ID: 948999916

View in Genome Browser
Species Human (GRCh38)
Location 2:241607350-241607372
Sequence CGTGCATCCAGCCAGGGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 149}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948999916_948999927 18 Left 948999916 2:241607350-241607372 CCCTCACCCTGGCTGGATGCACG 0: 1
1: 0
2: 1
3: 12
4: 149
Right 948999927 2:241607391-241607413 TTTCTAAGGGAGACCTGTGCGGG 0: 1
1: 0
2: 1
3: 23
4: 133
948999916_948999929 27 Left 948999916 2:241607350-241607372 CCCTCACCCTGGCTGGATGCACG 0: 1
1: 0
2: 1
3: 12
4: 149
Right 948999929 2:241607400-241607422 GAGACCTGTGCGGGGACCACAGG 0: 1
1: 0
2: 0
3: 7
4: 141
948999916_948999926 17 Left 948999916 2:241607350-241607372 CCCTCACCCTGGCTGGATGCACG 0: 1
1: 0
2: 1
3: 12
4: 149
Right 948999926 2:241607390-241607412 TTTTCTAAGGGAGACCTGTGCGG 0: 1
1: 1
2: 4
3: 13
4: 169
948999916_948999924 4 Left 948999916 2:241607350-241607372 CCCTCACCCTGGCTGGATGCACG 0: 1
1: 0
2: 1
3: 12
4: 149
Right 948999924 2:241607377-241607399 CTGCTCTTACTCATTTTCTAAGG 0: 1
1: 0
2: 0
3: 31
4: 328
948999916_948999928 19 Left 948999916 2:241607350-241607372 CCCTCACCCTGGCTGGATGCACG 0: 1
1: 0
2: 1
3: 12
4: 149
Right 948999928 2:241607392-241607414 TTCTAAGGGAGACCTGTGCGGGG 0: 1
1: 0
2: 0
3: 12
4: 92
948999916_948999925 5 Left 948999916 2:241607350-241607372 CCCTCACCCTGGCTGGATGCACG 0: 1
1: 0
2: 1
3: 12
4: 149
Right 948999925 2:241607378-241607400 TGCTCTTACTCATTTTCTAAGGG 0: 1
1: 0
2: 1
3: 32
4: 261

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948999916 Original CRISPR CGTGCATCCAGCCAGGGTGA GGG (reversed) Intronic
900534630 1:3170758-3170780 TGTGCCTCCAGCCCTGGTGACGG - Intronic
900608593 1:3534935-3534957 CCCGCGTCCATCCAGGGTGAGGG + Intronic
906568294 1:46815860-46815882 CAGGCAGCCAGCAAGGGTGAAGG - Intronic
909417811 1:75427117-75427139 CATGCATCAAGTCAAGGTGATGG - Intronic
910615214 1:89190106-89190128 CGTGCATGCAGCCTGTGAGAGGG - Exonic
913200081 1:116488815-116488837 AGGTCACCCAGCCAGGGTGAAGG + Intergenic
914832232 1:151178798-151178820 TGTGCAGCCAGCCAGAGGGATGG - Intronic
919886967 1:201941834-201941856 CCTGTACCCAGCCAGGGTCAGGG - Intronic
923660140 1:235950555-235950577 TGTGCATCGGGCCAGGGGGAAGG + Intergenic
1064097745 10:12436367-12436389 CCTTCATCCAGCGAGGCTGAGGG - Intronic
1066373312 10:34835897-34835919 CAGACATCCAGCCATGGTGAAGG - Intergenic
1070758114 10:79006001-79006023 GGAGCATCCAGCCTGGCTGAGGG - Intergenic
1073443661 10:103568190-103568212 TGTGCTGCCAGCCAGGGTGCTGG + Intronic
1073638493 10:105223795-105223817 CCTACTTCCAGCCATGGTGATGG + Intronic
