ID: 949007171

View in Genome Browser
Species Human (GRCh38)
Location 2:241656291-241656313
Sequence GACGTGGGACGCGGGTGACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 1, 3: 0, 4: 87}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949007171_949007186 22 Left 949007171 2:241656291-241656313 CCACGTCACCCGCGTCCCACGTC 0: 1
1: 0
2: 1
3: 0
4: 87
Right 949007186 2:241656336-241656358 CTGCTGCTCCCTCTGTCTCCAGG 0: 1
1: 1
2: 4
3: 152
4: 1602
949007171_949007187 23 Left 949007171 2:241656291-241656313 CCACGTCACCCGCGTCCCACGTC 0: 1
1: 0
2: 1
3: 0
4: 87
Right 949007187 2:241656337-241656359 TGCTGCTCCCTCTGTCTCCAGGG 0: 1
1: 1
2: 10
3: 122
4: 1895

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949007171 Original CRISPR GACGTGGGACGCGGGTGACG TGG (reversed) Intronic
904494367 1:30878382-30878404 GACGTGGGACCCTGGAGACCTGG + Intronic
904826406 1:33276408-33276430 GACGTGGGCGGCAGGTGAGGCGG - Exonic
916015078 1:160742530-160742552 AAGGTGGGATGCGGGTGACAAGG - Intronic
920002548 1:202809739-202809761 GACGGGGGACGGGGGTGGGGGGG + Intergenic
924161659 1:241239199-241239221 GCCGTGGGAGGCAGGTCACGAGG - Intronic
1066429371 10:35336965-35336987 GACGCGGGGCGCGGGCGGCGGGG - Exonic
1074644476 10:115430804-115430826 GGAGTGGGACGTGGGTGCCGTGG + Intronic
1075345554 10:121679521-121679543 GACGTGGGACACGGGGGTGGTGG + Intergenic
1077028203 11:450967-450989 GACGCTGGAGGCGGGTGGCGGGG - Intronic
1077065643 11:639986-640008 GAGGCGGGGCGCGGGTGGCGTGG - Exonic
1077254007 11:1572564-1572586 GACGGGGGGCCTGGGTGACGCGG - Intergenic
1077332004 11:1987946-1987968 GGCGTGGGTGGCGGGCGACGGGG - Intergenic
1078180097 11:9004113-9004135 GACGCGGGACGCGGGACGCGAGG - Intergenic
1079190353 11:18272010-18272032 GAGGTGGGAAGCGGGTGCAGTGG - Intergenic
1202814985 11_KI270721v1_random:43122-43144 GGCGTGGGTGGCGGGCGACGGGG - Intergenic
1091387443 12:103800-103822 GACGTGGGACTCAGGTGGGGAGG + Intronic
1092659475 12:10722956-10722978 GACGTGGGCGGCGGGCGCCGGGG + Exonic
1102913764 12:116737910-116737932 GACGTGGGGCGCGGCGGCCGGGG + Exonic
1106181158 13:27370433-27370455 GAAGTGGGACGGTGGTGACCAGG - Intergenic
1113756000 13:112811363-112811385 GGCGTGGGATGCTGGTGATGGGG - Intronic
1113935983 13:113995769-113995791 GACGGGGGGCCCGGCTGACGGGG + Intronic
1113936004 13:113995816-113995838 GACGGGGGGCCCGGCTGACGGGG + Intronic
1113936012 13:113995832-113995854 GACGGGGGGCCCGGCTGACGGGG + Intronic
1113993226 14:16045382-16045404 GACGTGGGACGTGAGTGGGGTGG - Intergenic
1122231102 14:100306615-100306637 GAGGCGGGGCGCGGGGGACGTGG + Intergenic
1133270754 16:4609834-4609856 GAAGTGTGGCGGGGGTGACGTGG + Exonic
1135747778 16:25031931-25031953 GAATTGCGACGCGGGCGACGAGG + Intergenic
1136553826 16:30996663-30996685 GACGTGAGCCGCGGGTGGGGCGG - Exonic
1137055931 16:35746709-35746731 CATGTGGGAAGCGGGTGGCGGGG - Intergenic
1139346000 16:66304330-66304352 GAAGTGGGAAGCGGGGGACTTGG - Intergenic
1141620685 16:85235343-85235365 GAGGTGGGAGGGGGGTGAGGGGG - Intergenic
1142224434 16:88870688-88870710 GACGTGGGGCTGGGGCGACGGGG - Intergenic
1144880917 17:18430234-18430256 GACGTGGGAAGCTGGTGAGAAGG + Intergenic
1145151315 17:20514153-20514175 GACGTGGGAAGCTGGTGAGAAGG - Intergenic
1148079561 17:44960160-44960182 GACGTGGGTGGAGGGAGACGTGG + Exonic
1148166876 17:45490180-45490202 GACGGGGGATGGGGGTGACTGGG + Intronic
1152262577 17:79274974-79274996 GAGGTGGGACGGGGGTGGGGTGG - Intronic
1158406350 18:57163201-57163223 GAAGTGGGACTGGGGTGAAGTGG - Intergenic
1158756537 18:60332179-60332201 GACGTGGCAGGGGGGTGAAGTGG - Intergenic
