ID: 948998625

View in Genome Browser
Species Human (GRCh38)
Location 2:241598286-241598308
Sequence CTGGCAAAGGGTGGCCCCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 96}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948998625 Original CRISPR CTGGCAAAGGGTGGCCCCGT GGG (reversed) Intronic
900605390 1:3521449-3521471 CTGGCCAAGGGCTGCCCTGTGGG - Intronic
902535514 1:17117629-17117651 CTGGCAAAGAGAGGCCCAGCTGG - Intronic
903458569 1:23505161-23505183 CTGGGAAAGGGTGGCCAGGGAGG + Intergenic
907626430 1:56034971-56034993 CTGGCCAAGGGTAACCCCATGGG + Intergenic
913995926 1:143652009-143652031 CTGGCGAAGGGTCACCGCGTCGG + Intergenic
915835398 1:159171827-159171849 CTGGGAGAGGTTGGCCCCGCCGG - Exonic
921534221 1:216325502-216325524 GTGCCAAAGGGTGGACCCGCGGG + Exonic
1067431957 10:46251049-46251071 CTGGCCAAGGGTGGCCTCTGAGG - Intergenic
1067441461 10:46311153-46311175 CTGGCCAAGGGTGGCCTCTGCGG + Intronic
1073616297 10:104999695-104999717 ATGGCCAAGGGTGGCCTCCTGGG - Intronic
1074111022 10:110423001-110423023 CTGGCAAGAGCTGGCCCCATGGG + Intergenic
1074861746 10:117515217-117515239 CTGGCAAATGGGGGCCATGTGGG - Intergenic
1077325777 11:1963395-1963417 CTGGAAAGGGATGGGCCCGTTGG + Intronic
1077459315 11:2700708-2700730 CTGGCAAAGGGCAGCGCCGAGGG + Intronic
1083309403 11:61776720-61776742 CAGGGAAAGGGTGGCCCTGGGGG + Intronic
1202808757 11_KI270721v1_random:18574-18596 CTGGAAAGGGATGGGCCCGTTGG + Intergenic
1091823850 12:3494787-3494809 TTGGCAATGGGTGGCCCTGGGGG + Intronic
1101587103 12:106094710-106094732 CTGGCAGTGGGTGGCCTCATTGG - Intronic
1102201978 12:111063529-111063551 CCGGCAAAGGTTGGCCTCATGGG + Intronic
1107337045 13:39366065-39366087 CTGGCAAAGGAGGGCCCCATGGG + Intronic
1112572455 13:100606568-100606590 TTGGCAGAGCGTGGCCCCGCTGG - Intronic
1112625578 13:101099831-101099853 ATGGCAAAGGGTGGCGGCATAGG + Intronic
1113693859 13:112330410-112330432 TTCGAAGAGGGTGGCCCCGTGGG - Intergenic
1115316441 14:32029691-32029713 TTGGCCAAGGGTTGCCCTGTAGG + Intergenic
1116340671 14:43719265-43719287 CTGCTAAAGGGTGGCTCCGAGGG + Intergenic
1122841105 14:104463616-104463638 TTGACAAAGGGTGGACTCGTGGG - Intergenic
1125096572 15:35860371-35860393 CTGGCAAGTGGTGGCCACTTGGG - Intergenic
1129670824 15:77606802-77606824 CTGGGAATGGGTGTCCCCCTGGG + Intergenic
1135940797 16:26820054-26820076 CTGGCATAGGCTGGCTCAGTGGG - Intergenic
1136361874 16:29785787-29785809 AAGGCAAAGGGTGTCCACGTGGG + Intergenic
1137618300 16:49859161-49859183 GTGGAAAAGGGCAGCCCCGTGGG - Intergenic
1139006012 16:62572448-62572470 CTGGAAAAGGATGGCTCCTTCGG - Intergenic
1143646742 17:8235130-8235152 CTCGTACAGGGAGGCCCCGTAGG + Exonic
1144944993 17:18965275-18965297 GTGGCAAAGGGGAGCCCCGGAGG + Intronic
1148352493 17:46950883-46950905 CTTGCCAAGGGTGACCCAGTCGG + Intronic
1148835373 17:50463172-50463194 GTGGGAGAGGGTGGCCCCCTTGG - Exonic
1149656491 17:58312019-58312041 GTGGCAGAAGGTGGCCCAGTAGG + Exonic
1151336759 17:73444454-73444476 CTGGCATAGGGTGGGCCCTGGGG + Intronic
1161073339 19:2273134-2273156 CTGACAAGGGGTGGCCCCAGGGG - Exonic
1161535604 19:4817091-4817113 CTCGCAGAAGGTGGCCCCGTCGG + Exonic
1161842840 19:6693322-6693344 CTGGCCAGGGGTGGTCCCTTAGG - Intronic
1164585944 19:29476157-29476179 GGGGCAAAGGGTGGCCTCCTGGG - Intergenic
1165761954 19:38326780-38326802 CTGGCACTTGGTGGCCCTGTTGG + Exonic
1168241490 19:55091289-55091311 CTGGCCTCGGGTGGCCCCCTCGG + Exonic
925305836 2:2847475-2847497 CTGGCCAGGGGTGGCCCTGCAGG - Intergenic
928412674 2:31066784-31066806 CTGGCATTGTGTGGCACCGTGGG - Intronic
929570849 2:43022050-43022072 CTGGCCAAGGGAGGCCCAGAGGG - Intergenic
932342991 2:70978562-70978584 CTGGCAAGGAGTGGCCCCCGGGG + Intronic
932490245 2:72115653-72115675 CCGGGAAAGGGTGGCACCGAGGG + Intergenic
