAGATAGAGGG + Intronic
936241804 2:110794262-110794284 GGCCAGAGAGCACACACAGAGGG - Intronic
937896824 2:126982702-126982724 AGTCAGGAAGAACACAAAGATGG + Intergenic
938979086 2:136508499-136508521 TGCCAGTTAGCACACCCAGATGG + Intergenic
939841871 2:147198976-147198998 AGCCAGGCCTCACACACATATGG + Intergenic
940402353 2:153262211-153262233 AGCCAGGCAGTACACACTGTGGG - Intergenic
940786732 2:157989428-157989450 AGACAGGGAGCCCACAGAGAGGG - Intronic
941349291 2:164412874-164412896 AGCCAGCGATTACACACAGAAGG + Intergenic
941392334 2:164929586-164929608 AAACAGGAAGCACAGACAGATGG + Intronic
941412019 2:165169985-165170007 AGACAGGAAGGACAGAAAGAAGG + Intronic
941412022 2:165170005-165170027 AGGAAGGAAGGACACAAAGAAGG + Intronic
943439700 2:187912774-187912796 TGCAAAGAAGCACACACAGTTGG + Intergenic
944183808 2:196926387-196926409 AGGCAGGACGAACCCACAGAAGG + Intronic
944316626 2:198291958-198291980 AGCCAGGTAGGACAGTCAGAAGG - Intronic
944673069 2:202012229-202012251 AGGAAGGAAGGACAGACAGACGG + Intergenic
944843277 2:203643886-203643908 ATTCAGGAGGCTCACACAGAAGG - Intergenic
946158373 2:217821618-217821640 AGGCAGAAAGCATACCCAGATGG - Intronic
946477807 2:220025439-220025461 AGCCAGGCAGCCCAAACAAATGG - Intergenic
947470047 2:230392967-230392989 AGACAAAAAGCACTCACAGAAGG - Intronic
947765911 2:232637201-232637223 AGCCAGGAAACAGGCACAGAAGG - Intronic
948671344 2:239570718-239570740 AGCAGGGAAGCACCCCCAGAAGG - Intergenic
948943621 2:241208448-241208470 AACCAGCACGCAGACACAGAAGG - Intronic
948998555 2:241597688-241597710 AGCCAGGAAGCACACACAGAAGG - Intronic
1168865977 20:1086833-1086855 AGCCAGGAAGCAAAATCAAAGGG - Intergenic
1169098104 20:2921663-2921685 CTACAGGAAGCAGACACAGATGG + Intronic
1169405573 20:5318359-5318381 TCCCGGGAAGCACACACAGGGGG + Intergenic
1170872316 20:20217817-20217839 ATACAAGAAGCAGACACAGAGGG - Intronic
1171784393 20:29449090-29449112 AGCCAGGCTGCACAGGCAGAAGG - Intergenic
1171905507 20:30895699-30895721 AGCCAGAAATCACAGACACAGGG + Intergenic
1174096382 20:48092765-48092787 CGCCAAGCAGCCCACACAGATGG - Intergenic
1175200886 20:57276867-57276889 AGGCAGGCTGCACACACAGGTGG + Intergenic
1176124745 20:63470480-63470502 AGACAGGAAGGAGAGACAGAGGG + Intronic
1176167531 20:63681885-63681907 AGGCAGGAGCCACAGACAGAGGG - Intronic
1177222196 21:18209314-18209336 AGCCAGGAAGTACTCACTGTGGG - Intronic
1177305233 21:19306694-19306716 AGACAGGAAGCACACCCACAGGG + Intergenic
1177498961 21:21925757-21925779 AGCCAGTAGGCACCCACAAAGGG - Intergenic
1178510725 21:33202843-33202865 ACCCAATAAACACACACAGAGGG + Intergenic
1178589299 21:33895970-33895992 TGCCAGGCAGCACACCCAGGAGG + Exonic
1179817563 21:43917433-43917455 AGGCAGAGAGGACACACAGACGG - Intronic
