ID: 949011394

View in Genome Browser
Species Human (GRCh38)
Location 2:241681118-241681140
Sequence ATCACAGATGTACAAAGACA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 379
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 344}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949011390_949011394 0 Left 949011390 2:241681095-241681117 CCATCATCCCTACAGCTGCCAAG 0: 1
1: 0
2: 1
3: 20
4: 255
Right 949011394 2:241681118-241681140 ATCACAGATGTACAAAGACACGG 0: 1
1: 0
2: 2
3: 32
4: 344
949011392_949011394 -8 Left 949011392 2:241681103-241681125 CCTACAGCTGCCAAGATCACAGA 0: 1
1: 1
2: 2
3: 26
4: 239
Right 949011394 2:241681118-241681140 ATCACAGATGTACAAAGACACGG 0: 1
1: 0
2: 2
3: 32
4: 344
949011391_949011394 -7 Left 949011391 2:241681102-241681124 CCCTACAGCTGCCAAGATCACAG 0: 1
1: 0
2: 0
3: 15
4: 154
Right 949011394 2:241681118-241681140 ATCACAGATGTACAAAGACACGG 0: 1
1: 0
2: 2
3: 32
4: 344
949011389_949011394 3 Left 949011389 2:241681092-241681114 CCACCATCATCCCTACAGCTGCC 0: 1
1: 0
2: 2
3: 30
4: 369
Right 949011394 2:241681118-241681140 ATCACAGATGTACAAAGACACGG 0: 1
1: 0
2: 2
3: 32
4: 344
949011387_949011394 18 Left 949011387 2:241681077-241681099 CCAAATACCACAAGTCCACCATC 0: 1
1: 0
2: 0
3: 12
4: 134
Right 949011394 2:241681118-241681140 ATCACAGATGTACAAAGACACGG 0: 1
1: 0
2: 2
3: 32
4: 344
949011388_949011394 11 Left 949011388 2:241681084-241681106 CCACAAGTCCACCATCATCCCTA 0: 1
1: 0
2: 0
3: 11
4: 251
Right 949011394 2:241681118-241681140 ATCACAGATGTACAAAGACACGG 0: 1
1: 0
2: 2
3: 32
4: 344

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949011394 Original CRISPR ATCACAGATGTACAAAGACA CGG Intronic
901286389 1:8082571-8082593 ATCACAAGTGTATAAAGTCAGGG - Intergenic
903625595 1:24727895-24727917 ATCAAAGAGGTTCAAAGAGAGGG - Intergenic
905243928 1:36599273-36599295 ATGAAAGATGTACAAACTCAAGG - Intergenic
906730061 1:48073109-48073131 AGCACAAATGGACTAAGACAGGG + Intergenic
906776691 1:48536219-48536241 AAAAAGGATGTACAAAGACATGG + Intronic
908450013 1:64244734-64244756 ATCACACATGCTGAAAGACATGG - Intronic
908964826 1:69747330-69747352 AACACAAATGTGCAAAGGCATGG + Intronic
909878811 1:80847267-80847289 AGCACAAATGGACCAAGACATGG - Intergenic
911451244 1:98063844-98063866 ATGTCAGTTGTACAAAGTCAAGG + Intergenic
912040066 1:105378862-105378884 ATCATAGATGAACAAACAAATGG - Intergenic
912309164 1:108602310-108602332 ATGACAGAAGTTCAAAGTCAAGG + Intronic
912428298 1:109613539-109613561 ATAACAGAAGTACAAAGAGAGGG - Exonic
912686935 1:111775293-111775315 AGCAGAGAGGTACAGAGACAAGG + Intronic
913370382 1:118092526-118092548 GGCAAAGATGTACAAAGATATGG - Intronic
914994528 1:152530938-152530960 AACAAAGATGAAAAAAGACAAGG - Intronic
917008003 1:170436999-170437021 ATAACAGATGAAGAAAGATAGGG + Intergenic
917053323 1:170949857-170949879 ACCCCAGAGATACAAAGACAAGG + Intronic
917585108 1:176417941-176417963 ATGACAGAAGGACAAAGAAAGGG + Intergenic
917670276 1:177267207-177267229 ATCACAGCTCTCCAAAGACTAGG + Intronic
917781480 1:178401878-178401900 CTCACAGAGTTAAAAAGACAGGG - Intronic
918149097 1:181782832-181782854 ATCCCAGAGGTACAAATTCAAGG - Intronic
918741320 1:188134238-188134260 ATCAGAGATGAAGAAAGAAAGGG - Intergenic
919376580 1:196801821-196801843 CTTACAGATGTACAGACACATGG - Intergenic
