ID: 949005511

View in Genome Browser
Species Human (GRCh38)
Location 2:241644657-241644679
Sequence TCAGAAGTGTCGGCCGGTTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 114}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949005506_949005511 0 Left 949005506 2:241644634-241644656 CCAGAACCAAACCTCAGTAGAAA 0: 1
1: 0
2: 1
3: 10
4: 141
Right 949005511 2:241644657-241644679 TCAGAAGTGTCGGCCGGTTGCGG 0: 1
1: 0
2: 1
3: 15
4: 114
949005505_949005511 29 Left 949005505 2:241644605-241644627 CCTGTAGCTATCGAGCAGGCTGT 0: 1
1: 0
2: 2
3: 2
4: 51
Right 949005511 2:241644657-241644679 TCAGAAGTGTCGGCCGGTTGCGG 0: 1
1: 0
2: 1
3: 15
4: 114
949005507_949005511 -6 Left 949005507 2:241644640-241644662 CCAAACCTCAGTAGAAATCAGAA 0: 1
1: 0
2: 3
3: 21
4: 239
Right 949005511 2:241644657-241644679 TCAGAAGTGTCGGCCGGTTGCGG 0: 1
1: 0
2: 1
3: 15
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949005511 Original CRISPR TCAGAAGTGTCGGCCGGTTG CGG Intronic
900265494 1:1755107-1755129 ACAGAAGTGTCGGCCGGGCGCGG - Intronic
902348838 1:15838420-15838442 TCAGAAGTCTTGGCCGGTTTTGG + Intergenic
902461438 1:16580336-16580358 TAAGAAGTCTCGGCCGGGCGCGG - Intronic
902462223 1:16586635-16586657 TAAGAAGTCTCGGCCGGGCGCGG - Intronic
905600670 1:39247740-39247762 TTAAAAGTGTGGGCCGGGTGTGG + Intronic
908195763 1:61744166-61744188 TCAGGTGTGTCGGGAGGTTGAGG + Intronic
912277786 1:108278757-108278779 TAAGAAGAGTCGGCCGGGCGCGG + Intergenic
912290440 1:108415602-108415624 TAAGAAGAGTCGGCCGGGCGCGG - Intronic
912792666 1:112667993-112668015 TGAGAAGTGTGGGCCGGGAGTGG + Intronic
913247331 1:116881602-116881624 TTAGAAGTCTCGGCCAGGTGCGG - Intergenic
920461378 1:206143306-206143328 TCAGAACTGTCGGTCGGGAGGGG + Intergenic
921095579 1:211884715-211884737 TCAGAAGTGATTGCCAGTTGGGG + Intergenic
921644297 1:217595788-217595810 TAAGAAGGATCGGCCGGGTGCGG - Intronic
1064403698 10:15041865-15041887 TCAAAGGTGTGGGCCAGTTGCGG - Intronic
1066299248 10:34082267-34082289 CCAGAAGTGGAGGACGGTTGGGG + Intergenic
1074024136 10:109616103-109616125 TAAGAAGTGTGGGCCAGGTGTGG - Intergenic
1074546929 10:114408468-114408490 TCAGAAGTGGCTGCAGGTTGGGG + Intergenic
1075187692 10:120277718-120277740 TAAGATGTGTCAGCCGGGTGCGG + Intergenic
1075744990 10:124720907-124720929 TCAGAAATCTGGGCCGGGTGCGG + Intronic
1076083590 10:127605816-127605838 TAAGAATTGTGGGCCGGGTGCGG + Intergenic
1077328665 11:1974475-1974497 TCAGAACTCCCGGCCGGATGGGG + Intronic
1080870055 11:36229179-36229201 TCAGAAGAGTAGGGCGGTGGAGG - Exonic
