ID: 949008594

View in Genome Browser
Species Human (GRCh38)
Location 2:241665635-241665657
Sequence GTCCCACTGCAGGCCCCGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 181}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949008594_949008597 -5 Left 949008594 2:241665635-241665657 CCATCCGGGGCCTGCAGTGGGAC 0: 1
1: 0
2: 0
3: 15
4: 181
Right 949008597 2:241665653-241665675 GGGACACTATGTCAGATCCCCGG 0: 1
1: 0
2: 0
3: 5
4: 86
949008594_949008598 1 Left 949008594 2:241665635-241665657 CCATCCGGGGCCTGCAGTGGGAC 0: 1
1: 0
2: 0
3: 15
4: 181
Right 949008598 2:241665659-241665681 CTATGTCAGATCCCCGGAGATGG 0: 1
1: 0
2: 0
3: 6
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949008594 Original CRISPR GTCCCACTGCAGGCCCCGGA TGG (reversed) Intronic
900262497 1:1739098-1739120 AGCCCACTGCAGGCACGGGAGGG - Intronic
900764422 1:4494509-4494531 GGCCCCCTGCAGCCCCTGGATGG + Intergenic
902514110 1:16980653-16980675 GTCCCCCTCCGGGCCCCCGACGG + Exonic
902904204 1:19542601-19542623 GTCCCAGGTCAGGCCCCTGATGG - Intergenic
903032495 1:20473786-20473808 GTCCCACTGAAGTCCATGGAGGG + Intergenic
903184719 1:21622561-21622583 GCCCCACGGCGGGGCCCGGAGGG + Intronic
903329874 1:22591868-22591890 AGACCACTGCAGGGCCCGGAAGG - Intronic
903331378 1:22598826-22598848 GTCCCCCTGCAGACCCACGACGG + Exonic
906639420 1:47432836-47432858 GCCCCAATTCAGGGCCCGGAAGG + Intergenic
910459374 1:87432468-87432490 CTCTCACTGCAGTCCCCTGATGG - Intergenic
911076017 1:93875991-93876013 GTCTCACTGTTGGCCCAGGATGG + Intronic
911408101 1:97466923-97466945 CCCCCACTGCAGGCCCCTAAAGG - Intronic
912235993 1:107851098-107851120 GGCTCACTGCAAGCTCCGGAGGG - Intronic
914316611 1:146518811-146518833 GTCTCACTTCAGTCCCCTGATGG - Intergenic
914497745 1:148214550-148214572 GTCTCACTTCAGTCCCCTGATGG + Intergenic
915066879 1:153232085-153232107 TTCCCTCTGCAGGCTCCAGAGGG - Intergenic
915109334 1:153553142-153553164 GTCCCTCTCCAGGCCTTGGAGGG - Intergenic
915141141 1:153769354-153769376 ATCCCAGTGCAGGCCTCAGAAGG - Intronic
921043012 1:211452442-211452464 CTCCCACTTCAGGCCCCTCAAGG + Intergenic
923022322 1:230174662-230174684 GACCCAGTCCAGGTCCCGGAGGG - Intronic
1065017945 10:21478781-21478803 GTCCCACTGCAGGGCCTGAACGG + Intergenic
1067557493 10:47282955-47282977 GTCCCTGTGCAGGCCACGGTGGG + Intergenic
1069835491 10:71305425-71305447 GCCCCAGTGCAGGCCACTGAAGG + Intergenic
1072751518 10:97983827-97983849 ATGACACTGCAGGCCCCAGATGG - Intronic
1073042243 10:100615610-100615632 CTCCCGCTGCAGGCCCCGCTGGG + Intergenic
1076731808 10:132442916-132442938 ATGACACTGCAGGCCCCGGCAGG + Intergenic
1080569321 11:33542103-33542125 GTCCCCCTTTAGGCCCCGGTTGG - Intronic
1083492655 11:63024209-63024231 GGCGCACTGCAGGCACCGGGCGG - Intergenic
1083811154 11:65107738-65107760 GGCCCACTGCAGGCCCTGCCCGG - Intronic
1088728147 11:112657466-112657488 AACCCTCTGCAGGCCCTGGAGGG + Intergenic