1180180004 21:46113981-46114003 AACGAGGAAGCAGAGACAGAAGG - Intronic
1180203557 21:46242824-46242846 AGCCAGGTTGCAGACGCAGAAGG - Exonic
1180338919 22:11601814-11601836 AGCCAGAAACCACAGACACAGGG + Intergenic
1181031094 22:20149198-20149220 AGCCAGGAAGGAGAAGCAGATGG - Exonic
1181264871 22:21625125-21625147 ATCCAGGAAGCAGAGAGAGAAGG - Intergenic
1182715869 22:32355968-32355990 AGGAAGGAAACACACACAAAAGG - Intronic
1184453949 22:44598674-44598696 AGCCTGGACAGACACACAGACGG + Intergenic
1184843656 22:47067433-47067455 AGCCAGGGTGCACAAAGAGATGG + Intronic
1184900456 22:47443633-47443655 AGCAAGGAAACAAACTCAGAGGG + Intergenic
949841370 3:8323933-8323955 AGCCAGCAAGAACAGAGAGATGG + Intergenic
950621781 3:14211808-14211830 AGACTGGAATGACACACAGAAGG + Intergenic
950677949 3:14565800-14565822 AAACTGGAAGCCCACACAGAGGG + Intergenic
953725878 3:45398506-45398528 GGCCAGGAAGAAAAAACAGAAGG + Intronic
954154263 3:48676415-48676437 ATCCAGCAAGCACAGAGAGATGG - Intronic
959240924 3:103792542-103792564 AGGAAGGAAGGACAGACAGAAGG - Intergenic
959448305 3:106467403-106467425 AGCCAGAGAGCACACACTGTAGG - Intergenic
959942388 3:112092958-112092980 AGGCTGGGAGCACACTCAGAGGG - Intronic
960177202 3:114531868-114531890 ACCCAGGAAGCACACAGGGTTGG + Intronic
960554810 3:119016146-119016168 AGCCAGGAAGGAGGCACAAAGGG + Intronic
961330822 3:126136925-126136947 GTGCAGGAAGCATACACAGATGG + Intronic
961504849 3:127363158-127363180 AGCCAGGCTGTGCACACAGAGGG + Intergenic
961516756 3:127442791-127442813 AGCCAGGAAGCCCCCAGGGAGGG - Intergenic
961941464 3:130641806-130641828 GGCCAAGAAGCAGAGACAGAAGG - Intronic
963063267 3:141241913-141241935 AGTCAAGAATCAGACACAGAGGG - Intronic
964653485 3:159039830-159039852 TACCAGTAAGCAAACACAGATGG - Intronic
964706084 3:159620142-159620164 AGGCAGGGAGCAAGCACAGAGGG - Intronic
965089036 3:164139543-164139565 AGCCAATTAGCAAACACAGATGG - Intergenic
966625353 3:182009770-182009792 AGCCATGGACCACACACAGGAGG - Intergenic
968276042 3:197441105-197441127 AGACAGGGAGCTCAGACAGAAGG + Intergenic
968359478 3:198137331-198137353 AGGCAGCAAGCTCACAGAGAGGG - Intergenic
969150884 4:5167542-5167564 AGGCAGAAAGAACACAGAGAAGG + Intronic
969434821 4:7182780-7182802 ACCCAGGAAGAAAACAGAGAAGG - Intergenic
969673425 4:8601986-8602008 GGCCTGGAAGATCACACAGAGGG + Intronic
969834881 4:9832454-9832476 AGCCAGGCTGGACATACAGATGG - Intronic
969938023 4:10702277-10702299 AGGCAGGAAGAACACTCAGCTGG + Intergenic
970579692 4:17463994-17464016 AGCCAGGCAACAAACCCAGATGG + Intronic
971259359 4:25042416-25042438 AGCCAGGGAGGACACACAGCAGG + Intergenic
971850028 4:31973493-31973515 AGCCAAGTAGCAAACAGAGATGG - Intergenic