920016080 1:202910089-202910111 AACACTTATGTACAAAGACTTGG + Intronic
920670021 1:207996571-207996593 AACACAGAATTAGAAAGACAAGG - Intergenic
920717389 1:208353104-208353126 ATGACAGAGGGAAAAAGACATGG + Intergenic
921622283 1:217338610-217338632 TTCACAGATGAACAAAGAGGAGG - Intergenic
923394643 1:233549502-233549524 TTAACAGATGCAGAAAGACAAGG + Intergenic
923602772 1:235418080-235418102 GTCACAGAAGAACAAATACATGG - Intronic
924237086 1:242008094-242008116 ATCAGACATGTGCAAAGCCAAGG - Intergenic
924397405 1:243636854-243636876 AAAACAAATGTACAAAGACAGGG + Intronic
924928164 1:248703642-248703664 ATGAAAGCTGTACAAAGACAGGG + Intergenic
1063250464 10:4268384-4268406 ATCACAGCTGTACCTAGACCCGG + Intergenic
1063756832 10:9020695-9020717 CTTACAGATGAACATAGACATGG + Intergenic
1064496015 10:15911322-15911344 ATCACCGATGGCCACAGACAGGG - Intergenic
1064497460 10:15927671-15927693 ATCACAGAGATACAAAGAGGCGG - Intergenic
1064507279 10:16046691-16046713 ATCAAAGATGTACACAAATAGGG - Intergenic
1064538524 10:16382896-16382918 ATCTCAGATGCACACATACAAGG - Intergenic
1065126381 10:22578215-22578237 ACCAGAGATGGAGAAAGACATGG - Intronic
1065291365 10:24233171-24233193 ATCACAAATGGACTAAGAGAGGG - Intronic
1065299954 10:24312223-24312245 AAAACAGATATACACAGACATGG + Intronic
1065415447 10:25480506-25480528 ATAACAGATGTTCAAAGGCTGGG - Intronic
1065439933 10:25742116-25742138 ACCAAAGATGAACAAAGAAATGG + Intergenic
1065798802 10:29332234-29332256 ATCAGAGCTTTACAAACACAGGG - Intergenic
1068377762 10:56206881-56206903 AGCACACATGTACATAAACATGG - Intergenic
1068753441 10:60623294-60623316 CACAGAGATGTACAAAGAAAGGG + Intronic
1068780207 10:60911734-60911756 CTCACACAAGTACAAAAACATGG + Intronic
1069866016 10:71503283-71503305 ATCACAGCTGTGCAATGACTGGG - Intronic
1070567895 10:77617682-77617704 TTTACAGATGTACAAAAACTGGG - Intronic
1071002267 10:80843244-80843266 AACACAAATTGACAAAGACAGGG + Intergenic
1071462333 10:85910920-85910942 ATCACAGATTCAGAAGGACATGG + Intronic
1072027177 10:91471804-91471826 ATTACAGATGAACAAACAAATGG + Intronic
1072326393 10:94302934-94302956 ATGACAGAGGAACACAGACATGG - Intronic
1072328242 10:94319713-94319735 GTCAAACATGTACACAGACAAGG + Intronic
1072932052 10:99673776-99673798 AATAGAGCTGTACAAAGACACGG + Intronic
1073520226 10:104121734-104121756 TTCACAGACGCACAAAAACAAGG + Intergenic
1073698384 10:105895815-105895837 AACAAAGATGAAAAAAGACAAGG + Intergenic
1073739408 10:106389623-106389645 ATCACAGAGGGAGAAAGATAAGG + Intergenic
1073754905 10:106571328-106571350 ATTCCAGATGGACAAATACAAGG - Intergenic
1073798857 10:107019024-107019046 TTCACAGATGCAAAAAAACAAGG - Intronic
1074207848 10:111299625-111299647 ATTAAAGATATACGAAGACATGG - Intergenic
1074457272 10:113606115-113606137 TTCACAGATGTAGACATACATGG + Intronic
1075737470 10:124672806-124672828 ATCACAGATGTGCAAGGACTGGG + Intronic
1080665722 11:34334227-34334249 AAAACAGTTGAACAAAGACAGGG - Intronic
1083785131 11:64940573-64940595 ATCACTGATGTCCAGAAACAAGG - Exonic
1085625439 11:78068345-78068367 AATAAAGATGTACAAATACAAGG - Exonic
1086041313 11:82482865-82482887 ATCACAGAAGTGGAAAGTCATGG + Intergenic
1087263037 11:96032021-96032043 CCCACTGATGTACAAAGATACGG - Intronic
