ID: 949008591

View in Genome Browser
Species Human (GRCh38)
Location 2:241665632-241665654
Sequence CTCCCATCCGGGGCCTGCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 216}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949008582_949008591 19 Left 949008582 2:241665590-241665612 CCTGTGGCTGAGAGTAGCCTCTG 0: 2
1: 0
2: 0
3: 20
4: 205
Right 949008591 2:241665632-241665654 CTCCCATCCGGGGCCTGCAGTGG 0: 1
1: 0
2: 2
3: 19
4: 216
949008586_949008591 2 Left 949008586 2:241665607-241665629 CCTCTGGGTGGCAGTGTCCTCTG 0: 1
1: 0
2: 0
3: 27
4: 309
Right 949008591 2:241665632-241665654 CTCCCATCCGGGGCCTGCAGTGG 0: 1
1: 0
2: 2
3: 19
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949008591 Original CRISPR CTCCCATCCGGGGCCTGCAG TGG Intronic
900170816 1:1267787-1267809 CGCCCAGCAGGGGCCGGCAGAGG + Intronic
900262494 1:1739095-1739117 CACCCCTCCCGTGCCTGCAGTGG + Intronic
900352544 1:2242447-2242469 CTCCCCTGCGGGGCCAGAAGGGG - Intronic
900557930 1:3289374-3289396 CACCCATCTGGCACCTGCAGGGG - Intronic
900764426 1:4494512-4494534 CCCCCATCCAGGGGCTGCAGGGG - Intergenic
902036039 1:13458816-13458838 ATCCCATCTGAGGCTTGCAGTGG + Intergenic
903329872 1:22591865-22591887 TGCCCTTCCGGGCCCTGCAGTGG + Intronic
903731925 1:25503067-25503089 CTCGCAGCAGGGGCCTGCTGGGG + Intergenic
904517456 1:31067315-31067337 CTCCCATCAGGGTCCTGGTGGGG + Intergenic
905662924 1:39741610-39741632 CTCCCATTCTTGCCCTGCAGAGG + Intronic
905811462 1:40916454-40916476 CTGCCATGTGGGGCCTGCCGAGG - Intergenic
905860988 1:41351265-41351287 CTCCCATTCAGGTCCTGCACTGG + Intergenic
905863646 1:41365652-41365674 CCCCCATCCTAGGCCTGGAGGGG - Intronic
906215354 1:44035138-44035160 CTCCCATCCTGGGTCTGGAGAGG + Intergenic
911408096 1:97466920-97466942 CCCCCTTTAGGGGCCTGCAGTGG + Intronic
912572759 1:110636681-110636703 CACCAATGCTGGGCCTGCAGAGG + Intergenic
913073001 1:115318094-115318116 CTCCCTTCCATGGCCTGCAGGGG + Intronic
914171827 1:145232866-145232888 CTCCCAGCCGGGCCCCTCAGCGG + Intergenic
917821717 1:178769744-178769766 CACGCATCCAAGGCCTGCAGTGG + Intronic
917906737 1:179592301-179592323 TTCCCATCCGAAGCCTTCAGGGG - Intronic
918343774 1:183589001-183589023 CTCCTCTCAGGGGCCTGCTGAGG - Intronic
919830775 1:201539004-201539026 CTCCCCTCCTGGGCCCGCCGTGG + Intergenic
919992471 1:202718051-202718073 CTGCCCTCAGGGGCCTGCTGGGG - Intergenic
920181020 1:204131740-204131762 CTCCCACATGGGGCATGCAGGGG + Exonic
922335833 1:224617475-224617497 CGCCCAGTCGGGCCCTGCAGAGG - Intronic
922490605 1:226013589-226013611 CTCCCAGCCAGGTTCTGCAGAGG + Intergenic
923657548 1:235931388-235931410 CTCCCACCTGCAGCCTGCAGTGG + Intergenic
1069545020 10:69321463-69321485 CTCCCAGCAGGGACCTGCTGAGG + Intronic
1071569040 10:86686446-86686468 CTCCCTCCCAGGGTCTGCAGGGG - Intronic
1072788699 10:98302147-98302169 CTCCCAGCTGGAGCCTGCAAAGG + Intergenic
1074534558 10:114319602-114319624 CACCCATCTGGGGACTCCAGTGG + Intronic