1074142535 10:110686586-110686608 ACTGCATCCAGCCTAGGTGATGG + Intronic
1075025570 10:118980756-118980778 TGTCCCTTCAGCCAGGGTGAGGG - Intergenic
1075416373 10:122267540-122267562 AGTGCACCCAGCCAGGGTCCAGG - Intergenic
1076215381 10:128688931-128688953 TGTGGATCCAGACAAGGTGAAGG - Intergenic
1076296179 10:129386562-129386584 CTGGAGTCCAGCCAGGGTGATGG - Intergenic
1076530160 10:131139385-131139407 CATGCATCCAGACAGGGCAAGGG + Intronic
1076646287 10:131957280-131957302 CCTTCATCTAGACAGGGTGACGG - Intronic
1077140096 11:1020475-1020497 CGTGGGTCCAGCCAGGGCCATGG + Intronic
1077539370 11:3139391-3139413 CGAGCAACCTGCCAGGATGATGG + Intronic
1079289678 11:19175921-19175943 CTTTCACCCAGCCAGGGAGAAGG + Exonic
1081658858 11:44875487-44875509 TGTGCAACCAGCTAGGATGAGGG - Intronic
1081983843 11:47287440-47287462 ACTCCATCCAGCCTGGGTGACGG - Intronic
1083233210 11:61336234-61336256 CCTGCATCCAGCCAGGGCCAGGG - Intronic
1083772745 11:64877698-64877720 GGTGCATCCAGCCTGCGGGACGG + Intronic
1088246478 11:107822780-107822802 TGTGCATGCAGCCAAGGAGAAGG + Intronic
1089169802 11:116504060-116504082 CCTCCATCCAGGCAGGGCGAGGG + Intergenic
1089192091 11:116660604-116660626 CCTGCACCCAGCCAGGGGGATGG + Intergenic
1089733449 11:120534021-120534043 CGTGCCTCCAGCCTGTGTCAGGG - Intronic
1091205265 11:133816649-133816671 TGTGCATCCTGCCAGTGTGGAGG + Intergenic
1096259060 12:50079759-50079781 TTAGCATCCAGGCAGGGTGAAGG + Intronic
1096264453 12:50111991-50112013 CCGGCCTCCAGCCAGAGTGACGG + Exonic
1099475181 12:83099950-83099972 ACTACATCCAGCCTGGGTGACGG - Intronic
1102015746 12:109646804-109646826 GGGGCATCCAGACAGGGTGGTGG - Intergenic
1102959851 12:117085391-117085413 GGTGCAGCCGCCCAGGGTGAGGG + Intronic
1102967687 12:117140939-117140961 GGTGCATCCTGCCGGGGTGCTGG - Intergenic
1103938655 12:124490034-124490056 CGTGAATGCAGCCAGGGTCTAGG - Intronic
1104633731 12:130425114-130425136 CATGCATCCAGCCAAGGAGAGGG + Intronic
1105455587 13:20538328-20538350 ACTGCATTCAGCCTGGGTGATGG + Intergenic
1111062747 13:83044933-83044955 TTTGCATCCAGCGAGGGTGGAGG - Intergenic
1112108070 13:96264009-96264031 CTAGGAGCCAGCCAGGGTGAGGG + Intronic
1112429093 13:99333983-99334005 AATGCATCCAGCCTGGGTGACGG - Intronic
1115732427 14:36285686-36285708 AGGGCATGCAGTCAGGGTGATGG + Intergenic
1118878176 14:69802558-69802580 ACTGCATCCAGCCTGGGTGACGG + Intergenic
1120264155 14:82227887-82227909 CATGCATCCAGTCAGTGTCATGG - Intergenic
1122995463 14:105261490-105261512 CGTGCAGCCAGCCAGGGTGTGGG - Intronic
1124123313 15:26911353-26911375 TGTGCATGCAGCAAGGGTGGGGG - Intronic
1124164977 15:27318398-27318420 CTTGCACCCTGCCAGGGAGATGG + Intronic