1089627861 11:119762840-119762862 GTCTCCCTGCAGGCCTAGGAGGG - Intergenic
1089659931 11:119979079-119979101 GCACCACTGCTGGCTCCGGAGGG + Intergenic
1090386218 11:126358856-126358878 GTGCCACTGCTGGCCCAGCAGGG + Intronic
1091612418 12:2022495-2022517 GTGCCACTGCACTCCCCCGAGGG - Intronic
1095985679 12:47997909-47997931 GTTCCCCTGCAGGTCCCTGAAGG + Exonic
1096334730 12:50744844-50744866 GGCCCACTGCAGTCCCCACAAGG - Exonic
1096862816 12:54542164-54542186 ACACCACTGCAGGCCACGGAAGG - Intronic
1101173064 12:102119941-102119963 TTCCCACTTCGGGCCCCGGGAGG - Intronic
1103400709 12:120641105-120641127 GGCGCACTGCAGGCCCCGGGAGG + Exonic
1104845566 12:131845106-131845128 CTCTCCCTGCAGGCCCAGGAAGG + Exonic
1106208647 13:27621469-27621491 GTCCCACAAAAGGCCCGGGAGGG + Exonic
1106634539 13:31513451-31513473 GTCCCACTGCTTGCCCAGAATGG - Intergenic
1108704840 13:52975548-52975570 GTCCCACCGCAGGCCCCATGGGG - Intergenic
1118381984 14:65224961-65224983 TTCCCACGGGAGGCCCCAGAGGG - Intergenic
1118695445 14:68380420-68380442 GTGCCCCAGCAGGCCCCAGATGG + Intronic
1119024749 14:71143646-71143668 ATACCACAGCAAGCCCCGGATGG - Intergenic
1122121209 14:99554424-99554446 GTCCCTCTGCAGGCTCCTGCAGG + Intronic
1122263534 14:100536345-100536367 GGCCCGCTGCAGGCCTGGGATGG + Intergenic
1122857655 14:104567528-104567550 TTCCCACCTCAGGCCCCGGAGGG - Intronic
1123017110 14:105380751-105380773 GTCACCCTGCATGGCCCGGATGG + Intronic
1123450551 15:20357061-20357083 GTCCCACGGGAGGCCCGTGATGG + Intergenic
1124646827 15:31442818-31442840 GTCCCCCTGCAGGCACAGGGTGG - Intergenic
1125679278 15:41520778-41520800 CACCCACTGCAGGACCCGCATGG + Exonic
1125727258 15:41874430-41874452 CTGCAGCTGCAGGCCCCGGATGG + Exonic
1127259259 15:57316544-57316566 GTGCCACTTCAGGCCCAGGAAGG - Intergenic
1128673237 15:69590260-69590282 ACCCCACTGCAGGCCACTGAGGG + Intergenic
1128708082 15:69851832-69851854 GGCCCAGTGCAGACCCCAGAGGG + Intergenic
1129411914 15:75354962-75354984 AGGCCACTGCAGACCCCGGAAGG + Exonic
1130112458 15:80977071-80977093 GGCCCAGTGCAGGCCCAGGTTGG - Exonic
1130195109 15:81772177-81772199 GTGCTACTGCAGGCCCCAGCTGG + Intergenic
1130276174 15:82477409-82477431 GGCCCCCTGCAGGGCCCGGTGGG + Intergenic
1130468533 15:84204802-84204824 GGCCCCCTGCAGGGCCCGGTGGG + Intergenic
1130495731 15:84468740-84468762 GGCCCCCTGCAGGGCCCGGTGGG - Intergenic
1130590826 15:85209401-85209423 GGCCCCCTGCAGGGCCCGGTGGG + Intergenic
1131021338 15:89101824-89101846 GCCCCACTGCAAGCCCTTGATGG - Intronic
1131188538 15:90294812-90294834 GGCCCCCTGCAGGGCCCGGTGGG - Intronic
1131265086 15:90910968-90910990 GTCCCCATGCAGACCCAGGAGGG - Intronic
1131599556 15:93832357-93832379 GTCCCACTGCTGCCCACAGAAGG + Intergenic
1132802930 16:1763075-1763097 GTCCCGCTTCAGGGCCTGGAGGG - Intronic
1132858223 16:2057025-2057047 GTCCCGCTGCTGGCCCCGCCTGG - Intronic
1132958198 16:2607683-2607705 GTCACAAGGCAGGCCCGGGATGG - Intergenic
1133507215 16:6423775-6423797 GCAGCACTGCAGGCCCAGGAAGG + Intronic
