ID: 949003001

View in Genome Browser
Species Human (GRCh38)
Location 2:241628129-241628151
Sequence CAGAATGGAGAGAAGGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 863
Summary {0: 1, 1: 0, 2: 1, 3: 87, 4: 774}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949003001 Original CRISPR CAGAATGGAGAGAAGGGGGC TGG (reversed) Intronic
900129195 1:1080449-1080471 CAGAATTGAGAGATGGGGCCTGG + Intergenic
900395698 1:2452426-2452448 CAGGAGGGAGAGCAGGAGGCAGG - Intronic
900408821 1:2503857-2503879 CAGAAGAGAGAGAGGGAGGCAGG - Intronic
900427672 1:2587855-2587877 CAGCAGGGAGAGGAGGTGGCAGG - Intronic
900576326 1:3384256-3384278 CAGGAGGGAGGGCAGGGGGCAGG - Intronic
900658322 1:3771108-3771130 CAGAATGCGGAGCCGGGGGCAGG - Intronic
901150009 1:7095062-7095084 AAGAAAGGAGGAAAGGGGGCTGG - Intronic
901186357 1:7375869-7375891 CAGGGTGGACAGAAGGGGGCAGG + Intronic
901235944 1:7667665-7667687 CAGAAAGGACAGAAGGAGTCAGG - Intronic
901625494 1:10622290-10622312 CAGAAGGGAGAGGAAGGCGCAGG - Intronic
901720775 1:11195465-11195487 GAGAAAGGAGTGAAGGAGGCAGG + Exonic
901753889 1:11429275-11429297 GAGAAAGGGGAGAAGGTGGCAGG + Intergenic
902029668 1:13412767-13412789 CCGAATGGAGACATGGGTGCGGG + Intronic
902286834 1:15412594-15412616 GGGAAAGGAGAGACGGGGGCTGG - Intronic
902546497 1:17193742-17193764 CAGGCTGGAGAGCAGGGGGTGGG + Intergenic
902546519 1:17193842-17193864 CAGAAAAGAGAGCAGGAGGCAGG + Intergenic
902680366 1:18039692-18039714 GAGAAAGCAGAGAAGGGGGCTGG + Intergenic
902680546 1:18041105-18041127 GAGAAGGCAGAGAAGGGAGCTGG + Intergenic
903420253 1:23213852-23213874 CAGAAAGCAGAGAGAGGGGCTGG - Intergenic
903433955 1:23332123-23332145 CTGAATGGAGAGAGGGGAGAGGG + Intronic
903639384 1:24848259-24848281 CAGGAAGGAGGGAAGGAGGCCGG - Intergenic
903759414 1:25687404-25687426 CAGGCTGCAGACAAGGGGGCTGG - Intronic
903864761 1:26389918-26389940 CAGAATGAGGAGGAAGGGGCAGG + Intergenic
903955399 1:27022008-27022030 CAGAAGGAAGATAAGGGGGAGGG + Intergenic
904277928 1:29396284-29396306 CAGAAAGGAGAGGCGGGGGTTGG - Intergenic
904449598 1:30602321-30602343 CAGAAGGGAGTGGATGGGGCAGG - Intergenic
904604693 1:31692042-31692064 CAGAAAGGCGAGAAGGGCGACGG - Exonic
904943501 1:34181896-34181918 CAAAATGGAGAGCAAGGGCCAGG + Intronic
905017576 1:34788126-34788148 CAGCCTGGAGAAAAGGGGCCAGG - Intronic
906061176 1:42949644-42949666 TAGAACTGAGAGGAGGGGGCTGG + Intronic
906196605 1:43933959-43933981 AAGAAAGGAGAGGAGGGGGGTGG - Intronic
906323297 1:44829543-44829565 CAGGGTGGATAGGAGGGGGCAGG + Intronic
906521804 1:46471224-46471246 CTGAATGGAGAGAAGAGGCTGGG + Intergenic
906566213 1:46803044-46803066 CAGAATGGAGAGGATGAGGCTGG + Intronic
906728146 1:48058909-48058931 CAGAAGGGAGGGGAGGGGCCAGG + Intergenic
907581590 1:55577216-55577238 GTGTCTGGAGAGAAGGGGGCTGG - Intergenic
907849978 1:58247151-58247173 CAGAATGGGGGCAAGGAGGCTGG + Intronic
908318839 1:62961628-62961650 CAGAATGGGGAGGAGGGGGGTGG - Intergenic
909343562 1:74558605-74558627 CAGAAGGGACAGAAGGGAGAAGG - Intergenic
910538518 1:88327867-88327889 TACAATGGAGAGAAGGCGGCTGG - Intergenic
910593424 1:88952513-88952535 CAGGAGGGAGAGAAGTGGGGAGG - Intronic
911068501 1:93813135-93813157 CAGAATGGAGCTCTGGGGGCTGG - Intronic
911200546 1:95039312-95039334 GAGAATGGACAGAAGGGGAGAGG + Intronic
911887350 1:103320905-103320927 CGGAAAGGATAGTAGGGGGCTGG - Intergenic
912229385 1:107774682-107774704 CAGGATGGAGTGGAGAGGGCAGG - Intronic
912661907 1:111539242-111539264 GAGAGGGGAGAGAAGGAGGCAGG - Intronic
912698816 1:111861151-111861173 CAGAAAGGAGGAAGGGGGGCGGG + Intronic
913286017 1:117227480-117227502 CATAATGGACAGAAGTGGGAGGG + Intergenic
913405421 1:118485732-118485754 CTGCATGGAGATAAGGAGGCAGG - Intergenic
913673109 1:121116553-121116575 AAGGATGGAGGGAAGGAGGCGGG - Intergenic
915730810 1:158052882-158052904 CAGAAGGCAGAGAGGGGAGCTGG + Intronic
916075631 1:161198541-161198563 CACAATGGGGAGCAGGAGGCAGG + Exonic
916610747 1:166389211-166389233 CAGTATGGATAGATGGCGGCTGG + Intergenic
916714551 1:167438382-167438404 CAGAATGGAGCCAAGGAGGAAGG + Intronic
916788460 1:168104022-168104044 CTGAAAGGAGAGCAGGGGGAAGG - Intronic
916818746 1:168377979-168378001 CAGAATGGGGACAATGTGGCTGG + Intergenic
917471639 1:175330805-175330827 CAGATTAGAGAGAAAGGGACTGG - Intronic
917842799 1:178995671-178995693 CAGAAGGCAGAGGAGAGGGCAGG - Intergenic
918078702 1:181189959-181189981 CAAAAGGGAGAGAAGGTGGAAGG - Intergenic
918229975 1:182519660-182519682 CAGAATAGATAGAATGGAGCAGG - Intronic
918465732 1:184819616-184819638 CGCAATGGAGTGAAGGAGGCCGG + Intronic
919064949 1:192682890-192682912 CGGAATAGAGGGAAGGGGGACGG - Intergenic
919598228 1:199590916-199590938 AAGAGTGGTGAGAAGTGGGCAGG + Intergenic
919704051 1:200659484-200659506 AGGAATGGGGAGAATGGGGCAGG + Intronic
919884051 1:201919895-201919917 CAGGATGGAGAGATGTGGACTGG - Intronic
919982487 1:202650969-202650991 CAGAGTGGGAAGAAGGGGCCGGG + Intronic
920216341 1:204363611-204363633 GAGGAGGGAGACAAGGGGGCGGG + Intronic
920353372 1:205352435-205352457 CACACTGGAGAGGAGGGGGTGGG + Intronic
921191560 1:212713420-212713442 CAGATGGGGGAGAAAGGGGCTGG - Intergenic
921270613 1:213466018-213466040 CAGAATGCACAGAAGTGGGGAGG + Intergenic
921378096 1:214494779-214494801 TGGAAGGGAGAGAAGGGGGAAGG + Intronic
921771885 1:219050405-219050427 AAGAAGGGAGAGAAGGAGGAAGG + Intergenic
922314596 1:224432772-224432794 CAGAATGAAATGAAGGGGGGAGG - Intronic
922648513 1:227317668-227317690 CAGAATGCATAGAAGGGGGAGGG + Exonic
922871715 1:228907526-228907548 CAGAATGGGGATAAGGGCCCTGG + Intergenic
923064144 1:230502811-230502833 GAGAATGGAGGGAGGGGGGATGG - Intergenic
923549734 1:234954036-234954058 CAGAAAGGAGGGAAGGAGGACGG + Intergenic
923850678 1:237790875-237790897 CAGACAGGTGAGCAGGGGGCAGG - Intronic
924069484 1:240261698-240261720 CAGAGAGGAGAGAAGAGGTCAGG + Intronic
924616728 1:245618055-245618077 CAGAAGGAAGAGAAGGAGGCAGG + Intronic
1062911526 10:1215337-1215359 GAGAACGGAGAGAAGGGAGAGGG - Intronic
1063214462 10:3911878-3911900 TGGAAGGGAGAGAAGGGAGCAGG + Intergenic
1063412065 10:5843946-5843968 CAGAAAGGAGAGAAGAGAGAAGG - Intergenic
1063430954 10:5987871-5987893 CAGAGTGGGGAGAAGGCGGGTGG + Intergenic
1063472326 10:6298053-6298075 CAGAACAGAAAGAAGGGGGGAGG + Intergenic
1063522711 10:6755365-6755387 TAGATTTGAAAGAAGGGGGCTGG + Intergenic
1063963786 10:11328858-11328880 CAGAAAACAGAAAAGGGGGCTGG - Intronic
1064198292 10:13263397-13263419 CAAAAGGGAGAGAATGGGGTGGG - Intergenic
1064516860 10:16159274-16159296 CAGAAAGGATAGTGGGGGGCTGG - Intergenic
1064659374 10:17591118-17591140 TAGAATGGAGAAGAGGAGGCTGG - Intronic
1065542868 10:26787495-26787517 CAGAATTGAGAGAATGGAGAGGG - Intronic
1065709559 10:28502401-28502423 CAGAAAGGAGAAAAGCAGGCGGG + Intergenic
1065805577 10:29390950-29390972 CAGGAGGGAGGGGAGGGGGCGGG - Intergenic
1066335409 10:34472495-34472517 CAAAATGGGGAGAGGTGGGCAGG + Intronic
1067021158 10:42799400-42799422 GAGAATAGAGAGAAAGGGGCTGG - Intronic
1067921944 10:50468007-50468029 CAGAGGGGAGAGAAGGGAGTGGG + Intronic
1068360619 10:55972384-55972406 CAGGGTGGAGAGAAGGGGTGGGG - Intergenic
1069562715 10:69442027-69442049 CAGCAGGGAGAGCAGGGGACAGG + Intergenic
1069703427 10:70442039-70442061 CTGAGTGGAGAGGATGGGGCAGG - Intronic
1069722617 10:70559497-70559519 GAGAATAGACAGCAGGGGGCGGG + Intronic
1069871664 10:71536767-71536789 CACAATGAAGAGAAGGGGCCAGG + Intronic
1070759509 10:79014978-79015000 CAGAAGGGAGAGAAGGCAGGAGG + Intergenic
1071089951 10:81906583-81906605 TAGAGTGGAGCGAAGTGGGCTGG + Intronic
1071371041 10:84952247-84952269 CTAAATGGAGAGATGGGGTCTGG + Intergenic
1071385727 10:85119317-85119339 CAAAAAGGAGAGAAGTGGGCTGG - Intergenic