1074591881 10:114821739-114821761 CTGCCCGCCGCGGCCTGCAGGGG - Exonic
1075644584 10:124089367-124089389 CTGCAATCCTGGGCCTGCTGAGG + Intronic
1075699509 10:124460088-124460110 CTGCCCTCCTAGGCCTGCAGAGG + Intergenic
1075808907 10:125210150-125210172 CTCCCTCCCAGGGCCTGCACTGG - Intergenic
1075998365 10:126895946-126895968 CTCCCTTCTGGGTGCTGCAGGGG - Intergenic
1076204158 10:128581932-128581954 CACCGGTCAGGGGCCTGCAGGGG - Intergenic
1076394477 10:130128962-130128984 CGCTCCTCCGGAGCCTGCAGGGG - Intergenic
1076402930 10:130195188-130195210 CTGGCACCAGGGGCCTGCAGTGG + Intergenic
1076567772 10:131410701-131410723 CTCAGATCCGGAGCCAGCAGCGG + Intergenic
1076655920 10:132023241-132023263 CTCCCAACCGTGGACAGCAGAGG - Intergenic
1077326611 11:1966779-1966801 GTCCCATCCCAGGCCAGCAGTGG - Intronic
1078010725 11:7571126-7571148 ATCCCAGCTGGGGCCAGCAGAGG - Intronic
1084729193 11:71062393-71062415 TTCCCATCTGGGGCCTGGTGGGG + Intronic
1085304297 11:75476528-75476550 TTCCCAGCAGGGGCCTGGAGTGG + Intronic
1085446154 11:76602579-76602601 CTCCCCTCCTGGGCCTCCTGGGG + Intergenic
1085475077 11:76784141-76784163 CTCCCAGCCGGGGTCTGAGGGGG - Intronic
1088728150 11:112657469-112657491 GACCCCTCCAGGGCCTGCAGAGG - Intergenic
1202809591 11_KI270721v1_random:21958-21980 GTCCCATCCCAGGCCAGCAGTGG - Intergenic
1091587187 12:1822952-1822974 CCCACACCCTGGGCCTGCAGGGG - Intronic
1096862813 12:54542161-54542183 CCCCCTTCCGTGGCCTGCAGTGG + Intronic
1101381214 12:104215720-104215742 CTCCGACCCGCGGCCGGCAGGGG + Intergenic
1102010942 12:109617991-109618013 CTCAAATCCTGGGCCTGGAGGGG + Intergenic
1103910295 12:124348441-124348463 CTCACAGCCGAGGCCTCCAGAGG + Intronic
1103977923 12:124715713-124715735 CGCCCAGCCGGGCCCTGCAATGG - Intergenic
1104924335 12:132306137-132306159 CCCCCGTGGGGGGCCTGCAGGGG + Intronic
1106312878 13:28569052-28569074 CTTCCCTCCCGGCCCTGCAGTGG + Intergenic
1113453017 13:110425644-110425666 CTCCCATCCGGCTACTGCTGTGG + Intronic
1113535987 13:111066759-111066781 CTCCCTTCCCGCGCCTGCAAGGG - Intergenic
1113559732 13:111269068-111269090 CTCCCAAGCGGGACGTGCAGAGG - Intronic
1113911395 13:113843123-113843145 GTGCCCTCGGGGGCCTGCAGAGG - Intronic
1113931221 13:113969999-113970021 CTCCCATCCAGGCCCTGCGCGGG + Intergenic
1122092038 14:99347199-99347221 CTCCCATCATGGGCCTGGGGAGG + Intergenic
1122100893 14:99408901-99408923 CTCCCAGGGTGGGCCTGCAGAGG + Intronic
1122263536 14:100536348-100536370 GTGCCATCCCAGGCCTGCAGCGG - Intergenic
1122775198 14:104113904-104113926 CGGCCATCCGGGGACAGCAGGGG - Exonic
1124609839 15:31200938-31200960 CTTCCCTCCAGGGCCTGCTGGGG + Intergenic
1125679280 15:41520781-41520803 CAGCCATGCGGGTCCTGCAGTGG - Exonic
1125889979 15:43258653-43258675 CTCTCAGCCAGGGCCAGCAGTGG + Intronic
1128523322 15:68389915-68389937 CTCCAATGCAGGGCTTGCAGAGG - Intronic
1128708085 15:69851835-69851857 CTCCCCTCTGGGGTCTGCACTGG - Intergenic