1136011156 16:27364071-27364093 GCCCCACGGCAGGCCCCTGCAGG + Exonic
1137616929 16:49854336-49854358 GTCCTCCTGAAGTCCCCGGAGGG - Intronic
1137683149 16:50368607-50368629 TTCCCACGGCAGGCCCAGGCCGG - Intronic
1138095350 16:54207020-54207042 GACCCTCTGCAGGCCCCAGGAGG - Intergenic
1138998004 16:62476821-62476843 GTCAGACTGCAGGCCCTGGTGGG + Intergenic
1139422224 16:66855851-66855873 GCCCCACTGCAGGGCCAGGAGGG + Intronic
1141638577 16:85328657-85328679 GCCCCACTGCAGACCCTGCAGGG - Intergenic
1141705328 16:85661556-85661578 GGCCCGCTGCTGGCCCAGGATGG - Exonic
1142406703 16:89894212-89894234 GCCCCCGTGCAGCCCCCGGACGG + Intronic
1144951840 17:18998592-18998614 GTCCCACTGGAGTGCCCAGACGG + Intronic
1146133475 17:30297849-30297871 GTCCAACTGCAAGCCCCACATGG + Intergenic
1147208809 17:38858719-38858741 GTCTCACTGCATGCCCAGGCTGG - Intergenic
1147376825 17:40027431-40027453 GTCAAACAGCAGGGCCCGGACGG + Exonic
1147945957 17:44080341-44080363 CTCCCACTGCAGGGCCCAGAGGG + Intronic
1148486067 17:47991621-47991643 GCCCAGCTGCAGGCCCCCGAGGG - Intergenic
1148493268 17:48037114-48037136 GTTCCACTGCAGGCCCCGAGTGG + Intronic
1148566333 17:48635132-48635154 GTCCAGCTGCAGGCCCAAGAGGG + Intergenic
1149644175 17:58227776-58227798 GTGCCTCTGCAGGCCCTGCATGG - Intronic
1151293147 17:73164899-73164921 GTCCTTCTGCAGGACCCGGGAGG + Intergenic
1151368864 17:73634710-73634732 GTCAAACTGCAGGCCCCAAACGG + Intronic
1151568919 17:74916358-74916380 GTCCTACTGCAGGACACTGAGGG - Exonic
1151619928 17:75239429-75239451 GTCCCAGGGCAGCCCCCCGAAGG - Exonic
1151876469 17:76870165-76870187 GTCCCCCTGCCGGCTCCAGACGG + Intronic
1152525787 17:80887589-80887611 GCCCCACAGCAGGCTCAGGACGG - Intronic
1152699844 17:81813399-81813421 GGCCCACAGCAGGTCCCGGTGGG + Intronic
1152984808 18:311834-311856 GTGCCACTGCATGCCCAGGCTGG - Intergenic
1157409013 18:47448171-47448193 GTACAACTGCAGGACCAGGAAGG + Intergenic
1162060484 19:8091688-8091710 GCCCCACTGCAGCCCCTGGCTGG - Intronic
1163639302 19:18452282-18452304 GTCTCTCTGCAGGGCCTGGAGGG - Intronic
1164524495 19:29003448-29003470 ACCCCACTGCAGACCCCGGTGGG - Intergenic
1164565569 19:29323689-29323711 TTCCCACCGGAGGCCCAGGAGGG - Intergenic
1165060514 19:33202841-33202863 TTCCCACTGCAGGCCGCTGTCGG - Exonic
1165923844 19:39314974-39314996 GTCCAGGTGCAGGGCCCGGAGGG + Exonic
1167512398 19:49902429-49902451 GGCTCACTGCAAGCTCCGGATGG + Intronic
1168379423 19:55907460-55907482 CTCCCACTGCAGCCCCCGAGTGG - Intronic
926217515 2:10914460-10914482 CTCCCCCTGCAGGCCCAGGATGG + Intergenic
926640671 2:15232458-15232480 GACCCACTGAAGGTCCTGGAAGG - Exonic
930838849 2:55824679-55824701 GTCAGTCTGCAGGCCCCGGTTGG - Intergenic
932321902 2:70828599-70828621 GTCGCAATGGAGGTCCCGGAGGG - Intergenic
934787188 2:97020222-97020244 GTCCCACTGCAGCCTCCCAATGG - Intergenic
938378611 2:130824274-130824296 TTCCCACTGTAGGCCAGGGACGG - Intergenic