1087691788 11:101329009-101329031 ATCACTGATGTAGAATGAGAAGG + Intergenic
1088314067 11:108489479-108489501 AACACAGATGAACAAAGATAAGG + Intronic
1088858653 11:113779763-113779785 ACCACAGATGCAGAAAGAAAAGG - Exonic
1089301213 11:117499786-117499808 ATCAAAGATGTCCAAGGACTTGG + Intronic
1089546204 11:119227918-119227940 GACACAGAAGTAAAAAGACAAGG - Intronic
1090804942 11:130197005-130197027 AGCACAGATGATCAAAGTCACGG - Intronic
1090912229 11:131131360-131131382 GTGACAGAGGGACAAAGACATGG - Intergenic
1091322708 11:134663291-134663313 AGCACAGATTTACTAAGGCAAGG - Intergenic
1093793416 12:23282695-23282717 AGCACACATGGACAAAAACATGG - Intergenic
1097659780 12:62416810-62416832 AATACAGTTGTCCAAAGACAAGG + Intronic
1098077244 12:66745321-66745343 ATCAAAGCTGAAGAAAGACAAGG + Intronic
1098231134 12:68373008-68373030 AAAACAGATGAACACAGACAAGG + Intergenic
1098306471 12:69107527-69107549 ATCACAGAGGTACAAAAGGAGGG + Intergenic
1098548610 12:71738664-71738686 AGCACAGGTGGACTAAGACAAGG - Intergenic
1099254376 12:80297631-80297653 ATCAAAAATGTACATATACAAGG - Intronic
1101298901 12:103457458-103457480 ATCCCTGATGAACAAACACAGGG - Intronic
1101298920 12:103457683-103457705 GTAACAGATGTTCAAAAACAGGG + Intronic
1101353222 12:103952808-103952830 ATGACTGCTGAACAAAGACATGG + Intronic
1106060302 13:26283991-26284013 ATCAAAACTGTACAAATACATGG + Intronic
1107747789 13:43530304-43530326 ATCAGAGCTGTACAAAGGAAAGG + Intronic
1107955927 13:45511269-45511291 AACATAAATGTTCAAAGACAGGG - Intronic
1108224580 13:48275120-48275142 ATCACAGATCTACAAACACAGGG + Intergenic
1109356288 13:61233142-61233164 TTCACAGATGTGAAAATACAAGG - Intergenic
1109639777 13:65175229-65175251 AGCAGAGATGGACAAAGACTAGG - Intergenic
1109687622 13:65842827-65842849 ATAACATATGTACAAAGAACTGG - Intergenic
1110419903 13:75295257-75295279 ATCACATACATACAAAGAAATGG + Intronic
1110788695 13:79562912-79562934 AACAAAGATGAAAAAAGACAAGG + Intergenic
1110911865 13:80975795-80975817 ATGACAGAAGTGCAAAGAAAGGG + Intergenic
1110928141 13:81181823-81181845 AACACAGAGTTACAAAGAAAAGG - Intergenic
1110997744 13:82135159-82135181 ATCACATATGGACACAAACATGG + Intergenic
1111421896 13:88021965-88021987 GTTCCAGATGTACTAAGACATGG - Intergenic
1112392429 13:98997759-98997781 AACAAAGATGCACAAAGTCAGGG - Intronic
1112577731 13:100651807-100651829 ATCCCAAAAGTACAAAGACCAGG + Intronic
1112837131 13:103529844-103529866 GTCATATATTTACAAAGACAAGG - Intergenic
1112975976 13:105318012-105318034 ATCACAGAAATACAAAGAATGGG + Intergenic
1113409337 13:110070840-110070862 AGCAGAGATGTGAAAAGACAGGG + Intergenic
1116539569 14:46082846-46082868 ATCACTGCTTTACAAATACAGGG + Intergenic
1116734894 14:48676739-48676761 AACACACATGTACATAAACAGGG + Intergenic
1118240161 14:64048512-64048534 AACACAGATGTAAAAACAAAGGG - Intronic
1119134643 14:72205557-72205579 ACCACAGAAGTATAAAGATATGG - Intronic
1119732015 14:76957038-76957060 AACACAGATGCCCACAGACAGGG - Intergenic
1120433623 14:84451497-84451519 ATCACAAATATACAACTACAGGG + Intergenic
1202879076 14_KI270722v1_random:40586-40608 ATCACAGATGTCGAAACAAATGG - Intergenic
1125362272 15:38876652-38876674 AGCAAAGATGTGCAAATACAAGG - Intergenic
1125386149 15:39138933-39138955 ATCACTGATTTACAAGGTCAAGG + Intergenic
1125560052 15:40623397-40623419 ATCAAAGATGTACAAAGTCCTGG + Exonic