1072198834 10:93140620-93140642 CAGAATGGAGAGTTGGGGCTGGG - Intergenic
1072643345 10:97231493-97231515 CAGAAAGTAGAGAAGGTGGTTGG - Intronic
1073013786 10:100382284-100382306 CAGCCTGGGGAGAAGGGGGGAGG - Intergenic
1073208762 10:101782242-101782264 CAGATTGGTGAGAAGAGGGGAGG - Exonic
1073246794 10:102096515-102096537 CAGAAAAGAGAGAAAGGGCCGGG - Intergenic
1073597770 10:104817552-104817574 GAGAAGGGAGAGGAGGGGGGAGG - Intronic
1073804375 10:107080878-107080900 CAGAATAGAAAGAAGGGTCCTGG - Intronic
1074247782 10:111712681-111712703 CATAATGGAGAGAGGAAGGCAGG + Intergenic
1074993872 10:118738476-118738498 CAGAATGGATAGGTGGGGGTGGG - Intronic
1075042986 10:119123390-119123412 CAGGAAGAGGAGAAGGGGGCAGG + Intronic
1075304296 10:121354309-121354331 CAGGGAGGAGAGAAGAGGGCAGG - Intergenic
1075566757 10:123510645-123510667 CAGAAGGGAGAGAGGTGGTCTGG - Intergenic
1075614924 10:123883887-123883909 CAGTGTGCAGAGAAGGGGCCAGG + Intronic
1076222500 10:128745763-128745785 CTGATAGGGGAGAAGGGGGCAGG + Intergenic
1076350441 10:129811546-129811568 CAGCACCGGGAGAAGGGGGCAGG - Intergenic
1076512402 10:131022042-131022064 CATGGTGGAGAGAAGGTGGCTGG + Intergenic
1076797394 10:132804932-132804954 AAGAAGGGAGAGGCGGGGGCGGG + Intergenic
1076882658 10:133247235-133247257 CAGGATGCAGAGAGGAGGGCTGG - Intergenic
1076941574 10:133613587-133613609 CAGAATATAGATAAGGGAGCTGG + Intergenic
1077160013 11:1108408-1108430 CAGGATGGAGAGGTGGGGACAGG - Intergenic
1077231284 11:1459161-1459183 CAGAATGGAGAGAGGAGGGAGGG - Intronic
1077332162 11:1988511-1988533 GAGGAGGGAGAGGAGGGGGCAGG + Intergenic
1077365686 11:2160696-2160718 CAGCATGGGCAGAAGGGGGCAGG - Intronic
1077384628 11:2263148-2263170 CCGAAAGGAGGGAAGAGGGCTGG - Intergenic
1077431794 11:2519251-2519273 CATGTTGGAGAGAAGGGAGCTGG - Intronic
1077483555 11:2827829-2827851 CGGAATGAAGAGGAAGGGGCGGG + Intronic
1077550063 11:3196280-3196302 CATGCAGGAGAGAAGGGGGCCGG + Intergenic
1078093632 11:8283428-8283450 CAGCATGGAGATAAATGGGCTGG + Intergenic
1078442806 11:11381393-11381415 GAGGAGGGAGAGAAGGGGACAGG - Intronic
1078624720 11:12944220-12944242 TAGATTGGAGAGATGGGGGTGGG + Intronic
1079599730 11:22295940-22295962 CAAAATGGCAAGACGGGGGCAGG + Intergenic
1079842358 11:25419110-25419132 AAGAAGGGAGAGAAGGAGGGAGG + Intergenic
1080365832 11:31573021-31573043 AAGGAGGGAGAGAAGGGGGCAGG + Intronic
1080997610 11:37623067-37623089 CAGAAGGGAGAGCAGGCAGCAGG - Intergenic
1081159471 11:39735134-39735156 GGGAATGGAGAGAAGGGGTGGGG - Intergenic
1081297813 11:41413116-41413138 CAGAATGTAGAGAATGAGGATGG + Intronic
1081574470 11:44310518-44310540 AAGAGTGGAGAGGAGGGGGCAGG - Intergenic
1081731034 11:45371857-45371879 ATGAATGGAGAGAAGGCAGCAGG - Intergenic
1081799760 11:45849918-45849940 CAGAACTGGGAGAAAGGGGCTGG - Intronic
1082774922 11:57237452-57237474 CAGAAAGGAGAGGCGGGGCCAGG - Intergenic
1083097433 11:60266187-60266209 CAGAGTGCAGAGAATGGGGTGGG - Intergenic
1083105024 11:60349006-60349028 CAGAGTGAAGAGAATGGGGTGGG + Intronic
1083498838 11:63084275-63084297 CAGAATTGAGATAAAGGGGCTGG + Intronic
1083534146 11:63453506-63453528 AGAAATGGAGAGAAGGGGTCAGG - Intergenic
1083901714 11:65646568-65646590 CTGAATGGTGAGCAGGCGGCCGG + Exonic
1084145290 11:67261884-67261906 CAGAAAGGAGCGAAGGGCCCGGG + Intergenic
1084857015 11:71995945-71995967 CTGAATGCAGAGAAGGTGGGAGG - Intronic
1084905011 11:72338934-72338956 CACAATGGAGAAATGTGGGCTGG + Intronic
1085132691 11:74055026-74055048 GAGAATGGAGAGAAGGGAAGAGG + Intronic
1085200538 11:74699214-74699236 AAAATTGGAGAGAAGGTGGCAGG + Intronic
1085318572 11:75561058-75561080 CAGTATGGAGAGGAAGGGACAGG - Intergenic
1085341270 11:75733079-75733101 CAGAGAGCAGCGAAGGGGGCGGG - Intergenic
1085555056 11:77412008-77412030 AAGAAAGGAGGGAAGGAGGCGGG + Intronic
1086307128 11:85493669-85493691 CAGAGAGGAGAGAAGGGGAGGGG + Intronic
1086401393 11:86463558-86463580 CAGAATGGAGAAAGGCTGGCAGG + Intronic
1086499122 11:87434177-87434199 GAGGATGAAGAGAAGAGGGCTGG + Intergenic
1087687846 11:101285568-101285590 CAGTATAGAGAGAAGTTGGCTGG - Intergenic
1088572067 11:111231880-111231902 TAGAAAAGAGAGAACGGGGCAGG - Intergenic
1088704814 11:112452474-112452496 AAGAATGGAGAGAAGGATGTAGG - Intergenic
1089196342 11:116695971-116695993 AAGAAAGGAGAGAAGGAGGAAGG - Intergenic
1089198239 11:116707770-116707792 CTGAAAGGAGAGCAGGGAGCAGG + Intergenic
1089774739 11:120828405-120828427 GAGAATGGAGAGAAGGTTTCAGG + Intronic
1090366504 11:126211306-126211328 GAGAATGGGGAGAAGGCGGAGGG - Intronic
1090667156 11:128922103-128922125 CAGAATGGAGACATGAGGTCAGG + Intergenic
1091165129 11:133468765-133468787 CACAAGGTAGAGAAAGGGGCTGG - Intronic
1091169149 11:133505259-133505281 GGCACTGGAGAGAAGGGGGCCGG + Intronic
1202815143 11_KI270721v1_random:43687-43709 GAGGAGGGAGAGGAGGGGGCAGG + Intergenic
1091453554 12:588230-588252 CAGAAGGGAGGGAAGGGAGGAGG + Intronic
1091705433 12:2690243-2690265 CAGAAAGGAGAGAGGCAGGCTGG + Intronic
1092158378 12:6300140-6300162 CAGGCTGGAGTGTAGGGGGCTGG + Intergenic
1093274321 12:17105193-17105215 AAGAAAGGAGAGAAGAGGGAGGG - Intergenic
1093635122 12:21457695-21457717 AGGAAGAGAGAGAAGGGGGCTGG + Intronic
1094125519 12:27018878-27018900 CAGGAGGGAGAGAAGGAGGAAGG + Intergenic
1095583399 12:43825270-43825292 AACTATGGAGGGAAGGGGGCTGG + Intergenic
1096313784 12:50545390-50545412 CAGAACGGAGGGGAGGGGGAGGG - Intronic
1096540650 12:52305066-52305088 CAGAGAGGAGAGATGGGGGTGGG + Intronic
1096774586 12:53956199-53956221 GAGAAGGGAGAGAAAGGGCCTGG + Intronic
1096842975 12:54390534-54390556 CAGCAGGGAGAGAGAGGGGCAGG + Intronic
1097012563 12:55963884-55963906 CAGAAAGGAGAGGAGAGGGGAGG - Intronic
1097014274 12:55974254-55974276 CGGAGAGGGGAGAAGGGGGCCGG + Intronic
1097103226 12:56604167-56604189 CAGAGAGGAGAGAAGTGGGGCGG - Intronic
1097107422 12:56634026-56634048 CTTAAAGGGGAGAAGGGGGCCGG - Intronic
1097170384 12:57109720-57109742 TAGAAAGGAGAGGAGGGGACAGG + Intronic
1097338056 12:58406787-58406809 CTGAATGCAGAGAAGGAGGAGGG + Intergenic
1097644520 12:62220809-62220831 AAGAAAGAAGGGAAGGGGGCCGG + Intronic
1097712820 12:62934410-62934432 AAGCAGGGAGAGAAGAGGGCTGG + Intronic
1097726391 12:63080022-63080044 CAGCAGGGAGAGAAAGGGGAGGG - Intergenic
1098247183 12:68532131-68532153 CAGATTGGGGAGAGGGAGGCAGG + Intergenic
1098607062 12:72403857-72403879 CAGAGTGGAGTGGAGGGGGTAGG + Intronic
1098751348 12:74297025-74297047 CTGGAGGGAGGGAAGGGGGCTGG - Intergenic
1099959205 12:89380472-89380494 TAGAAGGGAGAGAAGGAAGCAGG - Intergenic
1100235103 12:92652917-92652939 AGAAATGGAGAGAAGGGGGTTGG - Intergenic
1100416613 12:94384498-94384520 CTGAAAGGAGAAAAGAGGGCAGG - Intronic
1100913950 12:99396687-99396709 CAGAGTGGAGAAAAGGCGCCAGG + Intronic
1101067928 12:101042060-101042082 CAGAATGGACTGGAAGGGGCCGG - Intronic
1101345334 12:103880937-103880959 GGGAGTGGAGGGAAGGGGGCAGG - Intergenic
1101595759 12:106163268-106163290 CAGAAAGGAGAGAAAAGGGAAGG - Intergenic
1101829906 12:108249046-108249068 CAGCATGGATAGAAAGGGGCAGG - Exonic
1102142617 12:110628022-110628044 CAGAAGAGAGAGAAGGAAGCAGG - Intronic
1102221854 12:111200399-111200421 CAGAAAGGAAAGAATGGGGGAGG - Intronic
1102688563 12:114742695-114742717 CAGAAAAGAGAGATGGAGGCAGG + Intergenic
1102756144 12:115342520-115342542 CAGAGAGGAGAGAAGAGAGCAGG + Intergenic
1103279987 12:119749508-119749530 CATAATCAAGAGAAGGGGGAAGG + Intronic
1103328735 12:120139012-120139034 AAAAAAGGAGAGAAGGGGCCGGG + Intronic
1103558012 12:121777558-121777580 CAGAATGAAGGGCAGGGGGGTGG - Exonic
1103649899 12:122423727-122423749 ATGAATGGAGAGGAGGGGCCAGG - Intergenic
1104001961 12:124865555-124865577 AAAAAGGGAGAGAAGTGGGCTGG + Intronic
