ID: 949011156

View in Genome Browser
Species Human (GRCh38)
Location 2:241679329-241679351
Sequence AGAGCCGCAGGCTCTGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 1, 2: 2, 3: 21, 4: 229}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949011156_949011162 11 Left 949011156 2:241679329-241679351 CCTCCCACAGAGCCTGCGGCTCT 0: 1
1: 1
2: 2
3: 21
4: 229
Right 949011162 2:241679363-241679385 CGCACAGCAGGAAGAAGCAAAGG 0: 1
1: 0
2: 4
3: 26
4: 287
949011156_949011160 -1 Left 949011156 2:241679329-241679351 CCTCCCACAGAGCCTGCGGCTCT 0: 1
1: 1
2: 2
3: 21
4: 229
Right 949011160 2:241679351-241679373 TGTCAGCTGATCCGCACAGCAGG 0: 1
1: 0
2: 0
3: 8
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949011156 Original CRISPR AGAGCCGCAGGCTCTGTGGG AGG (reversed) Intronic
900761791 1:4477422-4477444 AAAGCCCTGGGCTCTGTGGGAGG - Intergenic
901663777 1:10815085-10815107 AGCGCTGAAGGATCTGTGGGTGG + Intergenic
902149684 1:14433256-14433278 AGAGCAGTTGTCTCTGTGGGGGG - Intergenic
902378980 1:16043824-16043846 GGAGCTGGAGGCTCTGTGAGAGG + Exonic
903280894 1:22249243-22249265 AGGGACGCAGGCTCTGTGGGAGG + Intergenic
904265803 1:29317999-29318021 AAAGCTGAAGGCTCTGTTGGGGG + Intronic
904810644 1:33161445-33161467 AGTGCCCAGGGCTCTGTGGGAGG + Intronic
906567933 1:46813803-46813825 AGAGCAGGATGCTCTGTGGTTGG + Intronic
907309383 1:53530567-53530589 AGAGCCACAGGATCTGTGAAGGG - Intronic
908430203 1:64049492-64049514 CAAGCAGCAGGCTCTATGGGTGG + Intronic
910000012 1:82330620-82330642 ACAGGAGCAGGCTCTGTGTGTGG + Intergenic
913533848 1:119752746-119752768 AGAGAGCCAGGTTCTGTGGGAGG + Intronic
914789833 1:150867932-150867954 AGTTCCGCAGGCTGTATGGGAGG - Intronic
915988592 1:160490799-160490821 ATAGCCGGAGGCTCTGGGGTGGG + Intronic
921214986 1:212928967-212928989 GCAGCCGCAGGCTCTGTGCCTGG - Intergenic
922196126 1:223362566-223362588 ATAGCCTCAGCCTCCGTGGGCGG - Intronic
922620700 1:226986368-226986390 AGCGCCCCGGGCACTGTGGGAGG + Intronic
923730808 1:236547754-236547776 AGGGCCGCAGGCCCTGGGGATGG + Intronic
1064348029 10:14550334-14550356 AGAGCTGCAGACTCAGTGGTAGG - Intronic
1069603964 10:69728388-69728410 AGTGCCCCAGGCTCTGTGCTGGG - Intergenic
1069723900 10:70565608-70565630 AGAGTGGCAGGCTTTGAGGGTGG + Intronic
1069825405 10:71252277-71252299 AGAGCACCAGGCTGTGAGGGTGG + Intronic
1070496778 10:77031675-77031697 AGAGATGCAGCCTCTGTTGGAGG + Intronic
1071470925 10:85983678-85983700 TGAGCCTCAGGCCCTGTGGATGG + Intronic
1071564177 10:86663082-86663104 AGAGCTGCAGGCCCTGAGGAGGG - Intronic
1072810494 10:98457745-98457767 AGAGCTGAAGCCTCAGTGGGAGG + Intronic
1075478468 10:122757187-122757209 ACAGCTTCAGGCTCTGTGGTTGG - Intergenic