1126403324 15:48296873-48296895 ATCAAAGATGAACACAGAGAAGG + Intronic
1127376799 15:58392574-58392596 ATTACAGTTTTACAATGACATGG + Intronic
1128042449 15:64587238-64587260 CACTGAGATGTACAAAGACAAGG - Intronic
1129640950 15:77377404-77377426 ATTACAGATAAACATAGACAAGG + Intronic
1131591108 15:93749062-93749084 AACAAAGATTTAAAAAGACAAGG + Intergenic
1138014679 16:53417727-53417749 ATCACAGCTGTATAAGGGCAGGG + Intergenic
1138144117 16:54593873-54593895 ATCACAGATGTATTTATACAGGG - Intergenic
1138639693 16:58374767-58374789 ATCAAAGATGAAAAAAGACATGG + Intronic
1138980888 16:62266761-62266783 CTACCAGATGTACAAAGACCTGG + Intergenic
1139103519 16:63798849-63798871 ATCATAGATGTACAAAGTTTGGG - Intergenic
1141890232 16:86921414-86921436 TTCAAAGATGAACACAGACATGG - Intergenic
1142559557 17:802081-802103 AACACAGAAATCCAAAGACAAGG + Intronic
1142590380 17:1002454-1002476 ATCACTCATGTACAAACACTCGG - Exonic
1146059081 17:29595098-29595120 ATGATAGATAAACAAAGACAGGG - Intronic
1148357542 17:46985671-46985693 ATCACAGATGTCCAAAATCCAGG - Intronic
1148908175 17:50924805-50924827 ATAATTGATGTACAAAGACAGGG - Intergenic
1149298187 17:55280299-55280321 CTCACAGGTGTAAAAACACAGGG - Intronic
1149747393 17:59112463-59112485 ATCACAGATTTAGAAAGGCAAGG + Intronic
1150898118 17:69237713-69237735 TTTGCAGATGTAAAAAGACAAGG + Intronic
1153530058 18:6037085-6037107 ATCACAGAAGTGCAAAGAGGTGG - Intronic
1156094411 18:33511423-33511445 ATCCCAGAGTTACAAAGACATGG + Intergenic
1156284607 18:35679508-35679530 CTCACAGATGTACACAGATTGGG - Intronic
1158409089 18:57188544-57188566 ATCACAGAGGAACAAAGAGGTGG + Intergenic
1158812017 18:61048856-61048878 AACACAGAAGCACAAAGTCATGG + Intergenic
1159873353 18:73783551-73783573 ATCACAGATATAAAGAGCCAGGG - Intergenic
1160802515 19:976903-976925 ACCACAGATGTCCCCAGACATGG - Intergenic
1161028424 19:2047212-2047234 ACCACAGATGTCCCCAGACATGG - Intronic
1161155184 19:2728856-2728878 ACCACAGATGTCCCCAGACATGG + Intronic
1161323154 19:3650456-3650478 ACCACAGATGTCCCCAGACATGG - Intronic
1161480310 19:4507062-4507084 ACCACAGATGTCCCCAGACATGG + Intronic
1163163212 19:15477994-15478016 AGCACCAATGTACTAAGACAGGG - Intronic
1163716545 19:18875935-18875957 ATGACAGATGTTCAAAATCAAGG - Intronic
1164817178 19:31213490-31213512 TACACAAATGTACAAAGACATGG - Intergenic
1167110157 19:47455835-47455857 ATCACAGATTTGCAAGGAGAGGG + Intronic
1167675201 19:50879710-50879732 GTCCCAGATGTACAAAAACAGGG + Exonic
1167735055 19:51289238-51289260 AGCCCAGATGGACTAAGACAGGG - Intergenic
1168439619 19:56352808-56352830 AACACAGATGTCCAAAGTCCAGG + Intronic
1202654697 1_KI270708v1_random:9594-9616 ATCACAGATGTCGAAACAAATGG - Intergenic
925054842 2:849470-849492 TTCACAGATGCACAGAAACACGG + Intergenic
925054947 2:850180-850202 TTCACAGGTGCACAGAGACACGG + Intergenic
925567650 2:5273447-5273469 ATCACAGTTTTACAAAGAGAGGG - Intergenic
925576207 2:5362906-5362928 ATCACAGAAGCAAAAAGAGAAGG - Intergenic
927016421 2:18967237-18967259 ATCACAGATTCACAAACAAATGG - Intergenic
929132163 2:38587482-38587504 ATTAAAGAAGTACAAAAACAAGG + Intronic
929725741 2:44425415-44425437 ATCGTAGAAGTATAAAGACAAGG + Intronic
931780450 2:65574971-65574993 ATCACAAATGAGCAAAGTCATGG - Intergenic
931814471 2:65887323-65887345 ATCTCAGGAGTACAAAGAAAAGG - Intergenic