1125427039 15:39558687-39558709 ACTGCATCCAGCACGGGTGAGGG - Intergenic
1128363748 15:66982245-66982267 AATTCACCCAGCCAGGGTGAGGG + Intergenic
1128687836 15:69699945-69699967 CCTGCATCCAGCCAGGTGAACGG - Intergenic
1129265999 15:74393388-74393410 CCTGCTTCCAGGCAGGGTGAAGG + Intergenic
1130859109 15:87870476-87870498 GGTGCATACTGCCTGGGTGATGG + Intronic
1132987953 16:2777642-2777664 CTCGCATCCAGCCCGGGTCAGGG - Intergenic
1133775961 16:8895276-8895298 CCTGGATCCAGCCAGAGTGATGG + Intronic
1134452012 16:14369406-14369428 CCTGTGCCCAGCCAGGGTGATGG - Intergenic
1135709601 16:24704044-24704066 ACTGCACCCAGCCTGGGTGATGG + Intergenic
1137669095 16:50269002-50269024 ACTCCATCCAGCCTGGGTGACGG + Intronic
1142688905 17:1593052-1593074 GGTGCATCCTGCCCGGGTGGGGG + Intronic
1143941876 17:10551065-10551087 AGAGCATCCAGCCAGAGTAAAGG - Intergenic
1145207051 17:20990147-20990169 CACCCATCCAGCCAGGGTGGTGG - Intergenic
1145786438 17:27596996-27597018 CGTGGTCCCAGCCAGGGTGCAGG + Intronic
1145957996 17:28868099-28868121 TGTGCATAGAGCCAGGGTGTGGG - Intergenic
1145978400 17:28997445-28997467 AGAGCAGCAAGCCAGGGTGAAGG + Intronic
1146303165 17:31707242-31707264 ACTCCATCCAGCCTGGGTGATGG + Intergenic
1147585271 17:41651025-41651047 CGGCCTTCCAGGCAGGGTGATGG + Intergenic
1147646166 17:42035443-42035465 CCTGCATGAAGCCTGGGTGATGG - Intronic
1147900130 17:43778563-43778585 CGTGCACCCCGCCACGGGGAAGG + Intronic
1148031447 17:44624063-44624085 ACTGTATCCAGCCTGGGTGATGG + Intergenic
1150625203 17:66836822-66836844 GGTGCAGCCAGCCAGGATGCTGG - Intronic
1152375453 17:79916347-79916369 CGTGCAAACAGCCAGGGGGCAGG - Intergenic
1153228227 18:2913559-2913581 ACTGCATCCAGCCAGGCTGCAGG + Exonic
1153588184 18:6645357-6645379 AGTGAATCCAGGCATGGTGATGG - Intergenic
1155072008 18:22325002-22325024 TGTGCATGCAGGCAGGGTAAAGG - Intergenic
1158197822 18:54908753-54908775 ACTGTATCCAGCCTGGGTGACGG - Intronic
1158501919 18:58010091-58010113 ACTCCATCCAGCCTGGGTGACGG + Intergenic
1159490955 18:69133459-69133481 ACTGCATTCAGCCTGGGTGATGG + Intergenic
1160246708 18:77165431-77165453 CCTGCATCCAGGCACAGTGAAGG - Intergenic
1160583381 18:79900131-79900153 CCTGCCTCCAGCCAGGGAGGAGG + Intronic
1161387087 19:4000888-4000910 ATTGCACCCAGCCTGGGTGACGG + Intergenic
1162558964 19:11404992-11405014 CGTGCAACCCGCCAGGGACAAGG + Intronic
1165103982 19:33457913-33457935 CGTGAATCCAGCCTGGGAGCAGG - Intronic
1165313689 19:35042355-35042377 CGTCCATCCAGGCAGGCTGTAGG - Exonic
1165858311 19:38893559-38893581 CGGGCATTCAGCCAGGGGCATGG + Intronic
1167621503 19:50563434-50563456 CCTTCACCCAGCAAGGGTGATGG + Intronic