1075900357 10:126038097-126038119 AGGTCAGCAGGCTCTGAGGGAGG - Intronic
1076819256 10:132930604-132930626 GGAGGCCCAGGCTCTGTGTGGGG - Intronic
1076819384 10:132931044-132931066 GGAGGCCCAGGCTCTGTGTGGGG - Intronic
1076819569 10:132931687-132931709 GGAGGCCCAGGCTCTGTGTGGGG - Intronic
1076819610 10:132931829-132931851 GGAGGCCCAGGCTCTGTGTGGGG - Intronic
1076819724 10:132932258-132932280 GGAGGCCCAGGCTCTGTGTGGGG - Intronic
1076887637 10:133269848-133269870 AGAGCGGCAGCCTCTGTGCAGGG + Intronic
1076900007 10:133333739-133333761 AGAGTGGAAGGCTCTGAGGGGGG + Intronic
1077321145 11:1942614-1942636 AGGGCCGCAGGCTGTTTGGGGGG + Intergenic
1077435352 11:2536303-2536325 AGAGCCGCAGGCAGTGCGGATGG - Intronic
1077552250 11:3205876-3205898 AGAGCCACAGGGTTTGTGAGTGG + Intergenic
1079130356 11:17743697-17743719 GGAGCCGCAGGAGCTGTGGCTGG - Intronic
1083276515 11:61599978-61600000 AGACCCCCAGGCCCTGTGGGTGG - Intergenic
1083630695 11:64093713-64093735 AGAGCGGGAGGCCCAGTGGGTGG - Intronic
1083815595 11:65130713-65130735 TGATCCGCAGGCTCCGGGGGTGG + Exonic
1083851345 11:65369254-65369276 AGAGCTGAAGGCTGGGTGGGAGG + Intergenic
1084471294 11:69360710-69360732 ACAGCCCCAGGCACTATGGGAGG - Intronic
1084948199 11:72650418-72650440 GGAGCCAAGGGCTCTGTGGGTGG - Intronic
1087019268 11:93585951-93585973 AGAGCAGCAAGCTCTGTGTTAGG - Intergenic
1089156844 11:116409256-116409278 AGAGACGCAGGGGCTGTGGGTGG + Intergenic
1090072928 11:123560071-123560093 AGAGCCGCTGGGGCTGCGGGGGG - Intronic
1091347041 11:134862296-134862318 AGAAGCGCAGGCTTTGTGGCGGG + Intergenic
1092211204 12:6647431-6647453 AGAGCCGCAGGCGCGGGGCGGGG + Exonic
1092272739 12:7036687-7036709 AGAGCCCCTTGCTCTGTGGCTGG + Intronic
1092284503 12:7121080-7121102 GGAGCAGCAGGCTCTAGGGGAGG + Intergenic
1093502342 12:19827425-19827447 ATAGGCGCTGGCTCTGTGTGAGG + Intergenic
1094602231 12:31919549-31919571 AGAGCCCCAAGAGCTGTGGGTGG - Intergenic
1095958303 12:47819055-47819077 GGCGCCGCAGGCTGTGTGAGGGG - Intronic
1096062813 12:48716435-48716457 CGGGTCTCAGGCTCTGTGGGGGG - Intronic
1097237584 12:57550456-57550478 AGAGACTAAGGCTCTGCGGGGGG - Intronic
1098153606 12:67573900-67573922 ATGGCCGCAGGCTCAGTGGCTGG - Intergenic
1102261824 12:111447646-111447668 ACAGGCGCAGGTGCTGTGGGAGG - Exonic
1104018988 12:124979245-124979267 ACAGTCCCAGGCTCTTTGGGAGG + Intronic
1105881133 13:24607347-24607369 AGAGCCCCAGGGTGTGTGTGTGG + Intergenic
1107026060 13:35802884-35802906 CCAGCTGCAGGCTCTCTGGGTGG - Intronic
1109737791 13:66509348-66509370 AGGGTCCCAGTCTCTGTGGGAGG + Intronic
1113521608 13:110946010-110946032 AGAGGATCAGGCTCTGTTGGGGG - Intergenic