1104900047 12:132184737-132184759 CAGGGTGGAGAGAAGCAGGCTGG - Intergenic
1105064311 12:133183336-133183358 GAGAAAGGAGAGGAGGTGGCTGG + Intronic
1105208949 13:18246723-18246745 CAGAGGGGAGAGATGGAGGCAGG + Intergenic
1105226479 13:18439140-18439162 CAGAAGGGTGAGAAGGTGGGAGG + Intergenic
1105640614 13:22259963-22259985 GAGAAGGCAGAGAAGGGAGCTGG - Intergenic
1105893144 13:24696408-24696430 TAGAAAGGGGAGAGGGGGGCCGG + Intronic
1106396228 13:29383628-29383650 CAAAAGGGAGGGAAGGTGGCAGG - Intronic
1106444779 13:29817797-29817819 CAGATGGGAGAGCAGGGAGCTGG + Intronic
1107011654 13:35676479-35676501 AAGGGTGGAGAGCAGGGGGCAGG - Intergenic
1107087557 13:36442501-36442523 CAGAATGGAAGGAAGGAAGCTGG - Intronic
1107333086 13:39322692-39322714 CAGAAGGGAGAGAAGGAAGGAGG + Intergenic
1108273963 13:48789411-48789433 CAGTATGGAGAGCAGTGGGCTGG + Intergenic
1108527042 13:51294205-51294227 AAGAATGGAGGGAAGGGGCCGGG - Intergenic
1109339228 13:61033399-61033421 CAGAAGGGAGGGAGGGTGGCAGG + Intergenic
1110165799 13:72441635-72441657 CAAAATGGAGAGATGGGCGTGGG + Intergenic
1110395318 13:75023331-75023353 CAGAATAGAGAGCAGAGAGCTGG - Intergenic
1110721960 13:78772111-78772133 GAGAATGGAGAGAAGAGGACAGG + Intergenic
1110789846 13:79575663-79575685 CAGCATGGACAGATTGGGGCAGG + Intergenic
1111093443 13:83477404-83477426 GAGAAGGGAGAGAGGGAGGCAGG + Intergenic
1111805172 13:93031648-93031670 CAGAAGGCAAAGGAGGGGGCAGG - Intergenic
1111813981 13:93127397-93127419 GAGACTGGGGAGAAGGGTGCAGG + Intergenic
1112466192 13:99646950-99646972 CAGCAGGGAGAGAGGTGGGCAGG + Intronic
1113115486 13:106870260-106870282 CCGAATGGAGTGAGGGGAGCTGG - Intergenic
1113841467 13:113363914-113363936 CAAAACCGAGAGAAGGAGGCCGG + Intronic
1114263947 14:21060220-21060242 TAGAAAGCATAGAAGGGGGCTGG - Intronic
1114522192 14:23346801-23346823 GAGAATGCAGAGGAGGGCGCAGG + Exonic
1114555766 14:23561436-23561458 CAGAAGGGACAGAAGGGGCAGGG + Intronic
1114719448 14:24864927-24864949 CAGTAGAGAGAGAAGGTGGCGGG - Intronic
1114803896 14:25811709-25811731 CAGAATAGAGTGAGGGGGGCTGG - Intergenic
1115813321 14:37134113-37134135 CAAAATGGAGAGAGGGAGGTGGG + Intronic
1116915710 14:50523595-50523617 CTGAATGGAGTGAAGAAGGCAGG - Intronic
1116939742 14:50779456-50779478 CCAAATGAAAAGAAGGGGGCAGG + Intronic
1117045201 14:51806481-51806503 GTGAATGGAGAGAAAGGGGGAGG - Intergenic
1117169757 14:53081903-53081925 GAGAAGGGAGAGGAGGGGGATGG + Intronic
1117283604 14:54264757-54264779 CAGAATAGAGAGGAAGGGCCAGG + Intergenic
1118970960 14:70637336-70637358 CAGAATGGGGAGAGTGGGGAGGG - Intergenic
1118971563 14:70642126-70642148 CCGAATGGAGAGAAAGGGCTCGG + Exonic
1119558241 14:75569652-75569674 GACAATGGAGAGAAGTGAGCAGG - Intergenic
1119584317 14:75818132-75818154 CAGAAAAGAAAGAATGGGGCCGG - Intronic
1119824645 14:77647367-77647389 AAGAAAGGAGACAAGAGGGCTGG + Intergenic
1119879696 14:78090556-78090578 CAGAGTGGAAAGCAGGGGTCTGG + Intergenic
1119976403 14:79029094-79029116 GAGAATGAAAAGAAGGGGGTTGG + Intronic
1120865517 14:89292586-89292608 CAGAAGGCAGAAAAGGGGGGTGG - Intronic
1121007969 14:90502307-90502329 GAGGGTGGAGAGGAGGGGGCTGG - Intergenic
1121378065 14:93431540-93431562 AAGAAGGGAGAGAAGGGGGAGGG + Intronic
1121490473 14:94355436-94355458 CAGGAAGGAGAGAGGTGGGCTGG + Intergenic
1121491616 14:94365148-94365170 CAGAAGGAGGAGACGGGGGCTGG + Intergenic
1122073467 14:99220551-99220573 CAGAACGGAGAATGGGGGGCTGG + Intronic
1122194495 14:100074872-100074894 CAGAATGGCGAGGCTGGGGCAGG + Intronic
1122401096 14:101467866-101467888 GAGGATGGAGAGAAGAGGGATGG + Intergenic
1122406868 14:101505915-101505937 GAAAATGGTGAAAAGGGGGCAGG - Intergenic
1122660782 14:103293624-103293646 CAGGATGGAGGGGAGGGCGCGGG - Intergenic
1122782571 14:104149843-104149865 CAGAACGGCGAGCTGGGGGCCGG + Intronic
1122818356 14:104326494-104326516 CAGAAGGCAGGGCAGGGGGCAGG - Intergenic
1122854352 14:104552978-104553000 GACAAGGGAGTGAAGGGGGCTGG + Intronic
1123038335 14:105480324-105480346 CAGGAGGGAGGGATGGGGGCGGG + Intergenic
1124067742 15:26361844-26361866 TTGAGTGGAGAGAAGGGTGCCGG + Intergenic
1125451637 15:39814191-39814213 GAGAATGAAGAGAAAGAGGCAGG - Intronic
1126107574 15:45156788-45156810 CAACATGGAGAGAGGGAGGCAGG - Intronic
1126383904 15:48074566-48074588 AAGACTGTAGAGAATGGGGCTGG - Intergenic
1126742917 15:51796397-51796419 CACACTGCAGAGAAGGTGGCAGG - Intronic
1126945150 15:53810966-53810988 CAGCATGGAGAGGAGAGGGATGG - Intergenic
1127301819 15:57662583-57662605 CAGAATGTATAGAAGGTGCCTGG + Intronic
1127377082 15:58394755-58394777 CAGAGTTGAGAGCAAGGGGCTGG + Intronic
1127890217 15:63243684-63243706 CAGAATTTGGGGAAGGGGGCAGG + Intronic
1128638396 15:69317779-69317801 CAGCATGGGGAGAAGGGGAAAGG - Intronic
1128659062 15:69484618-69484640 CAGAATGGAAAGAACCTGGCTGG - Intergenic
1129450109 15:75646973-75646995 CAGCAAGGAGAGAAGTGGTCAGG - Intronic
1129648373 15:77460057-77460079 GAGAATAGAGTGAAGGGAGCAGG + Intronic
1130284139 15:82541301-82541323 CAGAGTTGGAAGAAGGGGGCAGG - Intronic
1130414490 15:83679726-83679748 CAACTTGGAGAGAAGGGAGCTGG - Intronic
1130783130 15:87066132-87066154 CTGAAGGGATAGATGGGGGCTGG + Intergenic
1130932957 15:88443738-88443760 CAGAATGGAAATCTGGGGGCAGG + Intergenic
1131179048 15:90227958-90227980 CAGGTTGGAGAGGAGCGGGCAGG - Exonic
1131569683 15:93522121-93522143 CAGAGTAGACAGAAAGGGGCTGG - Intergenic
1131835612 15:96387800-96387822 CGGGATGGAGAGAAGGGGACAGG + Intergenic
1131911695 15:97212371-97212393 CAGACTGGAGAGATGGTGTCTGG - Intergenic
1132113272 15:99117664-99117686 CAGGATGGAGAACAGGGGGCAGG - Intronic
1132607108 16:798237-798259 CAGGATGGAGTGAATGGGGCCGG + Exonic
1132607135 16:798341-798363 CAGGATGGAGTGAGTGGGGCCGG + Exonic
1132607180 16:798481-798503 CAGGATGGAGTGAATGGGGCTGG + Exonic
1132607218 16:798619-798641 CAGGATGGAGTGAGTGGGGCTGG + Exonic
1132643091 16:986893-986915 CAGAAAGGAGTGAAGGCAGCAGG - Exonic
1132841297 16:1979596-1979618 GAGAATGTGGAGAAGGGTGCGGG - Exonic
1132977095 16:2716332-2716354 CAGAAAGGAGAGGAGGAGGAAGG - Intronic
1133730130 16:8571743-8571765 CAGAATAGAGCGAGGGTGGCTGG + Intronic
1133765009 16:8831915-8831937 GAGAAGGGAGGGAAGGGGGGAGG - Intronic
1133932079 16:10240810-10240832 CACACTGGGGGGAAGGGGGCAGG + Intergenic
1134034169 16:11016931-11016953 CAGATGGGAGGGAAGGGGGATGG + Intronic
1134392587 16:13833174-13833196 CAGAAGGGAGGAAAGGAGGCAGG - Intergenic
1134467356 16:14491309-14491331 CAGAATTGAGATGAGAGGGCTGG - Intronic
1134523208 16:14927828-14927850 GAGAGGGGAGAGAAGGGGGAGGG - Intronic
1134566197 16:15253875-15253897 GAGAGAGGAGAGAAGGGGCCAGG + Intergenic
1134736298 16:16502823-16502845 GAGAGAGGAGAGAAGGGGCCAGG - Intergenic
1134931218 16:18209344-18209366 GAGAGAGGAGAGAAGGGGCCAGG + Intergenic
1135640174 16:24112950-24112972 CTGAAGGGAGACAAGGGGGTGGG - Intronic
1135717930 16:24789078-24789100 CAGAATGGTGACAAGGGCACTGG - Intronic
1137632506 16:49956967-49956989 GAGAATGGGGAGAAGGGCTCAGG - Intergenic
1137830985 16:51543166-51543188 CAGAAGGGAGAGAACTGGGGAGG - Intergenic
1138546244 16:57721644-57721666 CTGATGGGAGAGAAGGGGGTGGG - Intronic
1139127956 16:64104231-64104253 CAGAATGGGTAGAATGGGACAGG - Intergenic
1139256336 16:65546533-65546555 CAGAATTAAGAGATGGGGGCAGG - Intergenic
1139303143 16:65962084-65962106 AAGAAGGGAGGGAAGGAGGCAGG + Intergenic
1139375054 16:66491641-66491663 CAGGGTGGAGGGATGGGGGCGGG + Intronic
1140235198 16:73152801-73152823 AGGAGGGGAGAGAAGGGGGCTGG + Intergenic
1140299057 16:73738786-73738808 CAGCCTGTAGAGAAGGGGGCAGG - Intergenic
1140347231 16:74225965-74225987 GAGAAAGGAGGGAAGGGGGAAGG + Intergenic