938571611 2:132566877-132566899 GTCCCACAGCAGGACGCTGAAGG - Intronic
942759630 2:179383089-179383111 ATCCCACAGCAGGTCCCAGAAGG + Intergenic
943624105 2:190180346-190180368 GTCCCAAGGCAGGCCCCGCGGGG + Intronic
945080968 2:206085762-206085784 GGCCCACGCCAGGCCCCGGGCGG - Intronic
948862971 2:240761839-240761861 TCCCCACTGCTGGCCCCAGATGG - Intronic
949008594 2:241665635-241665657 GTCCCACTGCAGGCCCCGGATGG - Intronic
1171784336 20:29448840-29448862 GTCCCACCGCAGACTCCGGTGGG + Intergenic
1175800739 20:61799873-61799895 GCCCCACTCGAGGCCCCGCAGGG - Intronic
1176008416 20:62879446-62879468 GTCCCACTCCTTGCCCCGGTCGG + Exonic
1178662382 21:34518692-34518714 GTCGCAGTGCACGCCCAGGAAGG + Intronic
1179193759 21:39145406-39145428 ATCCCACTGCAGGCTCCAGGAGG + Intergenic
1179823456 21:43950846-43950868 GACCCAATGCAGGGCCCGAAAGG + Intronic
1179896021 21:44364179-44364201 GTCCCACTGTGTGCCCTGGAAGG - Exonic
1181463752 22:23099860-23099882 GCCCCACTGGAGGCACCTGAGGG + Intronic
1181951307 22:26555801-26555823 CTCCCACTGCAGGCCTCCCACGG + Intronic
1183078903 22:35443833-35443855 AGCCCAGTGCAGGCCTCGGAGGG + Intergenic
1184679463 22:46062206-46062228 GTCCCTGTGCAGGCCCCGTAAGG + Intronic
1185344622 22:50305877-50305899 GGCCCACTGCAGGCTCAGCAGGG + Intronic
949890880 3:8733098-8733120 ATCCCAGTGCAGGCTCCAGACGG + Intronic
950979690 3:17289132-17289154 GTCCAGCTGCAAGCCCCGCATGG + Intronic
951887510 3:27538738-27538760 GCACCACGGCAGGCCCAGGATGG - Intergenic
953766361 3:45746652-45746674 TTCCCACTCCAGGCCCCCAAAGG - Intergenic
957062215 3:75491159-75491181 GTCCCAGTGGAAGCCCTGGAAGG + Intergenic
961561662 3:127734402-127734424 GGCGCACTGCAGACCCCTGATGG - Intronic
965596904 3:170419252-170419274 GTACCACTGCAAGCCCCTGGTGG + Exonic
966491334 3:180531512-180531534 GTGCCACTGCAGCCACCGAAAGG + Intergenic
966860897 3:184230413-184230435 GTCTCACTCCAGCACCCGGACGG - Exonic
967993124 3:195146468-195146490 GTCCCACTGCAAGCTCCTGGAGG + Intronic
968187910 3:196646007-196646029 GTCCTCCTGCAGGCCTTGGAAGG + Intronic
968645676 4:1739558-1739580 GTCCCACTGGAAGCCCCACATGG + Intronic
969582030 4:8071265-8071287 GTCCCACTCCTGGGCCGGGATGG - Intronic
970441456 4:16083802-16083824 CTCCCACTGCCGGCCGCGGAGGG + Intronic
970468605 4:16352733-16352755 GACCCAGTGCAGGACCCAGAAGG - Intergenic
974848274 4:67377908-67377930 GCCCCACTGCAAGCCCAGGGAGG + Intergenic
977101578 4:92822747-92822769 ATCCCACAGCATGCCCTGGAGGG - Intronic
983938883 4:173521965-173521987 GTGCCGGTGCAAGCCCCGGATGG - Intergenic
984544066 4:181077904-181077926 GGCTCACTCCAGGCCCCAGATGG - Intergenic
985492778 5:189092-189114 GGGCGACTGCAGGCCCCGAACGG - Exonic
985789647 5:1918683-1918705 GTCCCACTGCACGCCTCTGGGGG + Intergenic
986199613 5:5569439-5569461 GGGCCACAGCAGGCCCTGGAGGG - Intergenic
987486494 5:18533315-18533337 GTCTGGCCGCAGGCCCCGGATGG + Intergenic
998004462 5:138647959-138647981 GACTCCCTGCAGGCCCCAGAGGG + Intronic
1002890520 6:1327655-1327677 GTCCCCCTGCAAGCCACGGCAGG - Intergenic