972141762 4:35969411-35969433 AGTCAGGAGGGACACACAAATGG - Intronic
974983259 4:68988647-68988669 AGTCAGGAACCCCAAACAGAGGG + Intergenic
975077569 4:70231314-70231336 AACCAGGAACCACATACACAAGG + Intronic
975254825 4:72220850-72220872 ATCTATGAAGCACACACAAATGG - Intergenic
975485553 4:74931529-74931551 ATGCAGGGACCACACACAGATGG - Intergenic
976443120 4:85099381-85099403 CACCAAGGAGCACACACAGATGG - Intergenic
977278164 4:95005386-95005408 AGGCATGTAGAACACACAGATGG + Intronic
977569083 4:98611422-98611444 ATCCAGGCAGCACACACTGGTGG + Intronic
978840422 4:113205798-113205820 AGGAAGGAAACACACACAGTTGG + Intronic
980519511 4:133912117-133912139 AGACGGGAAGAACACACACAAGG + Intergenic
980672909 4:136032626-136032648 AGCCAATAAGCAAACACAGATGG + Intergenic
981183256 4:141770148-141770170 AGGAAGGAAGCACAGACAAAAGG - Intergenic
982691583 4:158553517-158553539 AGCAAGGAAGCAGAGACAGGAGG + Intronic
982893136 4:160881345-160881367 AACCAGCAAGCACAAAAAGAAGG - Intergenic
983482000 4:168286075-168286097 AGCAAGCAAGCACACAGGGAGGG + Intronic
984126166 4:175813501-175813523 AGCCAGCACACACACACACAGGG + Intronic
985548795 5:523089-523111 AGACAGAAAGCAAACACACAAGG + Intronic
986379433 5:7168514-7168536 AGCCAGGAAGAAACCAGAGAAGG - Intergenic
986732210 5:10643472-10643494 AGCGAGGAAGAGTACACAGAGGG - Intronic
986851459 5:11818150-11818172 AGGAAGGAAGGATACACAGATGG + Intronic
988167903 5:27617557-27617579 ACCCAGGAAGCACAAAGAGCTGG - Intergenic
988224678 5:28397972-28397994 AGCTAGCAAGCAGACACAGCTGG - Intergenic
989147619 5:38264408-38264430 AGTCAGGAAGCAAAAACAAAAGG + Intronic
990511892 5:56497177-56497199 AGCCAGGGAGCACCCACAGCAGG + Intergenic
990622163 5:57571468-57571490 AGTCAGGAAGCACACAGAGGAGG + Intergenic
990893710 5:60674887-60674909 GGCCACCCAGCACACACAGAAGG + Intronic
991427011 5:66502970-66502992 AGCCAGCAAATACAAACAGAAGG - Intergenic
992126393 5:73646494-73646516 AGACAGGGAGCACAGAAAGATGG - Intronic
995014973 5:107299708-107299730 AGCCAGGAAGCAGAGGAAGAAGG + Intergenic
995961258 5:117842639-117842661 AGAGAGGAAGCACAAACAGTGGG + Intergenic
996146911 5:119987740-119987762 AGTCAGGGAGCCCAAACAGAGGG - Intergenic
996152536 5:120057731-120057753 AGACAGGAAGGACACACACACGG + Intergenic
996421802 5:123270756-123270778 AGCCACGAAGGAAAAACAGAGGG + Intergenic
996575711 5:124975098-124975120 AGCCAGGAAGAACAGATGGATGG - Intergenic
997549922 5:134743184-134743206 ATCCAGGAAGCATACAGAAAAGG - Intronic
997597883 5:135119264-135119286 AGCCAGGAAGCAGAGACAACGGG - Intronic
999021020 5:148165330-148165352 AGCCAATTAGCAAACACAGATGG - Intergenic
1000050117 5:157555667-157555689 CCCCAGGAAACACACACACAGGG - Intronic
1000113073 5:158127660-158127682 AGAAAGGAAGGACAAACAGAGGG + Intergenic