1140765752 16:78155215-78155237 AAGAAAGGAGAGAAGGAGGAAGG + Intronic
1140846261 16:78891314-78891336 CAGAAAGGAGGGAAGGGAGGAGG - Intronic
1141251381 16:82362084-82362106 CAGAAGGCAGAGATGGGGCCAGG - Intergenic
1141421171 16:83917511-83917533 CAGAAGACAGAGAAGGGGCCTGG - Exonic
1141732806 16:85834069-85834091 AAGAAGGGAGAGAAGGAGGGAGG + Intergenic
1141828601 16:86497472-86497494 CTGAATGGAGGGGCGGGGGCGGG - Intergenic
1141847945 16:86623666-86623688 GGGAATGGAGAGAAGGGTCCCGG + Intergenic
1141858333 16:86700309-86700331 CTCACTGGTGAGAAGGGGGCTGG + Intergenic
1142141504 16:88474693-88474715 CAGGATGGAGAAGAGCGGGCTGG - Intronic
1142176604 16:88648168-88648190 CAGTAGGTAGAGAAGGGGGGTGG - Intronic
1142496704 17:309866-309888 CAGCATGGAGGGAAGGGGCTGGG - Intronic
1142582302 17:949696-949718 CAGCAGGGAGAGGAGGAGGCAGG - Intronic
1143023404 17:3928106-3928128 CGGGCTGGAGAGAAGTGGGCTGG - Intronic
1145721634 17:27078493-27078515 CAGGAGGGAGAGGAGGGGTCAGG - Intergenic
1145759461 17:27418106-27418128 CAGCATGGAGGGAAGAGAGCAGG - Intergenic
1145799575 17:27674224-27674246 CAGCATGGAGGGAAGAGAGCAGG + Intergenic
1146596243 17:34171663-34171685 TGGACTGGAGAGAAGGGGCCAGG - Intronic
1146646785 17:34581485-34581507 CTGCAGGGAGAGACGGGGGCGGG - Intronic
1147303760 17:39549514-39549536 AAGAATGGAGAGAGGGAGGAAGG - Intronic
1147445413 17:40472291-40472313 CAGGCTGGGGAGAAGGGTGCTGG - Intergenic
1148163216 17:45463687-45463709 AAAAAAGGAGAGAAGGGGGCCGG - Intronic
1148643345 17:49204588-49204610 CAGAATGGTGAGATGGAGTCAGG + Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148736149 17:49865967-49865989 CAGGAGGGAGAGAAGGCGGCAGG + Intergenic
1148794394 17:50190129-50190151 GTGAATGGAGGGAAGGAGGCAGG + Intronic
1149575928 17:57713354-57713376 CAGCAAGGAGAAAAGGGGACGGG + Intergenic
1149892554 17:60402970-60402992 AGGAGGGGAGAGAAGGGGGCTGG + Intronic
1150134974 17:62690550-62690572 CAGGCTGCAGAGAAGAGGGCTGG + Intronic
1150176492 17:63062647-63062669 CAAAATGGGGAGGAGGGGGCTGG - Intronic
1150426141 17:65078601-65078623 CTGCAGGGAGAGAAGCGGGCTGG - Intergenic
1151074460 17:71255115-71255137 TAAAATCGAGAGAAGGGAGCTGG + Intergenic
1151538040 17:74749574-74749596 CAGACCCGAGGGAAGGGGGCTGG - Intronic
1151605146 17:75131160-75131182 GAGTAAGGAGAGAGGGGGGCGGG - Exonic
1151699895 17:75737519-75737541 CAGTCTGGAGAGGAGGAGGCAGG - Exonic
1151827232 17:76530213-76530235 CTGAATGGAGAGGCGGAGGCAGG - Intronic
1151836495 17:76585851-76585873 CAGAAGGGAGAGAACCGGGTGGG + Exonic
1152329898 17:79666588-79666610 CAGAAAAGAGAGAATGAGGCTGG + Intergenic
1152515414 17:80820704-80820726 CAGACTGGGGAGAAGGAGGAGGG + Intronic
1152614351 17:81331005-81331027 AAGAAAGGAGAGGAGGGGGCGGG + Intergenic
1152724588 17:81938998-81939020 AAAAAAGGAGAGAAGGAGGCTGG + Intronic
1152885228 17:82845496-82845518 CAGGACGGAGAGGAAGGGGCCGG - Intronic
1153615982 18:6933780-6933802 AAGAAGCGAGACAAGGGGGCCGG - Intergenic
1155925607 18:31652063-31652085 AAGGATGGAGAGAAGAGGCCGGG - Intronic
1156016599 18:32553645-32553667 GAAAAGGGAGAGAAGGGAGCTGG - Intergenic
1156076778 18:33288347-33288369 CAGAAGGGAGAGGAGGGGACAGG - Intronic
1156174947 18:34533072-34533094 CAAAATGCAGAGAGTGGGGCTGG + Intronic
1156227921 18:35127400-35127422 TAGAATGGCCAGAAGTGGGCAGG - Intronic
1156892531 18:42206361-42206383 CAGGGTGGGGAGAAGGGGGAGGG - Intergenic
1157439181 18:47697061-47697083 CAGAATGCAGAGGAGAGGGCAGG - Intergenic
1157527265 18:48393300-48393322 CAGAAGGGAGCCAAGGGGGCAGG - Intronic
1159553949 18:69925704-69925726 GAGACTGGAGTGAAGGAGGCTGG - Intronic
1160058294 18:75507051-75507073 TGGAATGGAGAGAACAGGGCTGG + Intergenic
1160477944 18:79209611-79209633 CAGAATGGACAGGATGGGGCCGG - Intronic
1160570803 18:79816398-79816420 CAGAGGGCAGAGAAGGGGGAGGG - Intergenic
1160710750 19:549936-549958 CAGCATGGACAGAGGTGGGCTGG - Intergenic
1160718194 19:585838-585860 CAGAGTGGAGGGGATGGGGCAGG - Intergenic
1160881816 19:1324438-1324460 CAGAAGGGCGAGAAGGAGCCAGG + Intergenic
1161021419 19:2013382-2013404 CAGAAAGGAGGGCTGGGGGCTGG + Intronic
1161286921 19:3473201-3473223 CAGGCTGGAGTGCAGGGGGCAGG - Intergenic
1161610129 19:5237828-5237850 CAGGAAGGAGGGAAGGGGGCCGG + Intronic
1162292823 19:9792280-9792302 GTGAAGGGAGAGAAGAGGGCGGG - Intronic
1162843248 19:13371795-13371817 CAGAATGGAGAACAGAGGGTGGG + Intronic
1162964391 19:14149122-14149144 TAGAGTTGAGGGAAGGGGGCTGG + Exonic
1162964404 19:14149159-14149181 CAGGCTGGAGAGGAGGGGGCCGG + Exonic
1163081876 19:14950150-14950172 CAGAGAGGAGGGAAGGGGGCTGG - Intronic
1163250806 19:16125292-16125314 AGGGATGGAGAGGAGGGGGCTGG + Intronic
1163276369 19:16286762-16286784 CAGGATGGAGAGAGGCAGGCAGG - Intergenic
1163560188 19:18014395-18014417 GAGAGTGGGGAGCAGGGGGCTGG + Intergenic
1164383633 19:27755429-27755451 GAAAATGGAGAGAATGGGGGAGG - Intergenic
1164564303 19:29314921-29314943 CAGGGTGGAGAGGAGGAGGCTGG + Intergenic
1164781602 19:30897395-30897417 CCAAATGGAGGCAAGGGGGCTGG + Intergenic
1164816720 19:31209851-31209873 CAGAATGGGGAGAAGGGGTTGGG - Intergenic
1164919955 19:32082056-32082078 CAGCATGAAGAGAAGGGAGTGGG + Intergenic
1165007237 19:32817300-32817322 GACAAAGGAGAGTAGGGGGCTGG - Intronic
1165674496 19:37709859-37709881 CAAAATGGAGTGGAGGGGCCGGG + Intronic
1165778332 19:38417914-38417936 CAGAAGGGCGAGAAGGTGTCCGG + Intronic
1166009148 19:39928182-39928204 CAGACTGGAGATAAGGAGGCGGG + Exonic
1166143417 19:40818373-40818395 TAGGATGGGGAGAAGGGAGCTGG - Intronic
1166143447 19:40818556-40818578 CAGATTGGAGGGATGGGGGAAGG + Intronic
1166184106 19:41128222-41128244 CAGATTGGAGGGATGGGGGAAGG - Exonic
1166184135 19:41128405-41128427 TAGGATGGGGAGAAGGGAGCTGG + Intergenic
1166672407 19:44718867-44718889 CAGGATGGAGAGCAGGGAGGAGG + Intergenic
1166705089 19:44904033-44904055 CTGAGTGCAGAGATGGGGGCAGG + Intergenic
1166748174 19:45151868-45151890 CAGATGGGAGAATAGGGGGCTGG - Exonic
1167166524 19:47803135-47803157 GAGAATGGAGGGAAGAGGGAGGG + Intronic
1167465857 19:49650951-49650973 GAGGATGCAGAGGAGGGGGCAGG - Exonic
1167684405 19:50947105-50947127 CTGAATACAGAGAAGGGTGCTGG + Intronic
1168060823 19:53891152-53891174 CCTAATGGAGAGAAGGGCTCTGG + Intronic
1168072386 19:53960297-53960319 CAGAAAAGAGAGGAAGGGGCCGG + Intergenic
1168172313 19:54596885-54596907 AAGAGTGGAGTGAAGGGGGAAGG + Intronic
1168598001 19:57694657-57694679 CAGAATGTAGAGGAGGGGTCAGG - Intronic
925517134 2:4695409-4695431 CAAAAGTGGGAGAAGGGGGCAGG + Intergenic
925746792 2:7050550-7050572 CAGAATGGTGAGAAGGGAGGAGG - Intronic
925879260 2:8337861-8337883 CAGAATGGGGAGAAGGTAACAGG + Intergenic
926037856 2:9649053-9649075 CAGAATGCAGGGTTGGGGGCGGG + Intergenic
926059841 2:9798356-9798378 CAGAAGGTACACAAGGGGGCTGG + Intergenic
926109080 2:10170682-10170704 CAGGTTGGAGAGAAGGAGGAGGG - Intronic
926516737 2:13855885-13855907 CAGAAAAGGGAGAAAGGGGCTGG + Intergenic
926539840 2:14162228-14162250 AAGAATGGAGAGAAGGTAGAGGG + Intergenic
927317289 2:21698944-21698966 CTCAATGGAGGCAAGGGGGCTGG - Intergenic
927857293 2:26535643-26535665 CAGTGTGGAGAGACTGGGGCAGG - Intronic
927896439 2:26785797-26785819 CAGATTGGCAAGCAGGGGGCAGG + Intronic
929928745 2:46235947-46235969 GAGAAAGGAGAGCAGGGAGCAGG + Intergenic
930000088 2:46855545-46855567 CATGATGAAGAGGAGGGGGCAGG + Intronic
931150795 2:59571064-59571086 CAGAAGGGAGAAAAGGAGGGAGG + Intergenic
931217925 2:60263688-60263710 CAAAGTGGAGAGAAGGGTGAGGG - Intergenic
931735179 2:65187139-65187161 CAGGATGGAGAGAAAGCAGCAGG + Intergenic
932490900 2:72119633-72119655 GAGAATGAAGAGAAGGGGCATGG - Intergenic
932503001 2:72200958-72200980 AAGAATGGAGAGAAGGCAGGGGG - Intronic
932839077 2:75064837-75064859 CAGAGTGGAGACAAGTGGGCAGG + Intronic