932264120 2:70352314-70352336 ATAACCGAAGTAAAAAGACAAGG + Intergenic
932270736 2:70407016-70407038 ATCACAGATGCACAAACAAATGG + Intergenic
932272942 2:70426605-70426627 ATCACAGATATAACAAGTCATGG - Intergenic
933112684 2:78423846-78423868 AGCACAAATGGACTAAGACATGG + Intergenic
936778209 2:115999488-115999510 AGCACAGATGGATTAAGACAGGG - Intergenic
937778560 2:125810554-125810576 TGCACAGATGTACAAAGCCTGGG + Intergenic
939651123 2:144763146-144763168 AGCACAAATGGACAAAGACAAGG + Intergenic
940138663 2:150468189-150468211 ATCACATTTAGACAAAGACATGG + Exonic
941115158 2:161463513-161463535 CTTACAGATGTACCAAGATAAGG - Intronic
941138271 2:161744402-161744424 ATCACATATCAACAAAGAGAAGG - Intronic
941195540 2:162446742-162446764 ATCTCAGATGTAAAAATACATGG + Intronic
941784944 2:169488080-169488102 ATCACAGAAGTAAAAAGTCTAGG - Exonic
942159853 2:173172712-173172734 CTCCCAGATCTACAAAGAAATGG + Intronic
942934336 2:181536436-181536458 ATCAAAGCTGTGCAAAGACTAGG + Intergenic
943266232 2:185736791-185736813 CTCAGAGATGGACAAAAACAGGG + Intergenic
944365131 2:198910077-198910099 ATCATAGATGTGCAAATTCAGGG + Intergenic
944999268 2:205331124-205331146 ACGACATATGCACAAAGACAGGG + Intronic
945186449 2:207144619-207144641 AGCACAGATCTTCAAAGAAAGGG - Intronic
945366580 2:208962207-208962229 CTAACAGATGTACAAAGATCTGG + Intergenic
945475974 2:210283042-210283064 TTCAAAGTTGTACAAATACATGG - Intergenic
946388839 2:219403152-219403174 ATCACACATTTCCAAAGACCTGG - Intergenic
948015858 2:234690116-234690138 AACACTGATGTAAACAGACAGGG - Intergenic
948169295 2:235888290-235888312 GTCACAGAGGGAGAAAGACAAGG - Intronic
948341445 2:237256092-237256114 ATCACCATTTTACAAAGACAAGG + Intergenic
949011394 2:241681118-241681140 ATCACAGATGTACAAAGACACGG + Intronic
1169280497 20:4262987-4263009 ATCAGAGCTGGTCAAAGACAGGG - Intergenic
1170047343 20:12099489-12099511 AGCACACATGGACATAGACATGG + Intergenic
1170977883 20:21183568-21183590 AGCACATATGTAAAAAGAAATGG - Intronic
1172715458 20:36960025-36960047 GCCACAGAAGTACAAAGATAGGG - Intergenic
1172872294 20:38143321-38143343 ATCACTAATGCACAAAGAGATGG - Intronic
1175028801 20:55931593-55931615 AGCACAGATGGACATAAACACGG + Intergenic
1175914747 20:62420544-62420566 AACACATATGTACACAGACAGGG + Intronic
1176728977 21:10470880-10470902 AACACACATGCACAAAGCCAGGG - Intergenic
1177381494 21:20350541-20350563 ATTACAGATACACAAAAACAAGG - Intergenic
1177435123 21:21042060-21042082 ATAACACATATACAAAGGCAGGG + Intronic
1177702525 21:24656913-24656935 ATCACACATGTTCAAAAACGTGG + Intergenic
1178310321 21:31524856-31524878 AGCACAAATGTACTAAGACAAGG - Intronic
1179524397 21:41966211-41966233 GTCACACATGTGCACAGACATGG + Intergenic
1179885249 21:44311389-44311411 CACACAGATGCACACAGACATGG + Intronic
1179958859 21:44757164-44757186 ATAACATGTGTCCAAAGACAGGG + Intergenic
1179966712 21:44811177-44811199 CACACACATGCACAAAGACACGG + Intronic
1180117665 21:45721739-45721761 TTCACAGAGGTCCATAGACAGGG + Intronic
1180388804 22:12204802-12204824 ATCACAGATGTCGAAATAAATGG + Intergenic
1182675941 22:32040082-32040104 ATTACAGATGTTCAAAGAGAGGG + Intergenic
1184457219 22:44617878-44617900 ACCACACATGTACACACACACGG + Intergenic
1184718200 22:46294005-46294027 ACCACAGATGCTCAAAGACTTGG - Exonic