1129541046 15:76347153-76347175 CTCCCAGGCGGGGGCTGCCGCGG - Intergenic
1129746477 15:78025203-78025225 CTCCCGTCCTTGGCCTGCTGAGG + Intronic
1132142075 15:99404660-99404682 CTCCCTACCGGGGCCAGCGGCGG + Intergenic
1132228980 15:100167923-100167945 CTCCCTTCTGGGGCCTGCTCTGG + Intronic
1132308205 15:100833820-100833842 CTCCCATGAGGGGTCTGCATGGG - Intergenic
1132718809 16:1305993-1306015 GCCCCCTCCGGGGCCTGCTGGGG - Intergenic
1132802927 16:1763072-1763094 CTCCCCTCCAGGCCCTGAAGCGG + Intronic
1132824265 16:1895386-1895408 CTCCCTTCCGTGGACTGGAGAGG - Intergenic
1133130342 16:3672863-3672885 CTCCCAGCCAGGGCCTGCCTGGG - Intronic
1135132214 16:19862256-19862278 CTGTCACCCGCGGCCTGCAGAGG - Intronic
1135539839 16:23321398-23321420 CTCACAGGCGGGGCCTTCAGAGG - Intronic
1135648270 16:24182706-24182728 CTCCCATCTGTGGGCTGGAGGGG + Intronic
1135970919 16:27071217-27071239 TTCCCTTCCTGGCCCTGCAGGGG - Intergenic
1136399816 16:30011128-30011150 CTCCCACCCGGGGCCCGCTCGGG + Intronic
1137010287 16:35314418-35314440 CCCCCATCCAGGGCCAGCTGTGG - Intergenic
1140878235 16:79173219-79173241 CTCCCCTCCTGGGCCTCCTGAGG + Intronic
1140978538 16:80084256-80084278 CTCCCTTCAGGGCCCTACAGAGG + Intergenic
1141409945 16:83826261-83826283 CTTCCATCTGTGGCCAGCAGAGG + Intergenic
1142306905 16:89290826-89290848 GTCCCCTCCTTGGCCTGCAGTGG - Exonic
1143649526 17:8254969-8254991 CTCCCAGCTGAGGCCTGCCGGGG + Intronic
1146258222 17:31404136-31404158 CACACAGCCTGGGCCTGCAGAGG - Intronic
1146938221 17:36825791-36825813 CCCCCATCCTGGGCCAGCAGGGG + Intergenic
1147685843 17:42286547-42286569 TTCTCCTCCAGGGCCTGCAGAGG - Intergenic
1148239985 17:45993951-45993973 CTCAGATCTGGGCCCTGCAGGGG - Exonic
1148493270 17:48037117-48037139 CGCCCACTCGGGGCCTGCAGTGG - Intronic
1149644174 17:58227773-58227795 CCTCCATGCAGGGCCTGCAGAGG + Intronic
1151474700 17:74338957-74338979 CTCCCTTCCTGGGTCAGCAGGGG - Intronic
1151624913 17:75270732-75270754 GCCCCATCCGGGGGATGCAGCGG - Intronic
1151670842 17:75570941-75570963 CTCCCCTCCTGTGCCTGCAAGGG - Exonic
1152094327 17:78264209-78264231 CTCCCAGGCTGGCCCTGCAGAGG + Intergenic
1152701707 17:81822894-81822916 CTCCCCTCCTGATCCTGCAGTGG + Exonic
1152766782 17:82145741-82145763 CCCCACTCAGGGGCCTGCAGGGG - Intronic
1157275848 18:46310809-46310831 CCCCATTCAGGGGCCTGCAGTGG - Intergenic
1157279714 18:46338345-46338367 CCCCTATCCAGGGCCAGCAGCGG + Intronic
1160700498 19:504680-504702 CTCCCTTCCCAAGCCTGCAGAGG + Intronic
1160863919 19:1249057-1249079 CTCCCAGGCGGGCCCGGCAGAGG + Intronic
1165060511 19:33202838-33202860 CTCCCGACAGCGGCCTGCAGTGG + Exonic
1166002421 19:39885773-39885795 CACCCATCTGGGCACTGCAGAGG + Exonic
1166005205 19:39902025-39902047 CACCCATCTGGGCACTGCAGAGG + Exonic
1167011726 19:46813191-46813213 CTCCCAGGAGGGGCCTGGAGGGG + Intergenic
1167096366 19:47376846-47376868 CTCCCAGGTGGGTCCTGCAGAGG + Intronic
1167377759 19:49120516-49120538 CTACCACCTGGGGCCAGCAGAGG - Intronic