933249014 2:80007738-80007760 CAGAAGTGAGAGAAGGGGTAAGG + Intronic
933374383 2:81460834-81460856 CTGAAAGGAGAGAAGAGGGTTGG + Intergenic
933408570 2:81895359-81895381 CAGAAAGGAGAGAGGGGAGACGG - Intergenic
934475225 2:94588927-94588949 GAGGAGGGAGAGCAGGGGGCTGG - Intronic
934569684 2:95361362-95361384 GAGAATGGAGTGAAGGGAACTGG - Intronic
934652343 2:96099808-96099830 CAGAAGGAAGAGAAGGGGAGGGG + Intergenic
936060616 2:109293470-109293492 CAGTGGAGAGAGAAGGGGGCAGG - Intronic
937193420 2:120127202-120127224 CAAAATGGAGTGAAAGGGACTGG - Intronic
937284450 2:120741411-120741433 CAGAAGAGAGAGAAAGGGGAAGG - Intronic
937425473 2:121795219-121795241 CACATGGGAGAGAAGGGAGCTGG - Intergenic
937710934 2:124979147-124979169 CAGATTAGAGAGAAGGTAGCTGG + Intergenic
937908771 2:127065293-127065315 CAGAATGGGGAGCGGGGGGTGGG + Intronic
938172844 2:129096810-129096832 CAAAATGGTGAGATGGGGCCGGG - Intergenic
938714970 2:134010833-134010855 AAGAAAGGAGAGAGGGTGGCAGG - Intergenic
940832874 2:158487791-158487813 GAGAAGAGAGAGAAGGGGGAGGG + Intronic
941725806 2:168858803-168858825 GATAATGGTGAGGAGGGGGCTGG + Intronic
942134009 2:172907333-172907355 CAGAATAGAGGGAAGAGGGAAGG - Intronic
942572042 2:177324509-177324531 CAAAATGAAGAGGAGGGGGTGGG - Intronic
942914726 2:181291389-181291411 CAAAGTGGAGAGAAGAGGGACGG - Intergenic
943343300 2:186707437-186707459 AAGAATGGACATAAGGAGGCCGG - Intronic
944211087 2:197207200-197207222 TGGCATGGAGGGAAGGGGGCAGG + Intronic
944365886 2:198919182-198919204 CAAAATGGAGAAAGGGGGCCAGG - Intergenic
944729446 2:202502344-202502366 CAGAAAGGAAAGAAAGGGACAGG + Intronic
945120553 2:206452888-206452910 CACAATGCAGAGAAGAGGGGAGG - Intronic
945401576 2:209388833-209388855 CAGAAAGGAGGGATGGGTGCAGG - Intergenic
946021649 2:216644276-216644298 AAGATTGGGGAGAAGGGGGCAGG + Intronic
946156927 2:217813180-217813202 CAGACTGTAGAGATGGGGGCAGG + Intronic
946196407 2:218035052-218035074 CAGAATGGTGAGATGGGGGATGG - Intronic
946200665 2:218069106-218069128 CAGAATGGTGAGATGGGGGATGG - Intronic
946226607 2:218267217-218267239 TAGAGTGGACAGAAGGGGGAAGG - Intronic
947831028 2:233141819-233141841 GAGACTGGGGAGAAGGGGACTGG + Intronic
948002503 2:234579920-234579942 CAGAATGGGGAACAGGGGACAGG + Intergenic
948041565 2:234905618-234905640 AAGAAGGGAGAGAAGGAGGGAGG + Intergenic
948213970 2:236215279-236215301 CAGAAGGGCTAGATGGGGGCCGG - Intronic
948602021 2:239112635-239112657 CAGAGTGGAGTGGAGGGAGCAGG + Intronic
948692317 2:239714335-239714357 CAGAATGCAGAGCAGGGGGGTGG + Intergenic
949002991 2:241628095-241628117 GATAGTGGAGAGAAGGGGGTTGG - Intronic
949003001 2:241628129-241628151 CAGAATGGAGAGAAGGGGGCTGG - Intronic
1169043739 20:2518952-2518974 CAGGAAAGAGAGAGGGGGGCAGG - Intronic
1169082732 20:2807091-2807113 CAGAGTGGTGGGAAGGGGGATGG - Intergenic
1169552591 20:6716129-6716151 CCGAATGGAGACACAGGGGCAGG + Intergenic
1169725468 20:8724383-8724405 CTAAATGGAAAGGAGGGGGCAGG + Intronic
1170876428 20:20254133-20254155 AAGAATGGAGAGGAGGGGAGGGG - Intronic
1171116007 20:22525420-22525442 AAGAATGGAAAGGAGGAGGCTGG + Intergenic
1172421010 20:34817704-34817726 CTGAAGGGAGGGAAGGGGGAAGG + Intronic
1172436401 20:34931749-34931771 CATAATGGAAGGATGGGGGCTGG - Intronic
1172589246 20:36105891-36105913 CAGAATAGGGAAAAGGTGGCAGG - Intronic
1172775373 20:37403840-37403862 CAGAATGGATGGCAAGGGGCAGG - Exonic
1173086590 20:39925167-39925189 CATAAAGGACAGAAGTGGGCGGG + Intergenic
1174197842 20:48786047-48786069 CAGCAGGAAGAGAATGGGGCTGG + Intronic
1174287526 20:49483465-49483487 GAGAAGGAGGAGAAGGGGGCGGG - Intergenic
1174581702 20:51576855-51576877 CAGACTGGGGAGGAGGGGCCTGG + Intergenic
1175227365 20:57452437-57452459 CTGAATGGAGAGAATGAGCCAGG + Intergenic
1175534441 20:59698291-59698313 CTGGATGGAGAGAGAGGGGCAGG + Intronic
1175922203 20:62455544-62455566 CAGGGTGCAGAGAAGGGGCCTGG - Intergenic
1176260504 20:64177270-64177292 GAGAAGGGAGAGGTGGGGGCAGG - Intronic
1176770530 21:13068165-13068187 CAGAAGGGTGAGAAGGTGGGAGG + Intergenic
1177228915 21:18293617-18293639 CAGAGTGGATGGAAGGGGGTGGG - Intronic
1177670210 21:24214739-24214761 AAGAAAAGAGAGAAGGGGGAGGG + Intergenic
1179136099 21:38681353-38681375 CAGGATCGAGAGAAGGGGGGAGG - Intergenic
1179141115 21:38726351-38726373 GAGAAAGGAGAGAAGGTGCCAGG + Intergenic
1179167698 21:38947592-38947614 CAGAAAGGAGAGATGGAGGGAGG - Intergenic
1179406974 21:41134476-41134498 CAGAATGAATATAAGGGGGATGG + Intergenic
1179988880 21:44935539-44935561 CAGAATGCAGAGAGGGGGCTAGG - Intronic
1180055734 21:45358302-45358324 AAGCATGGAGAGAAGGGGCTTGG - Intergenic
1180767309 22:18352575-18352597 CAGAGGGGAGAGATGGAGGCAGG - Intergenic
1180779000 22:18509804-18509826 CAGAGGGGAGAGATGGAGGCAGG + Intergenic
1180811721 22:18767124-18767146 CAGAGGGGAGAGATGGAGGCAGG + Intergenic
1181197874 22:21201366-21201388 CAGAGGGGAGAGATGGAGGCAGG + Intergenic
1181580902 22:23827559-23827581 CATAAGAGAGAGCAGGGGGCAGG - Intronic
1181703825 22:24635534-24635556 CAGAGGGGAGAGATGGAGGCAGG - Intergenic
1181737802 22:24895318-24895340 CAGAAGGGAGAGGAGTGGGTGGG - Intronic
1181872084 22:25907736-25907758 AAGAGTGTTGAGAAGGGGGCCGG + Intronic
1181970244 22:26684369-26684391 CAGAATGGATTGGAGGGGGACGG + Intergenic
1182483759 22:30626924-30626946 CAGAGTGGAGAGCTGGGGTCAGG - Exonic
1182831341 22:33307030-33307052 AAGATTGGAGAGATTGGGGCTGG - Intronic
1183158936 22:36097510-36097532 CAGAAAGCAGAGTAGTGGGCTGG - Intergenic
1183302339 22:37064478-37064500 CAGGATGGAGAGGATGGGCCGGG - Intergenic
1183480572 22:38062542-38062564 CAGACTGAAGAAAATGGGGCCGG - Intronic
1184883670 22:47328797-47328819 GAGAAGGGAGAGAAGGGGAGGGG - Intergenic
1185205954 22:49538900-49538922 CATGATGGAGGGTAGGGGGCAGG - Intronic
1203228931 22_KI270731v1_random:93469-93491 CAGAGGGGAGAGATGGAGGCAGG - Intergenic
1203299281 22_KI270736v1_random:65677-65699 CAGAATGGAGTGAAGTGGAATGG + Intergenic
1203300120 22_KI270736v1_random:71308-71330 TAGAATGGAGAGAAGTGGAATGG + Intergenic
1203311977 22_KI270736v1_random:149108-149130 TAGAATGGAGAGAAGTGGAATGG + Intergenic
949134039 3:540986-541008 CAGAATGGAGGGAAGGAAGAGGG - Intergenic
949872522 3:8601499-8601521 CAGAAGTGAAGGAAGGGGGCAGG + Intergenic
949961296 3:9314652-9314674 CAGGGTGGAGAGAGGAGGGCAGG - Intronic
950210470 3:11119336-11119358 AAGAATGGAGCAAAGGAGGCCGG - Intergenic
950404584 3:12796802-12796824 CGGGAAGGAGAGAAGGGGGCCGG - Intronic
950503164 3:13377129-13377151 CAGCTTGGGGAAAAGGGGGCGGG + Intronic
950808782 3:15632008-15632030 CAGCAAGGACAGCAGGGGGCTGG - Intronic
950924645 3:16728413-16728435 CAGGAGGGTGAAAAGGGGGCAGG + Intergenic
950934512 3:16824883-16824905 CAGAGGTGAGAGAAGAGGGCAGG + Intronic
951477954 3:23128753-23128775 CAGAGTGAAGAGAAAGGGGAAGG - Intergenic
951587763 3:24232734-24232756 CAGAATAGAGAAAAAGGTGCTGG + Intronic
951632577 3:24737626-24737648 CAGAATGGGGTGAAGCGGGACGG + Intergenic
951640101 3:24827281-24827303 AAGAAGGGAAAGAAGGAGGCAGG - Intergenic
952132950 3:30385298-30385320 CAGTGTGGAGGGAAGGGGGAAGG + Intergenic
952211869 3:31236110-31236132 CAGAAGGCAGAGAAGTTGGCAGG + Intergenic
954071147 3:48143759-48143781 CAGAATGGTGGGAAGGGTGCTGG - Intergenic
954213380 3:49110915-49110937 CAGCAAGTAGATAAGGGGGCAGG - Intronic
955098748 3:55826200-55826222 CAGAATGAAGACAAGTGTGCTGG - Intronic
955341716 3:58130201-58130223 CAGAACGGAGAGAGATGGGCAGG - Intronic
955513045 3:59700384-59700406 CAGAAGGGACAGAATGGGACAGG + Intergenic
955758272 3:62249396-62249418 CAGGGTGGAGGGAAGGGGGTGGG + Intronic
955925276 3:63998187-63998209 CAAAAAGGACAGAAGGGGGGGGG + Intronic
955996332 3:64684537-64684559 CAGAAGGAAGACAAAGGGGCAGG + Intronic