1083835602 11:65264938-65264960 TCAAAAGGGTCGGCCGGGTGCGG + Intronic
1088025787 11:105180768-105180790 TCAGGATTGTCGGCCGGGCGCGG + Intergenic
1090802741 11:130183248-130183270 TAAGAAATGTAGGCCGGGTGTGG - Intronic
1202811644 11_KI270721v1_random:29654-29676 TCAGAACTCCCGGCCGGATGGGG + Intergenic
1092524756 12:9302801-9302823 TAAGAAGGGTCGGCCGGGTGTGG + Intergenic
1092542508 12:9429010-9429032 TAAGAAGGGTCGGCCAGGTGTGG - Intergenic
1094510503 12:31093423-31093445 TAAGAAGGGTCGGCCGGGTGCGG + Intronic
1095245111 12:39910792-39910814 TCAGAAATGTAGGCCAGGTGTGG + Intronic
1105787355 13:23762665-23762687 TCAGAAGTGTGGGCCTGTAATGG + Intronic
1109314629 13:60735586-60735608 TAAGAAGTGTTGGCCGGGCGCGG + Intergenic
1113984563 13:114303493-114303515 GCAGAATTGTCGGCCCGGTGCGG + Intronic
1117534313 14:56689227-56689249 TCATAACTGTTGGCCGGCTGCGG + Intronic
1118027155 14:61781157-61781179 TAAGAATTGTTGGCCGGGTGCGG + Intronic
1119276026 14:73357110-73357132 TAAAAAGTGTTGGCCGGGTGTGG + Intronic
1121844808 14:97163554-97163576 TCACAAGGGCCGGCCGGATGCGG - Intergenic
1125646284 15:41275443-41275465 TCAGAAGTTTTGGCCGGGGGTGG - Intronic
1126762413 15:51981181-51981203 TCAGACTTATCGGCCGGGTGCGG + Intronic
1134711796 16:16330327-16330349 TAAAAACTGTCGGCCGGGTGCGG + Intergenic
1134955032 16:18378366-18378388 TAAAAACTGTCGGCCGGGTGCGG - Intergenic
1135139484 16:19909261-19909283 TCAGAATGGTGGGACGGTTGGGG + Intergenic
1139765337 16:69223918-69223940 GAAGAACTGTCGGCCGGGTGTGG - Intronic
1140225353 16:73072158-73072180 TCAGAAATGTAGGCCAGGTGGGG + Intergenic
1140762060 16:78118617-78118639 CCAGAAGAGTCGCCCAGTTGTGG + Intronic
1145874021 17:28302131-28302153 TAAAAACTGTCGGCCGGGTGCGG + Intergenic
1147150975 17:38513547-38513569 TAAGACGTGTTGGCCGGGTGTGG - Intergenic
1148732601 17:49846565-49846587 ACATAAGTGACGGCCGGCTGTGG - Intronic
1148740298 17:49889062-49889084 TCAGGAGGGTAGGCCGGGTGCGG + Intergenic
1161154816 19:2727149-2727171 GCAGAAGTGATGGCCGGTTGCGG - Intronic
1161877399 19:6922323-6922345 TCAGAGGTGTTGGCCGGGTGTGG + Intronic
1164525998 19:29014251-29014273 TCTTAAGTGTCGGCCTGTTGGGG - Intergenic
1168353787 19:55690209-55690231 TCAGCTGTGGCGGCCGGTGGTGG - Intronic
1202677876 1_KI270711v1_random:24083-24105 TAAGAAGTCTCGGCCGGGCGCGG - Intergenic
925227864 2:2201407-2201429 TCATAAGTGTTGGCCGGGTGCGG + Intronic
926169119 2:10539932-10539954 GCAGAAGTGTAGGTCGGCTGAGG + Intergenic
928646314 2:33356387-33356409 TCAGAAATGTCTGCCGGGCGAGG + Intronic
929793836 2:45043355-45043377 TCTGAAGTGCCGGCTGGTTGGGG - Intergenic