926217519 2:10914463-10914485 CCCCCATCCTGGGCCTGCAGGGG - Intergenic
927256301 2:21043699-21043721 CCCCCATCCTGAGCCTGCAGGGG + Intronic
931218449 2:60267378-60267400 TTCCCAGCCGGGGCACGCAGAGG + Intergenic
932442975 2:71749576-71749598 CTCACATCATGGCCCTGCAGGGG - Intergenic
935056656 2:99573464-99573486 CCCCCACCAGGGGCTTGCAGTGG - Intronic
935062880 2:99623495-99623517 CGCCCATCCTGGGCTGGCAGAGG - Intronic
935674742 2:105584970-105584992 CTTCCACCCAGGGCCTGCACTGG - Intergenic
946038733 2:216765898-216765920 CTCCCACCCTCAGCCTGCAGTGG - Intergenic
948121951 2:235537280-235537302 CTCCCCACCTGGGCCTGCAGCGG - Intronic
948273624 2:236692079-236692101 CTCCCACCCGGGGCAAGCATGGG + Intergenic
949008591 2:241665632-241665654 CTCCCATCCGGGGCCTGCAGTGG + Intronic
1170591290 20:17773718-17773740 CTCCAAACCTGAGCCTGCAGTGG - Intergenic
1174194451 20:48763273-48763295 CGCCCATCTGGGGCCTGCATGGG + Intronic
1175353427 20:58343067-58343089 CTCCCATCCGGGGCTCGATGAGG + Intronic
1175947246 20:62564638-62564660 CCCCCATCGGGGACCCGCAGGGG - Intronic
1176195566 20:63835197-63835219 CTCCCAGCAGAGGCCTGGAGAGG - Intergenic
1176547707 21:8208742-8208764 CTCGCTTCCCGGGCCTGCCGCGG + Intergenic
1176555604 21:8252948-8252970 CTCGCTTCCCGGGCCTGCCGCGG + Intergenic
1176566652 21:8391784-8391806 CTCGCTTCCCGGGCCTGCCGCGG + Intergenic
1176574534 21:8435976-8435998 CTCGCTTCCCGGGCCTGCCGCGG + Intergenic
1176611146 21:8987268-8987290 CTCGCTTCCCGGGCCTGCCGCGG + Intergenic
1179889062 21:44326693-44326715 CTCCCATCCCCGTCCTGCACAGG + Exonic
1180011109 21:45052146-45052168 CTCCCAGGCGAGGCCTGCACCGG + Intergenic
1180066616 21:45415611-45415633 TTCCCGTCCGGGGCCTGCCCCGG - Intronic
1180874959 22:19170973-19170995 CTCCCATCCAGGCCCTGTGGAGG + Intergenic
1181057890 22:20268444-20268466 ATCCCCTCCGCCGCCTGCAGGGG - Exonic
1181388162 22:22559286-22559308 CTCGCGTCTGGGGCCAGCAGGGG + Exonic
1181638535 22:24185302-24185324 CTCCCATCAGGGCCCAGGAGAGG + Intronic
1182548303 22:31088008-31088030 CAGCCATCCGGGAACTGCAGCGG + Exonic
1183702613 22:39458353-39458375 ACCCCATCAGGGGCCTTCAGGGG - Intronic
1184561998 22:45268849-45268871 CTCACTTCCAGGGGCTGCAGGGG - Intergenic
1184609489 22:45593696-45593718 CTCTCACCCGGAGCCTTCAGTGG + Intronic
1185058438 22:48593090-48593112 CTCCCATCCCGCGTCTGCTGCGG - Intronic
1185256861 22:49838803-49838825 CTCCCATCCCCGCCCGGCAGTGG + Intergenic
1203252581 22_KI270733v1_random:125027-125049 CTCGCTTCCCGGGCCTGCCGCGG + Intergenic
1203260637 22_KI270733v1_random:170113-170135 CTCGCTTCCCGGGCCTGCCGCGG + Intergenic
950124793 3:10504694-10504716 TTCCCATCCTGACCCTGCAGGGG + Intronic
953766753 3:45748806-45748828 CTCCCAACCAGGGACTGCAGGGG + Intergenic
954435094 3:50491727-50491749 CTCACAGCCGTGGCCTGTAGAGG + Intronic
956452645 3:69389697-69389719 CTCCACTCCAGGGACTGCAGTGG + Intronic
958060019 3:88467376-88467398 CTACCATCGGTTGCCTGCAGGGG + Intergenic