1113842092 13:113366072-113366094 AGAGCCCCAGGCTCTGTGCAGGG + Intergenic
1113880467 13:113622700-113622722 AGAGCCGCAGCCTCTGTGGAAGG + Intronic
1114215306 14:20653658-20653680 CGAGCCGCAGGGTCTGGTGGTGG + Intergenic
1116793686 14:49366614-49366636 ATAGTCCCAGGCTCTGTGGGAGG + Intergenic
1117800601 14:59440488-59440510 ACAACCCCAGGTTCTGTGGGAGG - Intronic
1118920285 14:70143796-70143818 AGAGCTGCTGGTTCTCTGGGGGG - Intronic
1119731710 14:76955485-76955507 AGAGCCGCAGGGGCTTTGGGAGG - Intergenic
1119846261 14:77832524-77832546 AGAGCCTCAGGCTCAGAGGAGGG - Intronic
1121407211 14:93726299-93726321 AGAGCAGCAGGCTGAGCGGGAGG - Intronic
1122873190 14:104650755-104650777 AGAGCCGCTGGGTCTGGGGATGG + Intergenic
1122982060 14:105196448-105196470 AGCGCCGCAGGATCTGGAGGCGG + Intergenic
1123495245 15:20817126-20817148 GGAGCCGCAGGCTGTGGCGGAGG + Intergenic
1123551734 15:21386219-21386241 GGAGCCGCAGGCTGTGGCGGAGG + Intergenic
1123632742 15:22273300-22273322 AGAGCCCCAGACTCTGCGGCTGG + Intergenic
1124618076 15:31256892-31256914 AGAGAAGCAGGGGCTGTGGGAGG - Intergenic
1128567111 15:68708187-68708209 ACAGGAGCTGGCTCTGTGGGGGG + Intronic
1128815790 15:70607138-70607160 AGAGTCTCTGGCTCTGTGAGTGG + Intergenic
1129115462 15:73363105-73363127 GGAGCCGCAGGCTGTGTTGGAGG - Intronic
1129606474 15:77027696-77027718 GAAGCAGCAGGCTCTGGGGGAGG + Intronic
1130295783 15:82646684-82646706 AGACCAGAAGGCTCTGTGAGCGG - Intronic
1131024500 15:89128772-89128794 AGAGCCCTATGGTCTGTGGGGGG + Intronic
1132060160 15:98685807-98685829 GGAGCCGCAGCCTCCTTGGGTGG + Intronic
1132196457 15:99917773-99917795 AGGGACGCTGGCTCTGTTGGAGG - Intergenic
1202960079 15_KI270727v1_random:113461-113483 GGAGCCGCAGGCTGTGGCGGAGG + Intergenic
1132563770 16:611164-611186 AGAGGCCCCGGCTCTGTGGGTGG + Intronic
1132601620 16:775425-775447 AGAGCAGCAGGTTGGGTGGGTGG + Exonic
1133258889 16:4535856-4535878 CAAGCCACAGTCTCTGTGGGAGG - Intronic
1133317689 16:4894482-4894504 AGGGCCTCAGGGTCTGTGGGGGG + Exonic
1137676402 16:50305767-50305789 GGAGCAGCAGGGCCTGTGGGCGG - Exonic
1141916489 16:87100804-87100826 AGAGCCACAGGCCTTGGGGGTGG + Intronic
1141934371 16:87227600-87227622 AGAGCAGGAGGCCCTGGGGGTGG - Intronic
1141970322 16:87477466-87477488 AGAGCCCCAGACTCTGCGGCTGG - Intronic
1142272563 16:89097982-89098004 AGAGCCCCAGGCTACCTGGGAGG + Intronic
1143379349 17:6486326-6486348 GGAGCAGCAGGCTCTGGTGGGGG - Intronic
1146943208 17:36858162-36858184 ACAGCCCCAGGCTCTGTCTGGGG - Intergenic
1147419916 17:40317358-40317380 AGAGCTGCAGGCTGGGAGGGGGG + Intronic
1148133215 17:45274677-45274699 ACAGCAGCAGCCTCTGTGTGTGG - Intronic
1150444852 17:65221019-65221041 AGAGCCCCAGGCTCCATGGGAGG + Intronic