930825814 2:55695853-55695875 TTAAAAGTGTCGGCCGGGCGCGG + Intergenic
931394976 2:61879566-61879588 TGAGAAGTATCGGCCAGGTGCGG - Intronic
939481004 2:142747234-142747256 TCAGAAAATTAGGCCGGTTGCGG + Intergenic
941134682 2:161699308-161699330 TAATAAATGTCGGCCGGGTGCGG - Intronic
947296070 2:228631970-228631992 TCAGGAAGGTCGGCCGGGTGTGG + Intergenic
949005502 2:241644578-241644600 TCAGAAGTGTTGGCCGGGCGCGG + Intronic
949005511 2:241644657-241644679 TCAGAAGTGTCGGCCGGTTGCGG + Intronic
1169314743 20:4580727-4580749 TCAAAATTGTTGGCCGGATGCGG + Intergenic
1170241374 20:14170180-14170202 AAAGAAGTGTTGGCCGGGTGTGG - Intronic
1171816338 20:29788891-29788913 TCAGAAGTCAAGGCCGGGTGCGG + Intergenic
1172414229 20:34751078-34751100 TGTGAAGTGTCGGCCGGGCGCGG + Intronic
1174921082 20:54702574-54702596 TAAGATTTGTCGGCCGGTCGCGG - Intergenic
1175102221 20:56587445-56587467 GCAGAAGTGACGGGGGGTTGGGG + Intergenic
1179725193 21:43338023-43338045 TCAGAGGTGTCGGCAGGTTGAGG - Intergenic
1180319779 22:11309409-11309431 TCAGAAGTAAAGGCCGGGTGCGG + Intergenic
1181817704 22:25451017-25451039 TAAGAAGTATAGGCCGGGTGCGG - Intergenic
1183215953 22:36480171-36480193 TTATCAGTGTCGGCCGGGTGCGG - Intronic
1184181512 22:42831007-42831029 ACAGAAGGGTCGGCCAGGTGTGG + Intronic
957612067 3:82480748-82480770 TAAGAAGTCTTGGCCGGGTGTGG - Intergenic
957642993 3:82883260-82883282 TCAGGAGTGTTGGCGGGGTGGGG + Intergenic
958955443 3:100461019-100461041 GCAGAAGTGACGGCCGGGCGCGG - Intergenic
959665018 3:108910938-108910960 TGAAATGTGTCGGCCGGGTGCGG - Intronic
961850901 3:129817291-129817313 CCATAAGAGTCGGCCGGGTGTGG + Intronic
963530431 3:146468338-146468360 TTAGAAGTGTCAGGCGGTTTGGG - Intronic
963813937 3:149809279-149809301 TAAGAAGTCTGGGCCGGGTGCGG + Intronic
968785146 4:2616088-2616110 TTAGAAGTTTCGGCCGGGCGCGG - Intronic
969562603 4:7959200-7959222 TCAGAAGTGACGTCTGGCTGAGG + Intergenic
980105572 4:128585199-128585221 TTAGAAATGCCGGCCGGGTGTGG + Intergenic
980830949 4:138128730-138128752 CAACAAGTGTCGGCCGGGTGCGG - Intergenic
989593076 5:43129944-43129966 CCAGAAGTTTCGGCTGGGTGTGG - Intronic
991136086 5:63184300-63184322 TCAGAAGTTTCCTCCAGTTGAGG - Intergenic
991925540 5:71701991-71702013 TGAGAAATGTCGGCTGGGTGCGG + Intergenic
992064548 5:73093975-73093997 AGAAAAGTGTCGGCCGGGTGCGG + Intergenic
992986633 5:82237351-82237373 TAAGAAGTCTTGGCCGGGTGTGG + Intronic
995003792 5:107166508-107166530 TAAGAAATGTCGGCCGGGCGCGG + Intergenic
998023425 5:138791326-138791348 TAAAAAATGTCGGCCGGGTGCGG + Intronic
999315072 5:150578416-150578438 ACAGCAGTTTCGGCCGGGTGCGG + Intergenic