961874730 3:130013467-130013489 CTCCCCACCGGGGCCTTCTGCGG + Intergenic
962873866 3:139520567-139520589 CTTCCATCCCAGGCCTGTAGAGG + Intronic
964927478 3:161976277-161976299 CTCCCATTCCAGGCCTGGAGAGG + Intergenic
966931917 3:184680942-184680964 CTCCCAACCAGGGCCTGCCAAGG + Intronic
967219054 3:187234108-187234130 CTCCCATCAGGGGTCTCAAGTGG - Exonic
967876510 3:194271472-194271494 CACCCAGCCTGGGCCTGGAGGGG - Intergenic
968182763 3:196609450-196609472 CTCCCAGCAGGGGGCAGCAGCGG + Intergenic
968641144 4:1715702-1715724 CTCCCACCCTGCTCCTGCAGAGG + Intergenic
968898935 4:3421718-3421740 CTCCAAGCCTGGGCCTCCAGAGG - Intronic
968938561 4:3626156-3626178 CACCCAGCCGGGGCCTGGTGTGG + Intergenic
969458584 4:7315216-7315238 CACCCAACCAGGGGCTGCAGAGG - Intronic
969618395 4:8266811-8266833 TGCGCATCCTGGGCCTGCAGAGG - Intergenic
971421881 4:26481368-26481390 CTCCCGTCCCTGGCCTGCTGAGG + Intergenic
982224838 4:153155878-153155900 CTCCCTGCCTGGCCCTGCAGTGG - Intronic
983792415 4:171813830-171813852 CTCCCAGCCGCTGCCTGCAGAGG + Exonic
983938880 4:173521962-173521984 ACCCCATCCGGGGCTTGCACCGG + Intergenic
986199612 5:5569436-5569458 CTGCCCTCCAGGGCCTGCTGTGG + Intergenic
991635394 5:68699362-68699384 CTGTCATCCCTGGCCTGCAGAGG - Intergenic
992039561 5:72816670-72816692 CTCCTGTCCGGGGCCTGAAATGG - Exonic
992857285 5:80875494-80875516 CTCCCCTCTGGGGCTGGCAGGGG + Intronic
994106820 5:95959094-95959116 CTCCCTTCTGGGGCCTCCAGTGG + Intronic
994171563 5:96663186-96663208 CTCCCTTCCGGGTCCTGCCCAGG - Intronic
994354838 5:98783252-98783274 CTCCACCCCGGGGGCTGCAGGGG + Intronic
999432821 5:151538643-151538665 CTTCCATCCAGGGCATGTAGGGG - Intronic
999524203 5:152384556-152384578 CTCCCATCTTTGGCCTGCTGAGG + Intergenic
1000009828 5:157220531-157220553 TTCCCACCTGGGGCCAGCAGAGG + Intronic
1001396184 5:171420675-171420697 CTCCCAGCCGAGGCCGACAGTGG - Intronic
1001587710 5:172844668-172844690 CTCCCACCCGGGGCCTGGCCTGG + Intronic
1002598286 5:180338521-180338543 CCCTCATCAAGGGCCTGCAGCGG - Exonic
1002890517 6:1327652-1327674 CTCCCTGCCGTGGCTTGCAGGGG + Intergenic
1003382386 6:5636960-5636982 TTGCCATCTGGTGCCTGCAGTGG - Intronic
1004690488 6:17988153-17988175 GTCCCACACGGAGCCTGCAGCGG + Intergenic
1005959512 6:30685651-30685673 CTCCGCTCCCGGGCCTCCAGAGG + Exonic
1007327475 6:41073263-41073285 CTCCCGGCCGAGGCCTGCAGGGG + Intronic
1012244589 6:96912271-96912293 CTGCCATACGGAGGCTGCAGTGG + Intergenic
1019355960 7:579111-579133 CGCCCGTCCGGGGCCTCCATGGG - Intronic
1020016417 7:4834527-4834549 CTCCCAGCCGGGGCCAGCTCCGG + Intronic
1020192165 7:6008858-6008880 CGCCACTCCGGGGCCTCCAGGGG + Intronic
1024242775 7:47448217-47448239 CACCCATGTGGGGCATGCAGAGG + Intronic
1024243047 7:47449983-47450005 CTCCCATGCGGATCCAGCAGAGG + Intronic
1025033001 7:55572437-55572459 CTCCCAGCCGGGCCCCCCAGCGG - Exonic
1027187153 7:75979477-75979499 CTCCCAGACGGGGACTGCAGAGG + Exonic
1029264302 7:99326135-99326157 CTCCCTGCCGGGGCCTCCTGAGG + Intronic
