ID: 949008591

View in Genome Browser
Species Human (GRCh38)
Location 2:241665632-241665654
Sequence CTCCCATCCGGGGCCTGCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 216}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949008582_949008591 19 Left 949008582 2:241665590-241665612 CCTGTGGCTGAGAGTAGCCTCTG 0: 2
1: 0
2: 0
3: 20
4: 205
Right 949008591 2:241665632-241665654 CTCCCATCCGGGGCCTGCAGTGG 0: 1
1: 0
2: 2
3: 19
4: 216
949008586_949008591 2 Left 949008586 2:241665607-241665629 CCTCTGGGTGGCAGTGTCCTCTG 0: 1
1: 0
2: 0
3: 27
4: 309
Right 949008591 2:241665632-241665654 CTCCCATCCGGGGCCTGCAGTGG 0: 1
1: 0
2: 2
3: 19
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949008591 Original CRISPR CTCCCATCCGGGGCCTGCAG TGG Intronic