956029276 3:65019703-65019725 CAGATGGGTGAGAAGGGGACAGG + Intergenic
956151966 3:66253109-66253131 AAGAATGTTGAGATGGGGGCCGG + Intronic
956154280 3:66278391-66278413 CAGAATGGAGAGGGATGGGCAGG - Intronic
956202484 3:66720808-66720830 CTGAATGGAAAGAAAGGGCCTGG + Intergenic
956724425 3:72145492-72145514 CAGAAGGAAGAGAAGGAGGAAGG + Intergenic
956737334 3:72247808-72247830 CAGCCAGGAGAGGAGGGGGCAGG - Intergenic
956763393 3:72463298-72463320 CAGAATGCAGTGCAGGGGGCTGG + Intergenic
957843875 3:85705160-85705182 AAGAATGAAAAGAAGGGGGCGGG - Intronic
959903467 3:111685084-111685106 CAGAATTGGGAGAAGGGCACAGG + Intronic
960030353 3:113048073-113048095 CAGAATTCAGAGATGAGGGCTGG - Intergenic
960036071 3:113104447-113104469 GGCAATGGAGAGATGGGGGCGGG + Intergenic
960374974 3:116889557-116889579 AAGAATGAAGAGAAGTGGGTCGG + Intronic
961197640 3:125016224-125016246 CTGAATGCAGAAAAGGGAGCGGG + Intronic
961338765 3:126203280-126203302 GAAAATGCAGAGAAGGGGGCTGG + Intergenic
962223784 3:133586890-133586912 CAGAAGGGAGGAAAGGGGGAGGG + Intronic
962327671 3:134449456-134449478 CTGAATGGACAGCAGGGGGCAGG - Intergenic
962348226 3:134637938-134637960 CAGAAAGGAGAGAAGGGATTAGG - Intronic
962815868 3:138999403-138999425 CACAATGGAGAGGAGAGAGCTGG - Intergenic
963925267 3:150944471-150944493 CAGAGGGGAGAGATGGGGGCTGG + Intronic
964176192 3:153827702-153827724 CAGCCTGGAGAGAAGGGGAGAGG + Intergenic
964547159 3:157847091-157847113 CAGAATGGAGGGAAGGCAGAAGG - Intergenic
965400346 3:168205988-168206010 CAAGATGGGGAAAAGGGGGCCGG - Intergenic
966519718 3:180859982-180860004 CAGAACGGAAAGAAGAGGGAGGG + Intronic
966741747 3:183240670-183240692 CAGAATGGGGAGAGGTGGGTGGG + Intronic
966855679 3:184192598-184192620 AAGGTTGGAGAGAATGGGGCTGG + Exonic
967054867 3:185823555-185823577 CGGAATGGAGAGGTGGGGGCCGG - Intronic
967072201 3:185971917-185971939 AAGAAGGGAGAGAGGGAGGCAGG - Intergenic
968066073 3:195760480-195760502 TAGGATGGAGTGGAGGGGGCTGG + Intronic
968066097 3:195760555-195760577 TAGGATGGAGTGGAGGGGGCTGG + Intronic
968066106 3:195760593-195760615 TAGTATGGAGTGAAGGGGGCTGG + Intronic
968136644 3:196224673-196224695 TTGAAAGAAGAGAAGGGGGCGGG + Intronic
968652499 4:1765842-1765864 CAGAGTGGGGAGAAGGGAGGAGG + Intergenic
969143878 4:5102937-5102959 CAAAAAGGAGAGGAGGGGGAGGG - Intronic
969355206 4:6621020-6621042 CAGTGTGGTGAGAAGGAGGCTGG + Intronic
969474055 4:7411247-7411269 CAAGATGGAGAGAAGAGGCCAGG - Intronic
969722058 4:8897613-8897635 CAGACAGGAGAGAAGGAGGAGGG - Intergenic
969991512 4:11268789-11268811 CAGGATGGAAAGAAGGGGTAGGG - Intergenic
970314122 4:14813186-14813208 GAGCATGGAGAGAAGAGGTCAGG + Intergenic
970664495 4:18321172-18321194 TGGAGTGGAGAGAAGGGGGTAGG + Intergenic
971318703 4:25588220-25588242 GAGAATGGACAGAAGGGAGGGGG - Intergenic
971410813 4:26369866-26369888 GAGAAGAGAGAGAAAGGGGCTGG - Intronic
971849673 4:31968086-31968108 GAGAAGAGAGAGAAGAGGGCTGG - Intergenic
972059169 4:34846914-34846936 CAAAAGGGAGAGAAGAGAGCAGG + Intergenic
972127729 4:35790165-35790187 GAGAAGGGAGGGAAGGGGGAGGG + Intergenic
972167980 4:36310839-36310861 AAGATGGCAGAGAAGGGGGCAGG + Intronic
972315333 4:37920812-37920834 AAGAATGGAGACAAAGGGGCCGG + Intronic
972570122 4:40303100-40303122 CAGGAAGGAGAGAAGGAGGCCGG + Intergenic
972620061 4:40738602-40738624 CAGATTTGGGAGAAGGGAGCAGG - Intergenic
972854393 4:43089662-43089684 CAGAATGGAGAGCCAGGGGAGGG - Intergenic
972993953 4:44856273-44856295 CAGAATGAAGAAAAATGGGCAGG + Intergenic
974297569 4:60022264-60022286 TAGAATGGAGAGATGAGGACAGG - Intergenic
974463658 4:62224705-62224727 CAAAATGGAGAAAAAGGGGAAGG + Intergenic
977990964 4:103442231-103442253 AAGAATGGAGAAAATGAGGCAGG - Intergenic
978830706 4:113080870-113080892 CAGAATGGAGAGGAAGAGGATGG + Intronic
979538627 4:121853703-121853725 GAGAATGGATTGGAGGGGGCGGG - Intronic
979718170 4:123866683-123866705 CAGAAGGCACAGCAGGGGGCCGG - Intergenic
980996497 4:139784471-139784493 CAGCAGGGAGAGAAGAGGGGTGG - Intronic
982099910 4:151957755-151957777 CAGAATGGAGGGAAAAGGGAAGG - Intergenic
982515390 4:156340863-156340885 CAGAATGTAAAGAAGGAAGCAGG + Intergenic
982771631 4:159401889-159401911 GAGAATGGAGGGATGGGGCCTGG - Intergenic
982893767 4:160890562-160890584 CAAAATGGAGATAAGGGGGTAGG + Intergenic
983274977 4:165605782-165605804 CAGAATACAGAGAAGGAGGAAGG + Intergenic
983500982 4:168499343-168499365 CAGAAGGGAGGGAGGGGGGAGGG + Intronic
983552558 4:169032417-169032439 AAGAAGGGAGAGAAGGAGGAAGG - Intergenic
983739546 4:171111773-171111795 CAGAAGGGAGAGAAGAGGTGTGG + Intergenic
984763879 4:183384860-183384882 CAACATGGTGAGAAGTGGGCAGG - Intergenic
985078065 4:186237807-186237829 CAGAGAGGTGGGAAGGGGGCGGG - Intronic
985230361 4:187809633-187809655 CAGAATTGAGATAAGAGGGAAGG - Intergenic
985355606 4:189116131-189116153 GAAAATGGTGAGAAGGAGGCAGG + Intergenic
985399827 4:189583258-189583280 CGGAAGGTAGAGATGGGGGCAGG + Intergenic
985571922 5:651585-651607 GGGGATGGTGAGAAGGGGGCTGG + Intronic
985651814 5:1111191-1111213 CAGGATGGAGGGAACAGGGCTGG + Intronic
985738917 5:1603232-1603254 GAGAATGGAAGGAAGGGGTCTGG - Intergenic
986365249 5:7022563-7022585 CAGGAAAGAGAGAAGGTGGCAGG + Intergenic
986485592 5:8232978-8233000 CAGAAGGAAGAGGAGAGGGCAGG + Intergenic
986593089 5:9391640-9391662 CAGATGGGAGAGAAGGGGACAGG - Intronic
986614713 5:9604537-9604559 AAGAATGGAGAGGAAGGGGGTGG + Intergenic
987541092 5:19257097-19257119 CAAAATGGAGAAAAGGGTGACGG + Intergenic
988677451 5:33447153-33447175 AAGAATGGAAAGAAGGAGGGAGG + Intronic
989046360 5:37277672-37277694 CAGAATGGAGAGCAGTGGCGTGG - Intergenic
989197203 5:38727158-38727180 AAGACTGGGGAGAAGGGGCCTGG + Intergenic
989273457 5:39558814-39558836 CAGAGTGGAAGGAAAGGGGCAGG + Intergenic
989622004 5:43393649-43393671 AAGAATGGAGGAAAGGAGGCCGG - Intronic
989957756 5:50375773-50375795 CAGAAAGGAAAGAAAGGGACAGG + Intergenic
990335341 5:54767090-54767112 CTGAATTGAGGGAAAGGGGCTGG - Intergenic
990522070 5:56589866-56589888 CAGAATGGAGGGAAGGACCCTGG - Intronic
991560604 5:67947602-67947624 CAGAATGGGGAGCAGGGGCCAGG - Intergenic
992215100 5:74518204-74518226 CCAAAGGGAGAGAAGGGGGAAGG - Intergenic
992579051 5:78151983-78152005 GAGAAGGGAGGGAAGGGGGAGGG - Intronic
992624626 5:78626019-78626041 CAGAATGGAGAGAAGTCACCTGG - Intronic
994037765 5:95222211-95222233 CAGTGTGGAGAGAAGAAGGCAGG - Intronic
994088673 5:95788207-95788229 CAGAATGAGGAGAATGGAGCTGG + Intronic
996075225 5:119185128-119185150 AAGAAAGGAGAGATGGGGGCAGG - Intronic
996117117 5:119631297-119631319 AGGCATGGAGAGCAGGGGGCTGG + Intronic
996135316 5:119834310-119834332 CAGAGTGGAGAGAAGATGGGAGG - Intergenic
996184925 5:120464047-120464069 CAGAACCAAGAGGAGGGGGCGGG + Intergenic
996339007 5:122415572-122415594 GGAAATGGAGAGAAGAGGGCAGG + Intronic
997532670 5:134591817-134591839 GAGAATGGAGGGAAGTGGCCGGG - Intergenic
997975687 5:138440203-138440225 CCGAATGGGAAGAAGGGAGCAGG - Intronic
998231696 5:140364995-140365017 GAGAGGGGAGAGAAAGGGGCAGG + Intronic
998477199 5:142431998-142432020 CAGCATGGTGAGCAGGAGGCGGG + Intergenic
998628852 5:143876225-143876247 GAGAATGAAGAGAAGGGGCTTGG + Intergenic
999132550 5:149295600-149295622 GAGAATGGAGAGAAAGAGGAAGG + Intronic
999217919 5:149951244-149951266 AAGAATGGAGAGAAATGAGCGGG + Intergenic
999459557 5:151746278-151746300 CAGGATGGACCAAAGGGGGCAGG - Exonic
999585536 5:153085740-153085762 GAGAATGGAGAGAAGGAAGAAGG + Intergenic
1000289369 5:159855816-159855838 CAGAATGGGGAGAGGGGAACAGG + Intergenic
1000993713 5:167937677-167937699 CAGAATTGAGAAAAGCAGGCAGG - Intronic
1001129678 5:169053692-169053714 GTGAATGAAAAGAAGGGGGCGGG - Intronic
1001270796 5:170310077-170310099 CAGAAAGCACAGAAGGGGTCAGG - Intergenic