1029425131 7:100489925-100489947 CTCCCTTCCCGGGGCTGCAGGGG + Intronic
1029438943 7:100576962-100576984 CTCCCAAGCAGGGGCTGCAGCGG - Exonic
1032792382 7:135252076-135252098 CACCCATCTAGGGACTGCAGAGG - Intronic
1032865389 7:135919448-135919470 CACTCATCAGGGGCCAGCAGCGG - Intergenic
1034202234 7:149289882-149289904 CTCCCTTTCCAGGCCTGCAGAGG + Intronic
1035732047 8:1860268-1860290 GCCACATCCGGGGCATGCAGAGG - Intronic
1037810044 8:22081597-22081619 CTCACTGCCGGGGACTGCAGAGG - Exonic
1039545614 8:38408853-38408875 CCTCCATCTTGGGCCTGCAGAGG + Intronic
1040038992 8:42897291-42897313 GTCACATCCGGGGCCTGGGGCGG + Intronic
1041601000 8:59717304-59717326 CCCCCATGCAGGGGCTGCAGTGG - Intergenic
1041936203 8:63334749-63334771 CCTCCATCTGGGGCCTGCAGGGG + Intergenic
1043542533 8:81280261-81280283 CTGGCTTCCTGGGCCTGCAGAGG + Intergenic
1045094544 8:98784343-98784365 CTCTCATCCTTGACCTGCAGTGG - Intronic
1045252282 8:100492039-100492061 CTCCCATCCATGGGCAGCAGAGG + Intergenic
1045878873 8:107014789-107014811 CTTGCATCCTGGGGCTGCAGGGG - Intergenic
1046383246 8:113476822-113476844 ATCACATCCGGGGCCTGTAGTGG - Intergenic
1048697250 8:137041526-137041548 CCCACATCCGTGGCATGCAGGGG - Intergenic
1049579889 8:143406473-143406495 CTTCCACCCGGGTCCTGCGGGGG - Intergenic
1049934169 9:484754-484776 CCCACATCTGTGGCCTGCAGTGG + Intronic
1049994455 9:1021372-1021394 CTCCCATCCCTTGCCTGCACTGG - Intergenic
1053021978 9:34701431-34701453 CTCCCTTCCTGGGCCTGCAGGGG + Intergenic
1053715508 9:40884391-40884413 ATCCCATCCCTGGGCTGCAGAGG - Intergenic
1054077036 9:60546346-60546368 ATCCCATCCCTGGGCTGCAGAGG + Intergenic
1054452180 9:65409180-65409202 CACCCAGCCGGGGCCTGGTGTGG - Intergenic
1056064119 9:82915881-82915903 CTCCCATCCAGGGCATGCTGAGG + Intergenic
1057521967 9:95767218-95767240 CTCCGAGCCTGGGCCTACAGTGG - Intergenic
1057600084 9:96450247-96450269 CTGCCCTCCCGGGCCCGCAGTGG + Exonic
1058961311 9:109995161-109995183 CTCCCACCCAGGGACTGGAGAGG + Intronic
1062009663 9:134260217-134260239 TGCCCATCCGGGGCCTGCCCAGG + Intergenic
1062268727 9:135699301-135699323 CACCCATCCTGGGCCTCCTGGGG - Intronic
1062430803 9:136526122-136526144 CTCCCAACAGGTGCCCGCAGAGG - Intronic
1062574351 9:137199586-137199608 ATCCCAGCCGGTGCCTGGAGGGG - Exonic
1203468985 Un_GL000220v1:108178-108200 CTCGCTTCCCGGGCCTGCCGCGG + Intergenic
1203476806 Un_GL000220v1:152150-152172 CTCGCTTCCCGGGCCTGCCGCGG + Intergenic
1185736448 X:2500352-2500374 CTCCCCTCCGGGGCCTGGCGGGG + Intronic
1186480995 X:9895891-9895913 CTCCCAACCCGGCCCTCCAGCGG - Exonic
1190421584 X:50290146-50290168 CTCCCATCAGGGACTTGGAGGGG - Intronic
1191851272 X:65588037-65588059 CTCCTATCAGAAGCCTGCAGAGG - Intergenic
1192584573 X:72308998-72309020 CCCGGATCCGGAGCCTGCAGCGG - Intergenic
1196566099 X:117206822-117206844 CTCCCATCACAGGCCTGGAGGGG - Intergenic
1200212825 X:154354470-154354492 GGCCTCTCCGGGGCCTGCAGTGG + Exonic