ID: 948999212

View in Genome Browser
Species Human (GRCh38)
Location 2:241602792-241602814
Sequence AGCTACACAGTCGGCCCCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 32
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 28}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948999203_948999212 29 Left 948999203 2:241602740-241602762 CCTCATGGTCAGGGGGCTGCACG 0: 1
1: 0
2: 3
3: 10
4: 111
Right 948999212 2:241602792-241602814 AGCTACACAGTCGGCCCCGCAGG 0: 1
1: 0
2: 0
3: 3
4: 28
948999207_948999212 -9 Left 948999207 2:241602778-241602800 CCGGAGGCCCCTACAGCTACACA 0: 1
1: 0
2: 1
3: 20
4: 214
Right 948999212 2:241602792-241602814 AGCTACACAGTCGGCCCCGCAGG 0: 1
1: 0
2: 0
3: 3
4: 28
948999202_948999212 30 Left 948999202 2:241602739-241602761 CCCTCATGGTCAGGGGGCTGCAC 0: 1
1: 0
2: 0
3: 14
4: 142
Right 948999212 2:241602792-241602814 AGCTACACAGTCGGCCCCGCAGG 0: 1
1: 0
2: 0
3: 3
4: 28
948999206_948999212 -1 Left 948999206 2:241602770-241602792 CCTGTGTGCCGGAGGCCCCTACA 0: 1
1: 0
2: 1
3: 12
4: 81
Right 948999212 2:241602792-241602814 AGCTACACAGTCGGCCCCGCAGG 0: 1
1: 0
2: 0
3: 3
4: 28

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948999212 Original CRISPR AGCTACACAGTCGGCCCCGC AGG Intronic