1150637614 17:66926317-66926339 AAAGACCCAGGCTCTGTAGGAGG - Intergenic
1152070485 17:78131636-78131658 GGAGCCGGAGGAGCTGTGGGAGG + Exonic
1152535223 17:80946926-80946948 GGAGCCACAGGCTGTGCGGGTGG - Intronic
1153745392 18:8173697-8173719 AGGGCCACAGGATCTGTTGGTGG + Intronic
1153982071 18:10318792-10318814 AATGCTCCAGGCTCTGTGGGAGG - Intergenic
1154095673 18:11413155-11413177 AGGGCCTCGGGCTCTGGGGGGGG - Intergenic
1157299683 18:46470574-46470596 AGAGCCACAGGCTATGTTGATGG - Intergenic
1157312309 18:46561398-46561420 TGAGCCCCAGGCTCTGAGGAAGG + Intronic
1158558521 18:58494649-58494671 AGAGTCGCAAGTTCTATGGGGGG - Intronic
1160956015 19:1692025-1692047 GGAGCCGGAGCCTCTGTGTGTGG + Intergenic
1161221794 19:3121226-3121248 GCAGCCGCAGGCTCCGTGGAAGG - Exonic
1161849413 19:6730944-6730966 AGGGCCGGCGGCTCTGGGGGTGG - Intronic
1163126434 19:15246702-15246724 AGCGCAGCAGGGCCTGTGGGGGG + Intronic
1163127739 19:15253407-15253429 TGAGCAGCAGCCTCAGTGGGAGG - Intronic
1163405010 19:17116640-17116662 AGAGCAGCAGGCGCTGTGAGGGG + Intronic
1163684168 19:18701206-18701228 TGAGCCCCGGGCTCTGGGGGCGG - Intronic
1164510094 19:28889612-28889634 AGAGCTGCTTGCCCTGTGGGTGG - Intergenic
1165203426 19:34163801-34163823 AGAGCCCCATCCTCTGTGGCAGG - Intergenic
1167041647 19:47026374-47026396 AGAGCCTCATGCACTGTGGTAGG + Intronic
1167482485 19:49741746-49741768 GGAGCAGCAGGCACTGGGGGAGG - Intronic
1167649450 19:50721418-50721440 AGAGGCCCAGGCTCTGAGGCAGG + Intergenic
1167982468 19:53286411-53286433 AGATCAGAAGGCTCTGAGGGTGG + Intergenic
1167983677 19:53297603-53297625 AGATCAGAAGGCTCTGAGGGTGG - Intergenic
1168431797 19:56287414-56287436 AGCTCCGCAGGCAATGTGGGAGG - Intronic
925121482 2:1421913-1421935 AGAGCTGCAGGCTCTGGGTGTGG - Intronic
925401160 2:3574407-3574429 AGAGCCGCAGGATCTATTGCTGG - Intergenic
926148723 2:10412718-10412740 AGAGCCTCAGGAGGTGTGGGAGG - Intronic
927220587 2:20704898-20704920 AGAATGGAAGGCTCTGTGGGGGG - Intronic
927502245 2:23590628-23590650 GGATCCGCAGCCTCTGTGTGTGG - Intronic
928374214 2:30761915-30761937 AGAGCATCAGGCTCTATGTGTGG - Intronic
934518050 2:95001227-95001249 AAAGCAGCAGGCTATGTGTGGGG - Intergenic
934710063 2:96508712-96508734 AGGGCCGCGGGCGCTGTGGGCGG + Intergenic
935667720 2:105526532-105526554 ACAGCCACTGGCTCTGTGTGAGG - Intergenic
936081291 2:109434316-109434338 AGAGCAGCAGCTTCTGAGGGAGG + Intronic
936600462 2:113890105-113890127 AAAGCAGCAGGCTCGGTCGGCGG - Exonic
937903287 2:127039040-127039062 TGTGCCCCAGGCTCTGTGGGTGG + Intergenic
938763754 2:134446812-134446834 GGCGCCGCAGGCTCTGGGGGAGG + Intronic
942256539 2:174106912-174106934 AAAGTCACAGACTCTGTGGGAGG + Intronic