932579131 2:72982253-72982275 CTGGAAAGGGGTGGGCCCATTGG + Intronic
937289985 2:120776341-120776363 CTTCCAAAGGGAGGCCCAGTGGG + Intronic
947838276 2:233190460-233190482 CGGGCAGAGGGTGGCTCCTTGGG - Intronic
948166036 2:235863511-235863533 GTGGCTGAGGGTGGCCCTGTGGG + Intronic
948643277 2:239388597-239388619 CTGCCAAAGGGGGGCCCAGAGGG - Intronic
948675801 2:239595902-239595924 CTGGCAGACTGGGGCCCCGTGGG - Intergenic
948998625 2:241598286-241598308 CTGGCAAAGGGTGGCCCCGTGGG - Intronic
1173689267 20:44947209-44947231 CTGGCAAATTGTGGCCCCTCTGG + Intronic
1174378860 20:50143666-50143688 CAGGCAGAGTGTGGCCCCATGGG + Intronic
1174475932 20:50795434-50795456 CTGGCAAAGGGCGGCGCCTGAGG - Intronic
1174645438 20:52081300-52081322 TTGGCAAACGGTGGCCCCACAGG - Intronic
1175407701 20:58745539-58745561 CTGGCAAAGTGTGGGCCATTGGG - Intergenic
1175852304 20:62100123-62100145 CCGGCAGAGGGTGGTCCCCTGGG + Intergenic
1176235340 20:64051129-64051151 CTGGCTAATGGGGGGCCCGTGGG + Intronic
1178741440 21:35205777-35205799 CTGGCCTAGGGTAGCCACGTGGG + Intronic
1181576977 22:23801423-23801445 CTGGGAAATGGTGGCACAGTGGG - Intronic
1182475428 22:30574280-30574302 CTGCCAGAGGGTGGCCTGGTAGG - Intronic
1183705331 22:39472124-39472146 CTTGCTAAGGGTGGACCCTTGGG + Intronic
1184855674 22:47145201-47145223 CTGCCAAAGGTTGGCCCAGGTGG + Intronic
954373653 3:50183280-50183302 GTGGCAGGGAGTGGCCCCGTTGG + Intronic
955744429 3:62125959-62125981 CTGGCAAATGGTACTCCCGTGGG - Intronic
960596838 3:119414760-119414782 CTGGCGAAGGCTGGGCCTGTGGG - Exonic
961104966 3:124233104-124233126 CTGGCAAAGGGTGGCTTGGAGGG - Intronic
961318531 3:126056849-126056871 CTGGCAGAGGGAGGTCCCGGCGG - Intronic
963001126 3:140682815-140682837 CTGGCAGAGGATGGGCCCGGAGG - Exonic
965372396 3:167879747-167879769 CTGGCAAAGGCTCTCCCCTTGGG - Intergenic
986296822 5:6446333-6446355 CTGGCACAGGGGGTCCCCGCTGG + Intergenic
988312032 5:29571816-29571838 CTGGCTAAGGGTGGCAGCATAGG - Intergenic
990285896 5:54300363-54300385 CTGGACAAGGGTGGCCCCCTGGG - Intronic
995313468 5:110739345-110739367 CTGGAAAAGGGTTCCTCCGTGGG - Exonic
1006599786 6:35217717-35217739 GCGGGTAAGGGTGGCCCCGTGGG + Intronic
1007720168 6:43880123-43880145 TGGGCACAGGGTGGCCCAGTAGG - Intergenic
1018123649 6:160661009-160661031 GTGGCAAAGGGTGGCCAAGTGGG + Intronic
1026223209 7:68418299-68418321 CTGGCAAAGGATTTCCCCTTGGG - Intergenic
1028540814 7:91940756-91940778 CTGGCAAGGGTTGACCCCGGAGG + Intergenic
1029546384 7:101212539-101212561 CAGGAAAAGGGTGACCCTGTCGG + Exonic
1031020812 7:116625678-116625700 CTTTCAATGGGTGGCCCCTTGGG + Intergenic
1032083363 7:128870782-128870804 CAGGCAAAGGCTGGCCCCTGGGG - Intronic
1032470599 7:132175714-132175736 GTGGCAGAGGGTGGCCCTGGGGG - Intronic
1034391315 7:150789821-150789843 CTGGCTAAGTGAGGCCCCATAGG + Intergenic
1034499377 7:151440070-151440092 GTGGCACAGGGTGGCCGCGGCGG - Intronic
1036619728 8:10416518-10416540 GTGGCAAAGGGTGGACAAGTAGG + Intronic
1046588340 8:116175539-116175561 CTACCAAATGCTGGCCCCGTTGG - Intergenic
1048003584 8:130400236-130400258 CTGGCACAGGGTTGACCTGTTGG - Intronic
1048214200 8:132480685-132480707 CAGGCAAAGGCGGGCCCCCTGGG + Exonic
1059246967 9:112856890-112856912 CTGGCAGAGGGTGGCTGCGGTGG - Intronic
1060927864 9:127467875-127467897 CTGGCACAGGGTGGCCATGGGGG - Intronic
1060992447 9:127856793-127856815 GAGGCAAAGGGTGGCTCGGTGGG + Intergenic
1061571400 9:131479648-131479670 CTGGAAAAGGATGGCCCCTTGGG + Intronic
1061952309 9:133943355-133943377 GTGGCAAAGGGAGGCCCAGATGG + Intronic
1195029775 X:100915028-100915050 ATTGCAAAGGGTGGCCCCATAGG + Exonic
1197833485 X:130670497-130670519 CTGGCTGAGGTTGGCTCCGTGGG + Intronic
1201614023 Y:15875921-15875943 GTGGCCAAGGGTGGCGCCATTGG - Intergenic
1201616345 Y:15903859-15903881 GTGGCCAAGGGTGGCGCCATTGG + Intergenic