1161438807 19:4279323-4279345 GAGGTGGGACGCTGGGGAGGGGG - Exonic
1164643860 19:29844517-29844539 GACGCGCGGCGCGGGAGACGCGG - Intergenic
1164822771 19:31263420-31263442 GCCGTGGGCAGCGGGTGGCGAGG - Intergenic
1167613207 19:50517303-50517325 GACGTGGGACCCAGGAGAAGTGG - Exonic
927858236 2:26540641-26540663 GACGAGGGCCGGGGGTGGCGGGG + Intronic
938538468 2:132265484-132265506 GACGTGGGACGTGAGTGGGGTGG + Intergenic
946041973 2:216790539-216790561 GAGGTGGGAGGCGGGAGGCGGGG - Intergenic
948638952 2:239360980-239361002 GAGGTGGGACGTGGGTGTGGAGG - Intronic
948825420 2:240571467-240571489 GACTTGGGACGAAGGTGATGTGG + Intronic
949007171 2:241656291-241656313 GACGTGGGACGCGGGTGACGTGG - Intronic
949007175 2:241656307-241656329 GATGTGGGACGGGGGTGACGTGG - Intronic
1170325470 20:15151216-15151238 GAGATGGGACGCGGCTTACGAGG + Intronic
1171907872 20:30915233-30915255 GACGTGGGACGTGAGTGGGGTGG - Intergenic
1174129664 20:48334058-48334080 GACCTGTGAAGAGGGTGACGAGG + Intergenic
1176096709 20:63347665-63347687 GACGCGGGACGGGGGAGCCGGGG - Intronic
1176233342 20:64042768-64042790 GACGGGGGTCGTGGGGGACGGGG + Intronic
1176233362 20:64042809-64042831 GACGGGGGTCGTGGGGGACGGGG + Intronic
1176233383 20:64042851-64042873 GACGGGGGTCGTGGGGGACGGGG + Intronic
1176233415 20:64042914-64042936 GACGGGGGTCGTGGGGGACGGGG + Intronic
1176233443 20:64042976-64042998 GACGGGGGTCGTGGGGGACGGGG + Intronic
1178665775 21:34545051-34545073 GGCATGGGACTCGGGAGACGTGG - Intronic
1180100106 21:45579887-45579909 GCCCTGGGACGCGGGTGCCCCGG + Intergenic
1180314042 22:11262131-11262153 GACGTGGGACGTGAGTGGGGTGG + Intergenic
1180341317 22:11621403-11621425 GACGTGGGACGTGAGTGGGGTGG - Intergenic
1180722219 22:17917834-17917856 GATGTGGGTCGAGAGTGACGGGG - Intronic
1181272395 22:21666844-21666866 AACGTGGGACGTGGGGCACGGGG - Intronic
1183368643 22:37420080-37420102 GGGGTGGGCCGCGGGGGACGGGG + Intronic
1185281240 22:49970995-49971017 GAAGGGGGACGCTGGTGACAGGG + Intergenic
950583514 3:13878258-13878280 GAGGAGGGACACGGGTGGCGGGG - Intronic
963381119 3:144531323-144531345 GGCTTGGGACGCTGGTGAAGAGG + Intergenic
966866765 3:184262482-184262504 GCCCTGGGCTGCGGGTGACGCGG + Intronic
985539147 5:479729-479751 GCCTTGGGACGCGGGTGCAGGGG + Intronic
988721586 5:33884365-33884387 GACGTGGGATGGGAGTGAAGGGG - Intronic
990910080 5:60843998-60844020 GAAGTGGGACCCGGGTGCGGGGG - Intronic
992013858 5:72556921-72556943 GACGAGGGAGGCGGGTGGAGAGG + Intergenic
1001453965 5:171846747-171846769 GAGGTGGGATGCGGGGGATGGGG - Intergenic
1001917486 5:175574016-175574038 GATGTGGGATGAGGGTGTCGGGG - Intergenic
1006457152 6:34138461-34138483 GATGTGGGATGTGGGTGATGAGG - Intronic
1032908453 7:136401194-136401216 GACATGGGACGCTGGTAACATGG + Intergenic
1033342837 7:140505441-140505463 GAGGTGGGACCCGTGTGAGGTGG + Intergenic
1035609395 8:949789-949811 GTCCTGGGACGCAGGTCACGCGG + Intergenic
1035725727 8:1823981-1824003 CGCGGGGGACGCGGGGGACGCGG + Exonic
1036649829 8:10635113-10635135 GGCTGGGGACTCGGGTGACGCGG + Intronic
1060477927 9:123999619-123999641 GGCCGGGGACGCGGGGGACGCGG + Intergenic
1062616504 9:137398984-137399006 GATGTTGGACGCGTGTCACGGGG - Intronic
1062638243 9:137502701-137502723 CGCGGGGGACGCGGGGGACGCGG + Intronic
1062638249 9:137502710-137502732 CGCGGGGGACGCGGGGGACGGGG + Intronic
1203362354 Un_KI270442v1:228250-228272 GACGTGGGACGTGAGTGGGGTGG + Intergenic
1192212568 X:69137167-69137189 CACGGGGGACCCGGGGGACGGGG - Intergenic
1201075893 Y:10188006-10188028 GACGTGGGACGTGAGTGGGGTGG - Intergenic