926008620 2:9391610-9391632 ATTGCATCCAGCCTGGGCGATGG - Intronic
926117464 2:10222398-10222420 CAGGCATCAGGCCAGGGTGATGG + Intergenic
926171553 2:10555939-10555961 CTTGCAGCCACACAGGGTGAAGG - Intergenic
926364905 2:12124094-12124116 CGGGCAGCCTGCCTGGGTGAGGG - Intergenic
926754641 2:16225263-16225285 CATGCAGCCACCCTGGGTGAAGG - Intergenic
935534218 2:104274145-104274167 CGGGCTTCCAGCCAGGATGGGGG - Intergenic
936403277 2:112182153-112182175 CGTGATTCCAGCCAGGGCGGAGG - Intronic
938099337 2:128487565-128487587 CCTGCATTCAGCCAGAGAGAAGG + Intergenic
943764324 2:191644413-191644435 ACTGCTTCCGGCCAGGGTGATGG + Intergenic
944772093 2:202924887-202924909 GGTGCATACAGCCTGGGTGTTGG - Intronic
948106426 2:235417782-235417804 GGAACATCCAGCCAGTGTGAAGG - Intergenic
948507085 2:238435623-238435645 TGTCCATGCTGCCAGGGTGAGGG + Intronic
948730315 2:239959335-239959357 CGTGCAACCACCAAGGTTGAAGG + Exonic
948999916 2:241607350-241607372 CGTGCATCCAGCCAGGGTGAGGG - Intronic
1169388782 20:5172880-5172902 CCTGCTCCCAGCCTGGGTGAGGG - Intronic
1172901919 20:38341505-38341527 ACTCCATCCAGCCTGGGTGATGG + Intergenic
1173331250 20:42077971-42077993 GGTACATCCAGACAGGATGAGGG - Exonic
1175849421 20:62080862-62080884 CTTGAAACCAGCCAGGGTGGGGG + Intergenic
1175926129 20:62472462-62472484 CTGGCCTCCACCCAGGGTGACGG + Intronic
1176000492 20:62829366-62829388 CGTGCACGCAGGCAGGGTGCAGG - Intronic
1178906696 21:36642602-36642624 CCTGCTTCCAGCCAGGGGAAGGG + Intergenic
1179289691 21:40007735-40007757 TGTGCTTCCACTCAGGGTGAGGG + Intergenic
1179722157 21:43321995-43322017 GGAGCATCCAGCGAGGGTTAGGG - Intergenic
1180945317 22:19689254-19689276 CCTGCATCCAGCCAAGCTGAGGG - Intergenic
1183846165 22:40541953-40541975 ACTGCATCCAGCCTAGGTGATGG + Intronic
1184437104 22:44485782-44485804 CTTGAATCCAGCCAGTGAGAGGG + Intergenic
1184838798 22:47040467-47040489 GGTGAATTCAGCCAGGATGAGGG + Intronic
951133920 3:19081200-19081222 CATGCTTCCAGCAAGGGAGAAGG + Intergenic
952875980 3:37944812-37944834 CGTGCCTCCAGACAGGGAAAGGG - Intronic
953958978 3:47252655-47252677 CGTCCACCCAGCCAGGTTCACGG + Intronic
954019149 3:47723435-47723457 ACTGCAACCAGCCAGGGTGACGG + Intronic
964681018 3:159338712-159338734 CATGAATCCAGCCAAGCTGAAGG + Intronic
965903110 3:173668654-173668676 ACTCCATCCAGCCTGGGTGACGG - Intronic
967917779 3:194591647-194591669 CATGCCTCCAGCCTGGGTGATGG - Intronic
970368873 4:15388354-15388376 CGTCCATCCAGCCAGAATGGTGG + Intronic
972451725 4:39206863-39206885 CCTGAACCCAGCCAGGTTGATGG + Intronic
974038712 4:56839637-56839659 ACTGCATCCAGGCTGGGTGACGG + Intergenic
977511228 4:97965269-97965291 GCTGCAGCCAGCCAGGGGGAGGG + Intronic