1001711947 5:173786176-173786198 CAGAAAGGAGAGACGTAGGCCGG + Intergenic
1001957357 5:175857151-175857173 CAGAATGGAGCCCAGGTGGCAGG - Intronic
1002079459 5:176728739-176728761 CGGGATGGAGAGAAGAAGGCAGG + Intergenic
1002194509 5:177494862-177494884 CAGAATGGAGGGAGGTGGGAGGG - Intronic
1002516055 5:179759874-179759896 ATGAATGGAGAGAAGTGGGTGGG + Intronic
1002564018 5:180100029-180100051 CAGTGTGGAGAGGTGGGGGCAGG - Intergenic
1002606381 5:180385296-180385318 CGGAGTGGAGAGAAGGCGGTGGG + Intergenic
1002705647 5:181159763-181159785 CAGTATGGACTGCAGGGGGCTGG + Intergenic
1003153991 6:3575820-3575842 CAGAAGGGAGAGATGACGGCGGG - Intergenic
1004013380 6:11710671-11710693 CAGAACTGAGAGAAGGCAGCCGG + Intergenic
1004333616 6:14743832-14743854 AAGAAAGGAGAGAAGGGGGAAGG + Intergenic
1004459324 6:15820842-15820864 CAGAATGGAGAGGAGAGAGCTGG - Intergenic
1005187646 6:23180959-23180981 AAAAGGGGAGAGAAGGGGGCTGG + Intergenic
1005371344 6:25136970-25136992 CAGAAGGGAGAGAAGGGGAAGGG + Intergenic
1006057914 6:31399629-31399651 GAGAATGGAGAAAAGAGGGAAGG - Intergenic
1006169448 6:32084782-32084804 CAGGATGGAGTGAGGTGGGCAGG - Intronic
1006193397 6:32222959-32222981 GAGACTGGAGAGAAAGGGGGAGG - Intronic
1006391434 6:33761309-33761331 CAGGCAGGAGAGAAGGGGACGGG - Intergenic
1006443106 6:34064191-34064213 CAGAAGGGAGTGCGGGGGGCGGG + Intronic
1006558578 6:34889572-34889594 CAGACTGGAGAGGGGGTGGCTGG - Exonic
1006697478 6:35943474-35943496 CAGAATACAGAGAAGGGAGAAGG + Intergenic
1006981952 6:38154271-38154293 CAGCAGGCAGAGGAGGGGGCGGG - Exonic
1007197282 6:40073716-40073738 GAGAATGGAGAGGCGGGGGGTGG + Intergenic
1007307634 6:40919252-40919274 TAGAATGGAAAGAAGGGAGAGGG + Intergenic
1008128368 6:47693281-47693303 AAAAAAGGAGAGAAGGGAGCCGG + Intronic
1008673971 6:53799850-53799872 CAAAATGGAGAGAAGAAGGAAGG - Intronic
1010060126 6:71613279-71613301 GAGATTGGTGAGAAAGGGGCAGG - Intergenic
1011218649 6:85031854-85031876 GAGAAGAGAGAGAAGAGGGCAGG + Intergenic
1011508493 6:88074180-88074202 AAGAATAGAGAAAAGAGGGCCGG + Intergenic
1011735010 6:90301887-90301909 CAGAGAGGAGGGAAGGTGGCTGG + Intergenic
1012971667 6:105738084-105738106 CAGAGTAGAGACAAGGGGGGTGG - Intergenic
1013169124 6:107620260-107620282 GAGAGTGGGGAGAAGGGAGCTGG - Intronic
1014203489 6:118629845-118629867 TAGAAAGGAGAGAAGTGGGTTGG - Intronic
1014327008 6:120010184-120010206 GAGATAGGAGAGAAGGAGGCAGG + Intergenic
1014947605 6:127516102-127516124 GAGAAGGGGGAGGAGGGGGCGGG - Exonic
1015512467 6:134052199-134052221 ATGAGTGGAGAGAAGGGGACAGG - Intronic
1015543387 6:134338579-134338601 GAGAAGGGAGAGGAGAGGGCTGG + Intergenic
1016003555 6:139066911-139066933 GAAAATGGAGAGAAGGAGGAAGG - Intergenic
1016329725 6:142944500-142944522 CAGAATGGAAAGGCGGGGGGTGG + Intronic
1016622290 6:146125693-146125715 CAGAATGGAGAAAAGGAGGGGGG - Intronic
1016891693 6:149014105-149014127 CAGAGTGAGGAGAAGGAGGCAGG + Intronic
1017370273 6:153697241-153697263 CAGAATGGTGAGAATGCAGCTGG + Intergenic
1017727799 6:157287674-157287696 CAGAAGGGAGGGAAGGGAGGAGG - Intergenic
1017775749 6:157679472-157679494 CATAGAGGAGAGAAGGGGGTGGG - Intergenic
1018066614 6:160129026-160129048 CAGTGTGGAGGGACGGGGGCAGG + Intronic
1018213835 6:161507633-161507655 GAGAATGGAGGGTAGGGGGAAGG - Intronic
1018497647 6:164366371-164366393 TAGAATGGAAAGAAGGTGGCCGG + Intergenic
1018861200 6:167712123-167712145 GAGAATGGAGAGATAGGGCCTGG + Intergenic
1019002119 6:168763150-168763172 GAGAATGGAGGCAAGAGGGCAGG + Intergenic
1019517460 7:1446264-1446286 GAGGAGGGAGAGAAGGGGGGAGG + Intronic
1019550775 7:1601361-1601383 GAGAAAGGAGAGAAGGGGCCGGG + Intergenic
1019607775 7:1918698-1918720 CAGCATGGAGAGAAGGGCCTAGG + Intronic
1019619393 7:1982562-1982584 CGGAATTTAGTGAAGGGGGCGGG - Intronic
1020728202 7:11843736-11843758 TAGAAAAGAGAGAAGGGGGCAGG - Intergenic
1021280237 7:18708135-18708157 AAGAGTGTAGAGGAGGGGGCAGG + Intronic
1021393438 7:20121711-20121733 CAACATGGAGAGAAGGGGTCGGG - Intergenic
1022117478 7:27274944-27274966 GAGAAGGAAGAGAAGGGGGAAGG + Intergenic
1022129945 7:27395786-27395808 CAGCAGGGAGAGAAGGGGGCAGG + Intergenic
1022590360 7:31655416-31655438 CAGTTTGGAGAGAAGGTGGCTGG - Intronic
1022801298 7:33779857-33779879 CAGAATGGAGATATGGGTGAAGG + Intergenic
1023116566 7:36868642-36868664 CAGAATAAGGAGAAGCGGGCAGG - Intronic
1023937197 7:44748625-44748647 CAGAAAGGTGTGGAGGGGGCTGG + Intronic
1024168259 7:46756739-46756761 GAGAAGGGAGAGAAGGAGGAAGG + Intronic
1024279286 7:47706176-47706198 CAGAATAGAGAGCTGGGTGCAGG + Intronic
1024813232 7:53237693-53237715 CATAAGGGAGAGAAGGGAGAGGG + Intergenic
1024895700 7:54259371-54259393 CTGAATGGGGTGAAGGGGCCAGG + Intergenic
1026847308 7:73705369-73705391 CAGAATTGGGGGAGGGGGGCGGG - Intronic
1027120241 7:75513159-75513181 CAGTAAGGAGAAAGGGGGGCAGG + Intergenic
1027312890 7:76966170-76966192 CGGAATGGAGAGAGGAGGGGAGG + Intergenic
1027353355 7:77333810-77333832 CAGAATGGAGGGGAGGGGAGGGG + Intronic
1027476014 7:78632362-78632384 CAGTATGGAGAAAAGGGTGGAGG + Intronic
1027606545 7:80306811-80306833 TAGAAAGGAGACAAAGGGGCTGG + Intergenic
1028921224 7:96312761-96312783 CAGAATGGAGAGGAAGGTGTAGG + Intronic
1029035335 7:97513983-97514005 CAGAATGCACAGAAGGGGCATGG - Intergenic
1029372999 7:100160977-100160999 CAGAAGAGAGAGAACTGGGCTGG + Intronic
1029420237 7:100468244-100468266 CAGAGTGGAGGGGAGGGGGCCGG + Intronic
1029490650 7:100868263-100868285 GAGAGTCCAGAGAAGGGGGCAGG - Intronic
1029628291 7:101734115-101734137 CAGATGGGTGAGAAGGGGGATGG - Intergenic
1029717266 7:102336814-102336836 CAGTAAGGAGAAAGGGGGGCAGG - Intergenic
1031147482 7:118013394-118013416 CAGCAGGGAGAGAGAGGGGCAGG - Intergenic
1031496368 7:122453790-122453812 CAGAATGGAGCCAGGGGGTCAGG + Intronic
1032148290 7:129404015-129404037 TAAAATAGTGAGAAGGGGGCAGG + Intronic
1032426581 7:131827479-131827501 CAGAAATGAGAGAAGGGCCCTGG + Intergenic
1032616816 7:133481830-133481852 CAGAAAGGAGTGAAGGAGGAGGG + Intronic
1032675219 7:134123981-134124003 CAGAATGGAAAGAAGAGGCCAGG - Intergenic
1032928503 7:136637884-136637906 AAGAGGGGAGAGAAGGGAGCTGG - Intergenic
1033237880 7:139652772-139652794 CAGAGTTGAGAGAAGGGAGAGGG + Intronic
1034063290 7:148112738-148112760 GAGAATATAGAGAAAGGGGCTGG + Intronic
1034255923 7:149724665-149724687 CAGGATGGGGAGGAGGGGTCAGG - Exonic
1034454853 7:151163329-151163351 AATAATGGAGAGAAGAGAGCAGG - Intronic
1034496976 7:151428886-151428908 CAGATTAGGGAGCAGGGGGCTGG + Intronic
1034884998 7:154792596-154792618 CAGGATGGAGAGCAGGGGGGAGG + Intronic
1035162513 7:156961374-156961396 CAGTCTGAAGAGGAGGGGGCTGG + Intronic
1035299625 7:157888401-157888423 CAGAATGGAGCGAAAGCGGTGGG - Intronic
1035350000 7:158238972-158238994 CTGAATGGAGAAGAGGGTGCTGG + Intronic
1035443836 7:158925946-158925968 CAGACTGGAGAGCAGGGGCTGGG + Intronic
1035761091 8:2069399-2069421 CAGAAAAGAGAAAAGGAGGCGGG - Intronic
1035827703 8:2661838-2661860 AGCAATGGAGAAAAGGGGGCAGG + Intergenic
1036538660 8:9679613-9679635 CTGAATAGAGAAAAGGGGGGAGG + Intronic
1036595517 8:10208556-10208578 AAGAATGGAGAAAAGAAGGCAGG - Intronic
1036766940 8:11555322-11555344 CCTAATGCAGAGAAGGGGGATGG + Exonic
1037323339 8:17664563-17664585 CAGAACTGAGAGGAGGAGGCCGG - Intronic
1037893638 8:22637320-22637342 CAGAGTGCAGAGGAGAGGGCGGG + Intronic
1038006665 8:23436387-23436409 CAGAATGGAGAGAGGATGGTGGG + Intronic
1038482678 8:27912651-27912673 CAGAGAGGAGAGAAAGGGGTGGG - Intronic
1038831913 8:31071456-31071478 GAGAATGGAGAGAAGTTGACAGG + Intronic
1039339701 8:36634138-36634160 CAGAATGCAGAGGAGGAAGCTGG - Intergenic
1039890651 8:41683372-41683394 CAGGATGCAGAGCAGGGGACAGG + Intronic