949433508 3:4003848-4003870 AGTGCAGATGTACAAAGAAAGGG + Intronic
950202467 3:11054981-11055003 GTTACAGATGAACAAGGACATGG - Intergenic
951234352 3:20217354-20217376 ATCAAAGAGGTAAAAAGAAATGG + Intergenic
954824553 3:53361304-53361326 AACTCAGATGGACTAAGACAGGG - Intergenic
954848612 3:53581437-53581459 ATCACACACACACAAAGACACGG + Intronic
955528569 3:59848030-59848052 ATCACAGAGGTACAAAAAAGAGG - Intronic
956241889 3:67140166-67140188 ATCAAAGATGAAAAGAGACAAGG - Intergenic
956734679 3:72229105-72229127 ATCACAAATGGACTAAGACAGGG + Intergenic
957001658 3:74893510-74893532 TTCACAGGTGTGCACAGACATGG + Intergenic
957054065 3:75431020-75431042 AGCAAAGATGTACATGGACACGG + Intergenic
957147018 3:76437254-76437276 ATCACATATGAATAATGACAAGG + Intronic
960108017 3:113818810-113818832 ATCACAGAAGTAAAAAGATATGG + Intergenic
960685857 3:120292790-120292812 AACAGAGATTTAAAAAGACAAGG + Intergenic
961927394 3:130495806-130495828 AACACAAATGGACTAAGACAAGG - Intergenic
962174373 3:133137680-133137702 ATGTCAGCTGTACAAATACAAGG + Intronic
962533136 3:136302079-136302101 ATCACAGAGGTGCAAAGAGATGG - Intronic
963313065 3:143729527-143729549 TCCACAGATATAAAAAGACAAGG - Intronic
963881164 3:150530373-150530395 TTCACAGATGCACACAGATATGG + Intergenic
964905080 3:161709438-161709460 ATCAAAGATCAAAAAAGACAAGG + Intergenic
965787399 3:172350368-172350390 ATCACAGAAGGACAAGAACATGG - Intronic
965950087 3:174298400-174298422 AACACATATGTACATAGAAAAGG - Intergenic
966962826 3:184957576-184957598 TTGACAGATGATCAAAGACAAGG + Intronic
966988065 3:185200583-185200605 CTCACAGATGCATATAGACAGGG + Intronic
967502584 3:190217105-190217127 AACACAGATGGACTAAGACAAGG + Intergenic
969102053 4:4776733-4776755 GTCACTGGTGTACACAGACAGGG - Intergenic
970164360 4:13220723-13220745 TTAACAAATGTACAAAGACATGG - Intergenic
970408763 4:15787581-15787603 ATTCCTGAAGTACAAAGACAAGG - Intronic
970680789 4:18505484-18505506 AACACACATGGACAAAAACATGG - Intergenic
971687725 4:29790168-29790190 AGCATACATGTAAAAAGACATGG + Intergenic
971857989 4:32067829-32067851 AGCACACATGTACATAAACATGG - Intergenic
972149929 4:36076852-36076874 ATCAGAGATGTAGAAGGAAATGG - Intronic
972975132 4:44624887-44624909 ATGACAGTCCTACAAAGACATGG - Intronic
973668853 4:53192736-53192758 ATAACAGATGTAAAAGGTCATGG + Intronic
974093429 4:57336071-57336093 AACACAAATGTACAAAGCCCAGG - Intergenic
974255359 4:59446692-59446714 AACACAGAGGTCCAATGACATGG + Intergenic
974687458 4:65248275-65248297 AGCACAAATGGACTAAGACATGG + Intergenic
976492459 4:85687463-85687485 AGCACAGGTGGACAAATACATGG - Intronic
976548207 4:86362792-86362814 ATCACATATTGACAAGGACATGG + Intronic
977817200 4:101428737-101428759 ATCACATATGTACAATTATATGG - Intronic
977868666 4:102062553-102062575 ATCACAGATGTGCTAAGAAGAGG + Intronic
978092159 4:104730816-104730838 ATCAAAGAGGTAAAATGACAAGG + Intergenic
978373286 4:108050605-108050627 ATCACAGATTTTCAAAGGCTTGG + Intronic
979086335 4:116414665-116414687 ATCAGAAATGTACAAAGTGAAGG - Intergenic
979446885 4:120824159-120824181 AACACAAATGGACTAAGACAAGG + Intronic
979706970 4:123731816-123731838 CTCCCAGATGTACAAAGAGCTGG - Intergenic
979906283 4:126297987-126298009 AACAGAGATGTACAAATGCAGGG + Intergenic