1000289185 5:159854328-159854350 AGCCAGGAACCACTCAGACAGGG - Intergenic
1001741866 5:174059746-174059768 AACAAGGCAGCACACAAAGAAGG - Intronic
1003745565 6:8997735-8997757 AGCAAGGAAGGACAGACAGATGG - Intergenic
1003899855 6:10644470-10644492 AGGAAGGAAGGACAGACAGAAGG - Intergenic
1004152955 6:13138166-13138188 CACCAGTTAGCACACACAGATGG - Intronic
1005160969 6:22863239-22863261 AGCCAGGATGCAAATCCAGATGG + Intergenic
1006072690 6:31508563-31508585 ATCCAGGAGGCACCCACAGCAGG + Intronic
1006475416 6:34249462-34249484 GGCCAGGGAACAAACACAGACGG - Exonic
1007784671 6:44272745-44272767 GCCCAGGCAGCAAACACAGATGG - Intronic
1007802234 6:44405420-44405442 AGGCAAGAAAGACACACAGAAGG + Intronic
1009335134 6:62478420-62478442 GGCCAGTTAGCAAACACAGATGG + Intergenic
1010165529 6:72910957-72910979 AGCAAAGAAGCTCACACACAGGG + Intronic
1011077917 6:83457910-83457932 AGCCAATTAGCAAACACAGATGG + Intergenic
1012697940 6:102413163-102413185 ATCCAGGAATCACACAAAAAGGG + Intergenic
1013421980 6:109975498-109975520 AGCCAGGAACCAGACACTCAGGG + Intergenic
1013973460 6:116047946-116047968 TGCAAGGAAGCACAAAAAGATGG + Intronic
1014401100 6:120991250-120991272 AATCAGAAAGCACACACTGAGGG - Intergenic
1015265943 6:131292623-131292645 TGCCAGTTAGCAGACACAGATGG + Intergenic
1016320126 6:142833442-142833464 AGACAGGAAGGATAGACAGAAGG + Intronic
1017985850 6:159442643-159442665 AGACAGCAGGCACAGACAGATGG + Intergenic
1019143148 6:169960940-169960962 AGCCAGGCAGCAGACACTGTGGG + Intergenic
1019260521 7:79344-79366 AGACAGCAAGCTCACAGAGAGGG + Intergenic
1019352071 7:559055-559077 AGCCTGGAAGAATAAACAGAAGG - Intronic
1019793244 7:3031068-3031090 AGACAGGAACAACACACAGTGGG - Intronic
1020736385 7:11954091-11954113 AGCCAGTTAGCAAACACAGATGG - Intergenic
1021055083 7:16036947-16036969 AACCAAGAAGATCACACAGAAGG - Intergenic
1021123778 7:16826621-16826643 AGCCAGGCAGTACTCACAGTGGG + Intronic
1024112937 7:46164628-46164650 AGCAGGGAAGCACAGACAGGAGG - Intergenic
1024118216 7:46212666-46212688 TGACAGGAAGCCCACACAGAGGG + Intergenic
1024632971 7:51264284-51264306 AGCCAGGATGCAGCCACACAGGG + Intronic
1024633683 7:51269299-51269321 AGCCAGGATGCATCCACACAGGG + Intronic
1025066236 7:55858110-55858132 AGCCAGGAAGCACTCTCTTAGGG + Intronic
1026546492 7:71327617-71327639 AGACAGGTAGCACACTCAGAAGG + Intronic
1027996030 7:85426612-85426634 AGCCAGTGACCACACACAGAGGG + Intergenic
1029276921 7:99411111-99411133 AGCCGGAAAGCACCCCCAGATGG + Exonic
1029371924 7:100155692-100155714 AGCCTGGAAGGCCACACTGAAGG + Exonic
1030128357 7:106176596-106176618 AGCCAGCACTCACCCACAGATGG - Intergenic
1031425153 7:121596170-121596192 GGCTAGGAAGCACTTACAGATGG - Intergenic