999790237 5:154932853-154932875 TTAGAAGAGTTGGCCGGGTGTGG - Intronic
1002007196 5:176245009-176245031 TAAGAAATGTTGGCCGGGTGCGG - Intronic
1002219184 5:177665613-177665635 TAAGAAATGTTGGCCGGGTGCGG + Intergenic
1004325229 6:14668614-14668636 TAAGAAGTGTTGGCCGGGCGCGG + Intergenic
1007882476 6:45182827-45182849 TAACAAGTGTTGGCCTGTTGTGG + Intronic
1010971607 6:82268979-82269001 TCAGAGGTGTTGGCCGGGCGTGG + Intergenic
1011448857 6:87472342-87472364 TCAGATGTATCGGCCGGGCGTGG - Intronic
1022716547 7:32903938-32903960 TCAGAAGTGCTGGCCGGATGTGG - Intergenic
1023605150 7:41923882-41923904 TCACACATGTTGGCCGGTTGTGG - Intergenic
1026912266 7:74097831-74097853 TCAGAAGTGTGAGTGGGTTGGGG - Intronic
1027919623 7:84376310-84376332 TAAGAAGTGTTGGCCGGGCGCGG + Intronic
1033052617 7:138020149-138020171 TCAAAAATGTCGGCCGGGCGTGG - Intronic
1034159310 7:148981064-148981086 TTAGAAGTGTTGGCGGGGTGTGG - Intergenic
1037627448 8:20620393-20620415 TAAAAAGTGTTGGCCGGGTGTGG + Intergenic
1040779260 8:51088469-51088491 ACATCAGTGTCGGCCGGGTGCGG + Intergenic
1041438287 8:57865615-57865637 TAACAAGTGTCGGCAGGATGTGG - Intergenic
1048784001 8:138031138-138031160 TTAGAAGTGTTGGCTGGGTGCGG - Intergenic
1048942038 8:139408279-139408301 TCATAAGTATAGGCCGGGTGCGG + Intergenic
1049054613 8:140226007-140226029 TCAGAAGTTTTGGCCTGTAGAGG + Intronic
1056481239 9:87008624-87008646 TCTGAAGTGACTGCCTGTTGTGG - Intergenic
1057607284 9:96508304-96508326 TCTGAAGTATGGGCCGGGTGCGG - Intronic
1057701998 9:97370135-97370157 TCAGAAATGGTGGCAGGTTGTGG + Intronic
1058217102 9:102248585-102248607 TCAGAAGTTTAGGCTGGGTGCGG + Intergenic
1059645921 9:116267581-116267603 TAAGAAATGGCGGCCGGGTGCGG + Intronic
1062508465 9:136890891-136890913 TGAGAAGCGTCTGCCGGTGGTGG + Intronic
1203368009 Un_KI270442v1:275158-275180 TCAGAAGTAAAGGCCGGGTGTGG + Intergenic
1186015651 X:5189690-5189712 TTAGAAGAGTGGGCCGGGTGTGG - Intergenic
1186238990 X:7546363-7546385 TCAGAGATGGCGGCTGGTTGAGG + Intergenic
1187051517 X:15701204-15701226 TAAGAAGTCTAGGCCGGGTGCGG + Intronic
1189484316 X:41417555-41417577 TCAGAATTCTCGGCCGATTAGGG - Intergenic
1190263076 X:48811011-48811033 TTAGAAGTGCCGGCTGGGTGCGG + Intronic
1190585377 X:51934821-51934843 TGAGAAGTGTCAGCCAGGTGTGG + Intergenic
1190829574 X:54047897-54047919 TCAAAAGTGTTGGCCGGGTGTGG + Intronic
1194222728 X:91215299-91215321 TAAGAAGTGTCGGCCGGGCGCGG - Intergenic
1202360981 Y:24110175-24110197 TGAGAAATGTCGGCCGGGCGCGG + Intergenic
1202509797 Y:25559943-25559965 TGAGAAATGTCGGCCGGGCGCGG - Intergenic