982246878 4:153361977-153361999 ATCACAGACATGGAAAGACATGG - Intronic
982516098 4:156352146-156352168 ATGACATATGTACAAAAAGAAGG + Intergenic
983263219 4:165479054-165479076 ATGAGAGATGTACAAAGAAGAGG + Intronic
983797130 4:171878425-171878447 ATGAAACATGTACAGAGACAGGG - Intronic
984189214 4:176584551-176584573 ATCACAGATTGATAAAGACAGGG + Intergenic
984392036 4:179148391-179148413 ATCACTGATTTACCAACACAGGG - Intergenic
987480669 5:18453186-18453208 ATCACAGAAGTTCAAAGAGGTGG - Intergenic
987761709 5:22171972-22171994 ATGACACCTGTACATAGACAAGG - Intronic
987808696 5:22804805-22804827 ATCACAGATGGACTAAGATTAGG + Intronic
989069260 5:37493463-37493485 ATCACAGTTCTACAACCACAAGG + Intronic
989194410 5:38702009-38702031 AACACAGATCAAAAAAGACAAGG + Intergenic
989526632 5:42461028-42461050 ATCCCAGATATTCAGAGACAAGG - Intronic
990393298 5:55350418-55350440 AACAAAGATGTATAAAAACATGG - Intronic
990811303 5:59726957-59726979 AGCACCGATATACAAAGATAAGG + Intronic
990822357 5:59856954-59856976 ATCACAGATTTGGAAATACAAGG + Intronic
991896494 5:71405411-71405433 ATGACACCTGTACATAGACAAGG - Intergenic
993390459 5:87314375-87314397 ATTATAGATGTATAAAGAGATGG + Intronic
995419880 5:111952351-111952373 ATCCCAGATGTACCTTGACAGGG - Intronic
995867088 5:116702805-116702827 ATCACAATTGTAAAAACACAAGG - Intergenic
1003352393 6:5330323-5330345 CTCAGAGATGTTCAAAGAAAGGG - Intronic
1004523014 6:16380145-16380167 ATCACAGATGCGCAGAAACAAGG + Intronic
1005559511 6:27023975-27023997 ATAACAGTTCAACAAAGACAGGG - Intergenic
1005807002 6:29483415-29483437 TTCACAGATATAAAAAGAGATGG - Intergenic
1007408721 6:41649361-41649383 ATGACAGATGTATAAGGGCAGGG - Intronic
1008007114 6:46422433-46422455 AACACAAATGGACTAAGACAGGG + Intronic
1008232006 6:48994658-48994680 ATGACAGATATAAAGAGACATGG - Intergenic
1008418932 6:51274045-51274067 ATCCCAGATGAACTAGGACAAGG + Intergenic
1009481864 6:64169331-64169353 ATCAGAGATATACAAGGACAGGG + Intronic
1010242078 6:73625510-73625532 ATCAAAGATGTACAGATATAGGG + Intronic
1012118213 6:95331505-95331527 TGCACAGATGTATAAATACAGGG + Intergenic
1012180519 6:96146898-96146920 ATTACAGCTATTCAAAGACAGGG - Intronic
1012227651 6:96723369-96723391 ATCAAAGAAAGACAAAGACAGGG + Intergenic
1012317954 6:97803457-97803479 CTCACAGATGTACAGAGAAATGG - Intergenic
1012616399 6:101283955-101283977 AGCACAGCCCTACAAAGACATGG + Intergenic
1012836927 6:104281028-104281050 ATCACAGACGTACTGAGAGATGG - Intergenic
1012968052 6:105696859-105696881 AACCCAGGTGTTCAAAGACATGG + Intergenic
1013537110 6:111073115-111073137 ATCAGAGCTGTCCAAAGTCAGGG - Intergenic
1014478860 6:121910322-121910344 ATCAAAAATTTACAAATACATGG - Intergenic
1014961662 6:127694430-127694452 ATACCATATGTACAAATACATGG + Intergenic
1014981548 6:127951719-127951741 ATCACAGATGTTATAAGAGATGG - Intergenic
1015177703 6:130328918-130328940 ATGGCAGATTTACCAAGACAAGG + Intronic
1017402568 6:154081101-154081123 AGCACAGATGTCCAAACAAAAGG + Intronic
1017628275 6:156370269-156370291 ATCAGGGATGTTCAAAGAAATGG - Intergenic
1018486106 6:164242619-164242641 ATCACAGAGGTACAAAAAGTAGG + Intergenic
1018603525 6:165573477-165573499 CTCATAGATTTACTAAGACAGGG + Intronic
1018877897 6:167841690-167841712 ATCACAGATGATCAAAGAATAGG - Intronic
1020577480 7:9951930-9951952 AACATAGATGCACAAATACAAGG + Intergenic