1031784964 7:126018153-126018175 ACCCCAGAAGCACAAACAGAGGG + Intergenic
1032231042 7:130074382-130074404 ATCAAGGAATCACACACAAATGG - Intronic
1032422478 7:131793752-131793774 AGGAAGGAAGCACACAGAGAAGG - Intergenic
1032942488 7:136810821-136810843 AGCCAGGCAGTACTCACAGTGGG + Intergenic
1033259143 7:139827142-139827164 AGACAGGGAGGGCACACAGAAGG - Intronic
1033303690 7:140208966-140208988 AACCAGGGAGCCCACTCAGAGGG - Intergenic
1033848408 7:145463346-145463368 GGCCAGAAAGAAAACACAGAGGG + Intergenic
1034090863 7:148362808-148362830 AGCCAGAATACATACACAGATGG + Intronic
1034103159 7:148468585-148468607 ACCCAGGAAGCAGACACAGATGG - Intergenic
1034548194 7:151802687-151802709 AGGCAGGAAGCAACCACTGAAGG - Intronic
1035111451 7:156485759-156485781 AGACAGGAAGCAAACAGAGGTGG + Intergenic
1035224402 7:157425484-157425506 AGGCAGGAAGCAGAGGCAGAGGG + Intergenic
1036023100 8:4870910-4870932 AGCCAGGTATCACACACTGCAGG + Intronic
1036780759 8:11645650-11645672 AGCCGGGAAGGAAACCCAGAAGG + Intergenic
1036935480 8:12998010-12998032 GGGCAGGAAACACACACAAAGGG - Intronic
1037929323 8:22868389-22868411 AGGCAGGCAGCACACACACCGGG - Intronic
1039742192 8:40393157-40393179 AGCCAGGGCCCACACACAAAAGG + Intergenic
1040352135 8:46580311-46580333 AGCCAGGGACCACGAACAGAGGG + Intergenic
1040512668 8:48108717-48108739 AGTCAGGCAGAACACCCAGAAGG + Intergenic
1042026313 8:64427734-64427756 AGCCAGAAATCAGAAACAGAGGG + Intergenic
1042710151 8:71708357-71708379 GGCCAGGAAGGACACACTGCAGG - Intergenic
1045008117 8:97933589-97933611 TGCCAGAAAGCACACAGAGATGG - Intronic
1045713237 8:105011241-105011263 TGCCAAGAAGCACACCAAGAAGG + Intronic
1046972625 8:120238868-120238890 ATCCAGGAAGCACAAAGAGTTGG - Intronic
1047865310 8:129017365-129017387 AGCCAGGAATAATACTCAGAAGG + Intergenic
1048809302 8:138270717-138270739 AGGCAGGAATCACACCCAGTAGG + Intronic
1049040921 8:140111138-140111160 AAACAGGCAGCACACTCAGAGGG - Intronic
1049192900 8:141298631-141298653 AGCCAGGGAGCCAACCCAGAGGG + Intronic
1049342189 8:142119039-142119061 AGCCAAGGAGCCCACATAGAAGG - Intergenic
1049558359 8:143295089-143295111 AGGAAGGAAGGACAGACAGAAGG + Intronic
1049592496 8:143468955-143468977 AGCCAGGCAGCACCCGCGGAGGG + Intronic
1050622719 9:7471485-7471507 AGCCAGAAAGCACACAGGGCTGG + Intergenic
1052214407 9:25948876-25948898 AGGCAGGAAGGAAACAAAGAAGG - Intergenic
1053510140 9:38680715-38680737 GGGCAGGAAGCACAGAGAGAAGG + Intergenic
1054337366 9:63818318-63818340 AGCCAGGCTGCACAGGCAGAAGG - Intergenic
1055653348 9:78430015-78430037 TGCCAGGCAGGTCACACAGAGGG - Intergenic
1056125801 9:83535858-83535880 AGGAAGGAAGCAAACACAGATGG + Intronic
1056321503 9:85439636-85439658 AAGAAGGATGCACACACAGAGGG - Intergenic