1041145571 8:54872767-54872789 CAGGGTGGGGAGAAAGGGGCAGG - Intergenic
1041251729 8:55940866-55940888 CACCATGGCAAGAAGGGGGCTGG - Intronic
1041313469 8:56539163-56539185 CAGAATGGGGAGGAGGAGGGAGG + Intergenic
1041362334 8:57066746-57066768 AAGAATGACGAGAATGGGGCTGG - Intergenic
1042525449 8:69759941-69759963 CAAAATTGAGAGATGAGGGCCGG - Intronic
1042542954 8:69925081-69925103 CAGCAAGGTGAGAAGGGTGCAGG + Intergenic
1043363968 8:79510161-79510183 CTGAATTTAGAGAAGGGGGAGGG - Intergenic
1044601685 8:94011654-94011676 CAGAATGGAGAGAAGGGATAGGG + Intergenic
1045949021 8:107830539-107830561 CAGAATTGGGAGAAGGGGAAAGG - Intergenic
1046108230 8:109691600-109691622 CAAAATGGAGAGAAGGGCGGGGG + Exonic
1046711173 8:117513203-117513225 CAGAATGGTGAGGAGGAGGAGGG - Intergenic
1046795309 8:118365150-118365172 CAGAAGGGAGGGAAGATGGCAGG - Intronic
1046828200 8:118715226-118715248 GGCAATGGAGAGTAGGGGGCTGG - Intergenic
1047376586 8:124303708-124303730 CAGAATGTAGATAAGATGGCTGG + Intergenic
1048274650 8:133057088-133057110 CCCAGTGGAAAGAAGGGGGCGGG - Intronic
1049018313 8:139937072-139937094 AAGCATGGAGAGAGTGGGGCTGG + Intronic
1049398538 8:142413098-142413120 CTCAATGGAGAGATGGAGGCTGG - Intergenic
1049422947 8:142524935-142524957 CAGAGTAGAGAGGTGGGGGCTGG - Intronic
1049529498 8:143147306-143147328 GAGTTTGGAGAGAAGGGGGATGG + Intergenic
1049529514 8:143147381-143147403 GAGTTTGGAGAGAAGGGGGATGG + Intergenic
1049543853 8:143220603-143220625 CAGAGGGGAGAGAAGGGGAAGGG - Intergenic
1050094932 9:2054561-2054583 TAAAATGGGGAAAAGGGGGCAGG - Intronic
1050132537 9:2427519-2427541 GTGAATGGAGAGAAGGGAACAGG + Intergenic
1052174469 9:25441667-25441689 AAGAATGGAATGAAGGGGGAAGG + Intergenic
1052834379 9:33239808-33239830 CAGGAGGCAGAGAAGGGGGCTGG - Intronic
1052854828 9:33400845-33400867 GAGGAGGGAGAGCAGGGGGCTGG + Intronic
1053216215 9:36272773-36272795 AAGAATGTGGAGAAGGGGCCGGG + Intronic
1053508460 9:38666966-38666988 CAAAATTGAGTGAAGGGGCCGGG + Intergenic
1053682846 9:40497164-40497186 GAGGAGGGAGAGCAGGGGGCTGG + Intergenic
1053932828 9:43125478-43125500 GAGGAGGGAGAGCAGGGGGCTGG + Intergenic
1054280868 9:63127764-63127786 GAGGAGGGAGAGCAGGGGGCTGG - Intergenic
1054295946 9:63332664-63332686 GAGGAGGGAGAGCAGGGGGCTGG + Intergenic
1054393962 9:64637159-64637181 GAGGAGGGAGAGCAGGGGGCTGG + Intergenic
1054428611 9:65142371-65142393 GAGGAGGGAGAGCAGGGGGCTGG + Intergenic
1054501768 9:65879171-65879193 GAGGAGGGAGAGCAGGGGGCTGG - Intronic
1055300028 9:74873090-74873112 TAGAATGTAGAGATGGAGGCAGG - Intronic
1055438062 9:76312105-76312127 AAGAATGGAGAGAGGGAGGCAGG + Intronic
1055726411 9:79234502-79234524 GAGAAAGGAGAGAAGAGAGCGGG - Intergenic
1056489931 9:87095902-87095924 CAGAAAGGACAGGAGAGGGCAGG - Intergenic
1057184099 9:93046816-93046838 CAAAAGGGAGAAAAGGGGCCAGG - Intergenic
1057230005 9:93316036-93316058 CAATATGGAGAGGAAGGGGCTGG - Intronic
1057230470 9:93318653-93318675 GAGAAGGGAGGGAAGTGGGCAGG - Intronic
1057671747 9:97096771-97096793 CAGAGAGGAAAGAATGGGGCAGG - Intergenic
1057868798 9:98702364-98702386 CTGAATGGAGACAGGGAGGCAGG - Intronic
1057923590 9:99121493-99121515 GAGAATGGAGAAAAGGGGTAAGG + Intronic
1058891532 9:109365393-109365415 CAGAATGGAGGGAAGGTTTCAGG - Intergenic
1059436648 9:114281240-114281262 CAGGATGGAGGGAGTGGGGCAGG - Intronic
1059454098 9:114388784-114388806 TAGAGTGGAGAGCAGGGGACTGG - Intronic
1059671652 9:116497714-116497736 CAGGCTGGGGAGAAGGGGGAGGG + Intronic
1060217489 9:121747010-121747032 CTGAGTGGAGAGATGGGGGAGGG + Intronic
1060298952 9:122362820-122362842 CTGGATGGAGAGAAGGGGGAGGG - Intergenic
1060488619 9:124065519-124065541 CTGAATGGAGGGAGGGAGGCAGG + Intergenic
1060809198 9:126600686-126600708 AAGAATGGAGAAAGGGGGCCAGG + Intergenic
1060978904 9:127781316-127781338 CAGAAGTGAGAGCAGGGGGCTGG - Intergenic
1061209728 9:129183905-129183927 GAGAAAGGAGAAAAGAGGGCAGG - Intergenic
1061416543 9:130450368-130450390 CAGGATGGAGGGAAGGAGGGAGG - Intronic
1061763627 9:132867914-132867936 CAGCATGGTGAGAAGGGTGCAGG + Intronic
1061883270 9:133578515-133578537 AAAAATGGAGAGAAAGAGGCTGG + Exonic
1062573797 9:137197396-137197418 CAGAAGGGACAGAACTGGGCTGG - Intronic
1203386779 Un_KI270438v1:62607-62629 TAGAATGGAGTGAAGTGGACTGG + Intergenic
1185627294 X:1491938-1491960 TGGAATGGACAGAAGGCGGCAGG + Intronic
1186172411 X:6891441-6891463 GAGAATGGAAAGAAAGGGGAAGG - Intergenic
1186752921 X:12640325-12640347 TAGTAAGGAGAGAAGGGGGAAGG + Intronic
1187078114 X:15956682-15956704 CAGAATGGGCAGTAGGGGACTGG + Intergenic
1187260365 X:17679847-17679869 CAGAATGAAGAAAGGGGGGGGGG + Intronic
1187488766 X:19729773-19729795 AAGAAGGGAGAGAAGGAGGGAGG + Intronic
1187704282 X:21993934-21993956 TACAAGGGAGAGAAGGGGGAGGG - Intronic
1187722446 X:22165435-22165457 CTGAATTGAGGCAAGGGGGCTGG + Intronic
1187957087 X:24529992-24530014 AAGAATGCAGAGGAGGGGTCTGG - Intronic
1188009165 X:25039465-25039487 CAGTATGGAGAGAAGGACGGTGG + Intergenic
1189068963 X:37844517-37844539 CTATATTGAGAGAAGGGGGCGGG - Intronic
1189511424 X:41665885-41665907 GGGAAAGGAGAGGAGGGGGCAGG + Intronic
1190288448 X:48975952-48975974 CAGAATGGAGAGGGAGGGCCAGG + Intronic
1190586966 X:51954781-51954803 CAGAATAGAGATAAGGGAACAGG + Intergenic
1192163195 X:68803986-68804008 GAGAATGGAGAGGAGGGGGTGGG + Intergenic
1192233365 X:69280898-69280920 CAGAATGGAGGGGTGTGGGCTGG - Intergenic
1192510252 X:71717079-71717101 GAGAATGGCGGGAAGGTGGCCGG + Exonic
1192516445 X:71764474-71764496 GAGAATGGCGGGAAGGTGGCCGG - Exonic
1192705973 X:73528829-73528851 TAGCATGGAGAGAAGGGGTGGGG - Intergenic
1193602848 X:83529641-83529663 CAGACTGGAGAAAAGTTGGCAGG + Intergenic
1193655087 X:84188343-84188365 CAGCTTGGGGTGAAGGGGGCGGG + Intergenic
1194128771 X:90053305-90053327 CAGAAGGGGGAGAATGGGACGGG + Intergenic
1194769218 X:97880232-97880254 CAGAATGGAGACAAGGTTGGAGG + Intergenic
1195496874 X:105546430-105546452 TAAAATGGAGAGAAGGAGGAAGG + Intronic
1195869135 X:109467966-109467988 CAGAATTGAGATAAGGAGTCTGG - Intronic
1196811952 X:119635949-119635971 CAGGATGGAGTGAAGGAGGAGGG + Intronic
1196835171 X:119807327-119807349 AAGAATAGAGAGAAAGGGGGTGG - Intergenic
1197767156 X:130066761-130066783 TTGAATGGGGAGAAAGGGGCTGG + Exonic
1197806006 X:130399179-130399201 GAGAATGGAGAGTAGGGGCTGGG + Intergenic
1198119971 X:133582793-133582815 CAGAAGGGAGAGAGTGGTGCAGG + Intronic
1198503156 X:137273232-137273254 CATAAGGGAGGGAAAGGGGCAGG - Intergenic
1198752215 X:139947189-139947211 CAGAATGCAGAGAAGGCGACAGG - Intergenic
1199372721 X:147070050-147070072 GAGACTGGAGAGGAAGGGGCAGG + Intergenic
1199723329 X:150558806-150558828 CTGAGTGGAGAGGAGGGGTCTGG + Intergenic
1200213269 X:154356307-154356329 CAGAATGGAGACAGGGAGCCCGG - Intronic
1201115825 Y:10834650-10834672 AAGAATGGAGAGAAGAGGTGTGG - Intergenic
1201123020 Y:10887629-10887651 CAGAATGGAGTGAAGTGGAGTGG - Intergenic
1201123303 Y:10889654-10889676 CAGAATGGAAAGGAGTGGACTGG - Intergenic
1201139871 Y:11019348-11019370 CGGAATGGAGAGGAGTGGACTGG - Intergenic
1201226573 Y:11824458-11824480 GAGAAAGGAGAGAGGAGGGCGGG - Intergenic
1201334887 Y:12869957-12869979 CAGGAGGGAGAGAAGGAGGAAGG - Intergenic
1201702474 Y:16899491-16899513 CATAAGGGAGAGAAGGGAGAGGG - Intergenic
1202270966 Y:23073652-23073674 CAGAAAGGGAAGAAGGGGGATGG + Intergenic
1202295060 Y:23347030-23347052 CAGAAAGGGAAGAAGGGGGATGG - Intergenic
1202368493 Y:24182574-24182596 CATACTGGACAGAAGGGGGCAGG + Intergenic
1202423961 Y:24707396-24707418 CAGAAAGGGAAGAAGGGGGATGG + Intergenic
1202446828 Y:24962689-24962711 CAGAAAGGGAAGAAGGGGGATGG - Intergenic
1202502292 Y:25487543-25487565 CGTACTGGACAGAAGGGGGCAGG - Intergenic