984944286 4:184959141-184959163 TGTGTCTCCAGCCAGGGTGCTGG + Intergenic
985854364 5:2413421-2413443 CGTGGCTCCAGGGAGGGTGAGGG - Intergenic
990204370 5:53413470-53413492 CGTGCTGCCAGCCAGGGGAAAGG - Intergenic
993621720 5:90176813-90176835 ACTGCATCCAGCCATGGTGGTGG - Intergenic
1002078988 5:176726704-176726726 CCTGCATCCTGCCTGGGTGCTGG - Intergenic
1003345322 6:5261083-5261105 CGTGCATCCAGCCAAGCTCCTGG + Exonic
1006429781 6:33988543-33988565 GGTGCATCCAGCCTGGGGGCGGG - Intergenic
1007229680 6:40339629-40339651 TCTGTATCCAGGCAGGGTGAAGG + Intergenic
1012321731 6:97856095-97856117 CATGCATCCAGACAGAGTGTAGG + Intergenic
1013175041 6:107669532-107669554 GCTGAATACAGCCAGGGTGAGGG - Intergenic
1016096617 6:140045340-140045362 CATGCTTCCAACTAGGGTGAGGG + Intergenic
1017356995 6:153521205-153521227 ACTGCATCCAGGCAGGGGGAGGG - Intergenic
1019264491 7:105926-105948 CATACATCCAGCCAGGCTAAGGG + Intergenic
1019640921 7:2103235-2103257 CGTCCATCCGGCCACGCTGAGGG + Intronic
1019679029 7:2334364-2334386 CTGGACTCCAGCCAGGGTGACGG + Intronic
1024268018 7:47621501-47621523 AGTGGAGCCAGCCAGGGTGTGGG + Intergenic
1032961007 7:137033856-137033878 ACTGCATCCAGCCTGGGTGACGG + Intergenic
1033078773 7:138274477-138274499 AGTGCATCCTGCTTGGGTGATGG + Intergenic
1035036020 7:155894459-155894481 CCTGCATCGAGCCAGGCTAATGG + Intergenic
1036213635 8:6862463-6862485 CGTCCAGCCGGCCAGCGTGAAGG - Intergenic
1036569204 8:9964987-9965009 AGTGCATCCAGCCTGGGTCATGG + Intergenic
1040021845 8:42747834-42747856 AGTGCTCCCAGCCAGGGTCAAGG - Intergenic
1043284834 8:78516058-78516080 AGTCCATGCAGCCGGGGTGACGG + Intergenic
1049574685 8:143384697-143384719 CCTGCTGCCAGCCAGGGGGAGGG + Intergenic
1054751503 9:68911843-68911865 ACTGCCTCCAGCCTGGGTGATGG + Intronic
1056284923 9:85078100-85078122 CCTCCCTCCAGCCTGGGTGAAGG - Intergenic
1056572326 9:87826464-87826486 TGTGCATCCAGTCAGGGAGCAGG - Intergenic
1057937580 9:99253826-99253848 TGTGCATCCAGGCAGGAGGAGGG - Intergenic
1060050883 9:120377366-120377388 AGTGCCTCCAGCCAGGATGCGGG + Intergenic
1060091563 9:120747809-120747831 AGTGCCTGCAGCCTGGGTGAAGG + Intergenic
1061419688 9:130466523-130466545 CGTCCAGCCAGCCCCGGTGAGGG + Intronic
1061850812 9:133414105-133414127 ACTGCCTCCAGCCTGGGTGACGG - Intronic
1062561172 9:137142725-137142747 TGTGCACGCAGCCAGGGTGGTGG + Intronic
1191135540 X:57059977-57059999 ACTGCACTCAGCCAGGGTGATGG - Intergenic
1191222827 X:58008661-58008683 CGTGCACACAGCTTGGGTGATGG - Intergenic
1197589389 X:128389956-128389978 AGTGCATACAGCGTGGGTGATGG + Intergenic
1198703426 X:139421329-139421351 CCTGCATCCAGGCAGAGTTAGGG - Intergenic