1056388548 9:86119294-86119316 AAACAGGAAGCCCACTCAGAGGG - Intergenic
1056601764 9:88052414-88052436 AGCCCACTAGCACACACAGATGG - Intergenic
1056799172 9:89679663-89679685 AACCAGGATGACCACACAGATGG - Intergenic
1058137978 9:101328312-101328334 AGCCAGGGACCCCACACAGAGGG - Intergenic
1058531767 9:105912952-105912974 AGCCGGGAAGCAAATGCAGAGGG - Intergenic
1059536373 9:115084723-115084745 ACCCAGGAAGCACAGAAAGTTGG - Intronic
1059747232 9:117214750-117214772 AGGAAGGAAGGACACACAAATGG + Intronic
1061605251 9:131705244-131705266 AGCCAGGGAGCACTCACAGAGGG + Intronic
1061986151 9:134131476-134131498 TGCCAGGAGGGACACACAGCAGG - Intergenic
1061986805 9:134134949-134134971 TCCCAGGAAGGACACAGAGAAGG - Intergenic
1062000835 9:134214871-134214893 AGCCAGTGAGGACAGACAGACGG + Intergenic
1062552722 9:137097447-137097469 TGCCAGGATGGCCACACAGACGG - Intronic
1062744166 9:138201045-138201067 AGGCAGCAAGCTCACAGAGAGGG - Intergenic
1203445001 Un_GL000219v1:45970-45992 AGCCAGGCTGCACAGGCAGAAGG - Intergenic
1203364087 Un_KI270442v1:242776-242798 AGCCAGGCTGCACAGGCAGAAGG + Intergenic
1185547686 X:958650-958672 AGCCAGGAAGGAAACTCAGGTGG - Intergenic
1186358076 X:8808251-8808273 AGCCAGGAAGAACAGAAGGAAGG + Intergenic
1186617426 X:11203907-11203929 AGCCAGGAAGAACAGAAGGAAGG - Intronic
1186720352 X:12297071-12297093 AGTCAGTAAGCAGACACTGAAGG - Intronic
1186917021 X:14233918-14233940 ACCCAGGAAGCAAAGAGAGATGG - Intergenic
1186956753 X:14690751-14690773 AGGCAGCAAACACAAACAGAAGG - Exonic
1189200021 X:39186006-39186028 GGCCAGGAAGCTCAAACAGGTGG - Intergenic
1190006864 X:46748406-46748428 AGGAAGGAAGGACAGACAGAAGG + Intronic
1190845449 X:54186639-54186661 TGCCAGGTAGCAGACACAGCTGG - Intergenic
1193463449 X:81817888-81817910 AGCCAGGCAGTACTCACTGAGGG - Intergenic
1193759908 X:85451980-85452002 AGCCAGCTAGCAGACACAGCTGG + Intergenic
1194274594 X:91863672-91863694 AGACAGGAAGGACAGAAAGAAGG - Intronic
1194926623 X:99833354-99833376 AGACAGGAAATACAGACAGAAGG + Intergenic
1195204534 X:102583212-102583234 AGCCATGAAGTACACAAAGCTGG + Intergenic
1196698804 X:118643736-118643758 AACAACAAAGCACACACAGAGGG + Intronic
1197347531 X:125342739-125342761 AGCCAGCAAGCAGATAGAGATGG + Intergenic
1197756387 X:129998247-129998269 ACCCAGGAAGCACAGGCACAAGG - Intronic
1198172109 X:134117376-134117398 ACCCAGGAAGCACAAGCAGTCGG + Intergenic
1199848987 X:151711843-151711865 AGGCAGGAAGGACAGACAGAAGG - Intergenic
1200591834 Y:5085079-5085101 AGACAGGAAGGACAGAAAGAAGG - Intronic
1201408308 Y:13672145-13672167 AGACAAGAAGCAAACACGGAGGG + Intergenic
1201725641 Y:17148012-17148034 AGCCAGGAAGCATAAACAAGTGG - Intergenic
1201960252 Y:19672995-19673017 AGTCAGTAAGCAAACACAGATGG + Intergenic