947643680 2:231722213-231722235 AGAGCTGAGGGGTCTGTGGGGGG + Intergenic
948572727 2:238927619-238927641 GGAGCCCCAGGCTCTGTGTGGGG + Intergenic
948589186 2:239038600-239038622 AGAGCCACAGACGCTGGGGGAGG - Intergenic
948772590 2:240259145-240259167 AGGGCCTCAGGCTGTGAGGGCGG - Intergenic
949011156 2:241679329-241679351 AGAGCCGCAGGCTCTGTGGGAGG - Intronic
1170334446 20:15252855-15252877 TGAGCAGCTGGCTCTGTAGGTGG - Intronic
1171182605 20:23101927-23101949 AGAGCTGCAGGCCCTGGGAGGGG + Intergenic
1171457780 20:25281615-25281637 TGGGCTGCAGGCTCTGTGCGTGG + Intronic
1172696833 20:36828753-36828775 AGAACCACAGCCGCTGTGGGAGG - Intronic
1173034481 20:39395573-39395595 AGAGGCGGGGGTTCTGTGGGTGG + Intergenic
1173863205 20:46297555-46297577 AGAGACGGGCGCTCTGTGGGAGG + Intronic
1174071778 20:47904772-47904794 GGAGGCCCAGGCTCAGTGGGGGG + Intergenic
1174370427 20:50083339-50083361 AGAGGTGCTGGCTCTGTGGCAGG - Intronic
1175189085 20:57199192-57199214 AGGGCAGCAGGGCCTGTGGGAGG - Intronic
1175786854 20:61717338-61717360 AGAGCAGCAGCGTCTGTGGCTGG - Intronic
1176210411 20:63918022-63918044 TGAGCAGCAGGCGCGGTGGGTGG - Intronic
1176222778 20:63978042-63978064 CGGGCTGCAGGCCCTGTGGGGGG - Intronic
1177134646 21:17296350-17296372 AGAGCAGCAGGCACTGTGCCTGG - Intergenic
1178728098 21:35073098-35073120 AGAGCTGCAGCCTCCGTGGATGG - Intronic
1179913353 21:44461438-44461460 GGGGCCCCAGGCTCTGTGGCGGG - Exonic
1180000943 21:44995272-44995294 AGGGCTGCAGGCTCTGGTGGGGG + Intergenic
1180099673 21:45578735-45578757 AGAGCTCCAGGCTGAGTGGGAGG - Intergenic
1181534740 22:23535501-23535523 AGAGGCTCAGCCTCAGTGGGCGG - Intergenic
1183544536 22:38448588-38448610 AGAGCTGTGGGGTCTGTGGGAGG - Intronic
1184683500 22:46085560-46085582 GGAGGCCCAGGCTCTGTGGTGGG + Intronic
1184722950 22:46326028-46326050 AGAGCCGCAGCCTGTCTGGTGGG - Intronic
1184791566 22:46703475-46703497 ACAGCCACAGACCCTGTGGGAGG - Intronic
1185101042 22:48840972-48840994 AGAGCTGCAGGGCCTGTGAGTGG + Intronic
1185369553 22:50454730-50454752 AGGGCCGCAGGACCTGAGGGTGG + Exonic
950480718 3:13242131-13242153 AGAGCCCCAGGCCTGGTGGGGGG + Intergenic
951689436 3:25380347-25380369 AGAGTCTCAGGCTCTGTGACTGG + Intronic
952959981 3:38583079-38583101 AGGGCCCTAGACTCTGTGGGTGG - Intronic
953407149 3:42665134-42665156 AGAGCCGCAAGCACTGAGGCAGG + Exonic
954645880 3:52131277-52131299 AGAGCCTCAGGCCCCGTGTGAGG - Intronic
954880586 3:53833430-53833452 AGGCCCGCAGGCTGGGTGGGTGG + Intronic
954971643 3:54656401-54656423 AGACCAGCAGCCTCTGTTGGAGG - Intronic
958807256 3:98826626-98826648 ACAGCCTCAGGCTCTGTCCGGGG - Intronic
961491488 3:127259451-127259473 GGAGCCGCAGGCAGTGAGGGAGG - Intergenic