1004274209 6:14221385-14221407 GCCCCTCTGCAGGCCCCAGAAGG + Intergenic
1004995030 6:21182797-21182819 GTCCCACTGTAAGCCCTTGATGG + Intronic
1006151704 6:31993408-31993430 GACCCACTGCAGGGCCAGGTGGG - Exonic
1006158005 6:32026146-32026168 GACCCACTGCAGGGCCAGGTGGG - Exonic
1012909914 6:105106655-105106677 GACCCACTGCATGTCCCTGAGGG + Intronic
1014452376 6:121596281-121596303 CTCCCAGTGCAGGGCCCGGTTGG - Intergenic
1016006999 6:139099339-139099361 GTCTGACTGCAGGCCCCACATGG + Intergenic
1018192853 6:161325776-161325798 CTCTCACTGCTGGCCCAGGAAGG + Intergenic
1019107651 6:169682078-169682100 GTCCCACAGCAGATCCCAGACGG + Intronic
1019437106 7:1028039-1028061 GTCCCCGAGCAGGCCCTGGACGG - Intronic
1022911311 7:34901768-34901790 GCCCCAGTGCAGGCCCCAGCAGG + Intergenic
1025514441 7:61614978-61615000 GTCCCACAGCAGGCCTCAAAAGG - Intergenic
1025538790 7:62043818-62043840 GTCCCACAGCAGGCCTCAAAAGG - Intergenic
1028808885 7:95061199-95061221 GTCCCAGTACAAGCCCAGGAAGG - Intronic
1031976514 7:128097131-128097153 CTCACCCTGCAGGCCCCCGAGGG - Intergenic
1034172173 7:149071143-149071165 GTCGCACTTCAGGCACTGGAAGG + Exonic
1034988715 7:155534029-155534051 GTCCCCCTGCTGGCCCCGCCGGG + Intergenic
1035011360 7:155718407-155718429 GTCCCACGGCAGGTCTCGGCTGG - Exonic
1035936377 8:3845944-3845966 GTCCCACTGCAGGCTCCTCAGGG + Intronic
1037666336 8:20973228-20973250 GTCCAACTGCCGGCCCAGGCCGG - Intergenic
1037770526 8:21796497-21796519 GTCCGACTGCAGGACCCAGAGGG + Intronic
1038362589 8:26897335-26897357 GTCTCACTGGAGGCCCAGGCTGG + Intergenic
1038760909 8:30384159-30384181 GTCCCGGTCCAGGCCCCGGCGGG + Intergenic
1040379563 8:46859150-46859172 GTCACAATGCAGTCACCGGAAGG - Intergenic
1041526073 8:58807768-58807790 GTCCCTCTGCATGCCCCTGTAGG + Exonic
1041600996 8:59717301-59717323 CTCCCACTGCAGCCCCTGCATGG + Intergenic
1041936206 8:63334752-63334774 CCCCCCCTGCAGGCCCCAGATGG - Intergenic
1043887400 8:85617755-85617777 GTCTCACTTGTGGCCCCGGATGG + Intergenic
1048381520 8:133869988-133870010 GTCCCACTGCATATCCTGGAAGG - Intergenic
1049584842 8:143428224-143428246 ATCCCACTGATGGCCCCTGAGGG + Exonic
1049585750 8:143431578-143431600 GTCCCACTCCAGGCCCAGCAAGG - Intergenic
1049588946 8:143446822-143446844 GCCCCAGTCCAGGCCCCAGAGGG - Intronic
1049683920 8:143931720-143931742 GTCCCAGGGCAGGCCCAAGACGG + Intronic
1053021981 9:34701434-34701456 CGCCCCCTGCAGGCCCAGGAAGG - Intergenic
1058649965 9:107166573-107166595 CTCCCACTGCAGGTCCCCGCTGG + Intergenic
1060986923 9:127825347-127825369 GTCTCCCCGCAGGCCCCGGACGG - Exonic
1061062559 9:128257995-128258017 GGCCCCCTGCAGGGCCCGGTGGG + Exonic
1061885749 9:133590316-133590338 GTCCCAGTTCAGGGCCTGGAAGG + Intergenic
1186300838 X:8198173-8198195 GTCACACTGGTGGCCACGGAGGG + Intergenic
1191223407 X:58015475-58015497 GTCAGACTGAAGGCTCCGGAGGG - Intergenic
1198846365 X:140916703-140916725 GTCCCAGTGCTGGCCCCATATGG + Intergenic