963976004 3:151481105-151481127 AGAGCCTCTGGATCTCTGGGGGG - Intergenic
968861702 4:3176545-3176567 AGAGGAGCAGGCTCTCAGGGGGG + Intronic
968872921 4:3250636-3250658 AGAGCACCCGGCCCTGTGGGCGG + Intronic
969443559 4:7231879-7231901 AGAGACCCAGGCTCTCGGGGTGG + Intronic
975591445 4:76004109-76004131 AGAGCCACAGAATATGTGGGTGG - Intronic
976629343 4:87220604-87220626 CGAGCCGCGGCCTCTGGGGGCGG + Exonic
981355472 4:143784783-143784805 AGAGCAGCAGGCTCTGGGGTTGG - Intergenic
982274247 4:153623097-153623119 AGAGCCCCAGGCACTCTCGGTGG + Intronic
986313715 5:6572557-6572579 AGAGCCGAAGGCCCTGGGGAGGG - Intergenic
988538677 5:32090162-32090184 AGCGACCCAGGCTGTGTGGGGGG - Exonic
994239573 5:97405856-97405878 ACAGGCGCCAGCTCTGTGGGAGG + Intergenic
995525934 5:113050608-113050630 AGATCCGAAGGCTCTGGGCGTGG - Intronic
997673341 5:135694303-135694325 CTAGCCACAGGCTCTGTGGAGGG + Intergenic
998168907 5:139860482-139860504 GGAGCCTCAGAGTCTGTGGGAGG + Intronic
1000220171 5:159208125-159208147 AGATCTGCAGGCGTTGTGGGAGG - Intronic
1000348798 5:160336700-160336722 GGAGGAGCAGGCTCTGTGGATGG - Intronic
1001399682 5:171439121-171439143 TGAGGTGCTGGCTCTGTGGGTGG + Intronic
1003060246 6:2857358-2857380 AGGGTCGCAGGCTCTGGGCGAGG + Intergenic
1003224149 6:4189560-4189582 TGAGCTGCAGTCTCTGTAGGAGG - Intergenic
1005249569 6:23929108-23929130 AGAGCCACAGTCTCTGAGGAGGG - Intergenic
1005851784 6:29828180-29828202 GGAGCCGCGGGCGCCGTGGGTGG + Exonic
1006043221 6:31271713-31271735 GGAGCCGCGGGCGCCGTGGGTGG - Exonic
1006412336 6:33881582-33881604 AGAGGGGCAGGCTCTGCAGGGGG - Intergenic
1006594826 6:35185481-35185503 ACTGGGGCAGGCTCTGTGGGTGG - Intergenic
1007281103 6:40713174-40713196 AGACACGCAGGCTCTGAGGCTGG - Intergenic
1012291577 6:97461898-97461920 AGGACTGCAGCCTCTGTGGGAGG - Intergenic
1012536123 6:100299230-100299252 ACAGCCTAAGGCTCTGTGAGAGG - Intergenic
1015785950 6:136921961-136921983 AGAGCCGCTGGCTCTGTGGGGGG + Intergenic
1018275346 6:162124550-162124572 ATAACCGCAGGCTCTGTGGCTGG + Intronic
1018719740 6:166563464-166563486 GGAGCCGCAGCCCCTGGGGGTGG - Intronic
1018723835 6:166595469-166595491 ACAGCCGCAGTCTGTGCGGGTGG - Intronic
1019309130 7:351781-351803 AGAGCCGCTGGCTCCGGGGACGG - Intergenic
1019482139 7:1271866-1271888 GGAGCCGTGGGCTCTGAGGGAGG - Intergenic
1022821833 7:33969801-33969823 TGAGACCCAGGCTCTGTGTGAGG + Intronic
1026982102 7:74532890-74532912 AGAGCCCAAGGCTCTGTCCGTGG + Intronic
1027001351 7:74657044-74657066 AGAGGCGGAGGGTCTGGGGGAGG + Intergenic
1027126449 7:75559903-75559925 CAACCCGCTGGCTCTGTGGGGGG + Exonic
1027681853 7:81232372-81232394 ACAGGCGCTGGCTCTGTGTGAGG + Intergenic
1028054434 7:86225347-86225369 ACAGGTGCCGGCTCTGTGGGAGG + Intergenic
1031710066 7:125034387-125034409 AGAGCCCCAGGCTGAGTGGAAGG + Intergenic
1033472928 7:141665370-141665392 TGAGCCGCAGGCTCCGAGGGAGG - Intronic
1034275423 7:149821852-149821874 CAAGCCTCAGGCACTGTGGGAGG - Intergenic
1035024025 7:155814991-155815013 AGAGCAGCAGCTTCTCTGGGGGG - Intergenic
1037406184 8:18545325-18545347 AGAGCCAGAGGCCTTGTGGGTGG - Intronic
1037965072 8:23127870-23127892 GAAACCGCAGGGTCTGTGGGGGG - Intergenic
1039889371 8:41673784-41673806 AGAGCAGGTGCCTCTGTGGGTGG + Intronic
1042485100 8:69339245-69339267 AGCCCCTCAGGCACTGTGGGAGG + Intergenic
1044820673 8:96153873-96153895 AGAGCCGCAATCTCTGTCTGCGG + Intronic
1048276349 8:133068859-133068881 AGAGCCACAGGCTGACTGGGTGG - Intronic
1048976733 8:139677360-139677382 AGAGCCCCAGGCCCTGGGGTTGG - Intronic
1049306120 8:141905199-141905221 AGACCCGCAGGTCCTGGGGGAGG + Intergenic
1049364760 8:142231827-142231849 TCAGCAGCAGGCTCTGTGGCTGG - Intronic
1049426607 8:142540693-142540715 GGAGCCCCAGGGTCTGTGCGGGG + Intronic
1049683423 8:143929900-143929922 CGAGCCGGGGGCTCTCTGGGTGG - Intronic
1053346551 9:37382710-37382732 AGAGCCGGAGGCCGTGGGGGTGG - Intergenic
1054910330 9:70449378-70449400 AGAGCCTCAGAGTCTCTGGGAGG - Intergenic
1056787987 9:89606134-89606156 AGCGCGGCTGGCTCTGTGGAGGG + Exonic
1057829669 9:98396796-98396818 AGAGGGGCAGGCTGTGTGGCCGG - Intronic
1057895107 9:98903073-98903095 TGACCCACAGGCTCTGTGTGAGG + Intergenic
1058360599 9:104142248-104142270 AGAGTCCCAGTCTCTGTGGGAGG - Intergenic
1060745145 9:126126268-126126290 CGAGTCACAGGCTCTGAGGGAGG + Intergenic
1061245672 9:129400336-129400358 AGAGGCTCAGCCTCGGTGGGTGG + Intergenic
1061675941 9:132215709-132215731 GGAGCTGCAGGCTCTGAGAGAGG + Intronic
1061955617 9:133959833-133959855 AGAGCCGCAGGAGGTGGGGGAGG + Intronic
1062046929 9:134428630-134428652 AGAGCCGCAGCCTCTTTCGGGGG - Intronic
1062558684 9:137129445-137129467 GGAGCCGCAGGCTGGGAGGGCGG + Intergenic
1062622646 9:137429689-137429711 AGAGACGCAGGGACTCTGGGAGG - Intronic
1062635359 9:137487744-137487766 AGAACTGGAGGCTCTGTGGCTGG - Intronic
1187298545 X:18026311-18026333 AGAGCCGCACCCTCTCGGGGAGG + Intergenic
1187384596 X:18836594-18836616 AGAACCACAGGCTCAGTGGTAGG - Intergenic
1189211777 X:39289961-39289983 GGAGAAGCAGGCTCTGTGTGTGG + Intergenic
1192147945 X:68694182-68694204 AGAGCTTCAGGCTCTGTTGCCGG + Intronic
1192172529 X:68865744-68865766 AGAGCCCCAGGCTGGGTGCGGGG + Intergenic
1195177663 X:102326633-102326655 AGAGCAACTGGCTCTTTGGGTGG - Exonic
1195181201 X:102360460-102360482 AGAGCAACTGGCTCTTTGGGTGG + Exonic
1198675238 X:139124079-139124101 GAAGCAGCAGGGTCTGTGGGAGG - Intronic