1021414130 7:20362310-20362332 ATCACACATGGACATGGACATGG - Intronic
1022898007 7:34772588-34772610 ATCCTGGTTGTACAAAGACAAGG - Intronic
1023200769 7:37694533-37694555 AACACAAATGGACTAAGACAGGG - Intronic
1026159125 7:67853176-67853198 ATCACAGATGTAGAAAGTAGGGG - Intergenic
1026254692 7:68700342-68700364 ATGTCAGAAGTACAAAGAAAAGG + Intergenic
1026325545 7:69306192-69306214 AACACAAATGGACTAAGACAGGG + Intergenic
1027331773 7:77103800-77103822 ATCACAGAGGTGGAAAGAGAAGG + Intergenic
1028109457 7:86921341-86921363 GTCACAGATGTAGACACACAGGG + Intronic
1028343398 7:89750454-89750476 AGCACAAAAGTACAAAAACATGG + Intergenic
1029784000 7:102767536-102767558 ATCACAGAGGTGGAAAGAGAAGG - Intronic
1029917376 7:104224968-104224990 ATCACAGAGCTAAAATGACAAGG - Intergenic
1030749290 7:113210832-113210854 AGCACAAATGTACTGAGACAAGG - Intergenic
1031489529 7:122369779-122369801 ATTTCAGATGTACAATGAAAAGG - Intronic
1031890486 7:127288153-127288175 CTCACAGATCTAGAAAGACATGG + Intergenic
1031930368 7:127679403-127679425 AACACAGAAGTACAAAAACATGG - Intronic
1032286774 7:130543671-130543693 AGGACAGATGAACAAAGACTGGG + Intronic
1032750355 7:134833779-134833801 AGCAGAGATGGAGAAAGACAAGG - Intronic
1033808436 7:144980980-144981002 AACACAAATGAACCAAGACAAGG + Intergenic
1034104230 7:148476786-148476808 AGCTCAGATGGACAAAAACAGGG + Intergenic
1035573450 8:688958-688980 ATGACAGTTTTACAAAAACAAGG + Intronic
1035961350 8:4141523-4141545 TTCACACATGTACAAACAAAGGG + Intronic
1036297703 8:7550072-7550094 ATCAAACATATCCAAAGACAAGG + Intergenic
1036299007 8:7557720-7557742 ATCAAACATATCCAAAGACAAGG + Intergenic
1036300312 8:7565370-7565392 ATCAAACATATCCAAAGACAAGG + Intergenic
1036324869 8:7770946-7770968 ATCAAACATATCCAAAGACAAGG - Intergenic
1036587589 8:10138771-10138793 AGCACAGTTGTACTAAGATAAGG - Intronic
1037650317 8:20831576-20831598 TGCAAAGATGTACTAAGACATGG - Intergenic
1038247491 8:25872487-25872509 TGCACAGATGCACAAACACATGG - Intronic
1038856949 8:31344298-31344320 AACACAAATGGACTAAGACATGG + Intergenic
1039401771 8:37275919-37275941 ATTACAGAGGTACTCAGACATGG - Intergenic
1039775368 8:40731101-40731123 ATCACAGAGGTGCAAAGAGCTGG + Intronic
1040355936 8:46618123-46618145 ATCACACATCTACAAAAAAATGG + Intergenic
1041079087 8:54198781-54198803 TTCAAAAATGTACAAATACATGG - Intergenic
1041850656 8:62388324-62388346 ATTTTAGATGAACAAAGACAAGG - Intronic
1043304110 8:78772798-78772820 CTCACTGATTTACAAAAACATGG - Intronic
1044407182 8:91841284-91841306 ATCACAGATGTCCAAAGGTGTGG + Intergenic
1044639627 8:94365162-94365184 ACCTCAAATGGACAAAGACACGG + Intergenic
1047368789 8:124237686-124237708 TTCACAGATCAACAAAGTCACGG + Intergenic
1047822767 8:128539673-128539695 CTCAGAGATGTACAACGACCTGG + Intergenic
1047983910 8:130213131-130213153 ATCTAAGATTTACAAAAACATGG + Intronic
1050272149 9:3957738-3957760 ATCTCAGATGCACAAAGGAAAGG + Intronic
1050365625 9:4870906-4870928 ATCACTGAGATGCAAAGACATGG + Intronic
1050391034 9:5144731-5144753 AACAAAGATTTAAAAAGACAGGG - Intronic
1050706050 9:8398889-8398911 AGCACAAATGGACTAAGACATGG + Intronic
1050803680 9:9647037-9647059 AGCACAGATGGGCAAAGAGATGG - Intronic
1053488670 9:38482940-38482962 AGCACTGATGTCTAAAGACATGG - Intergenic
1055188339 9:73485218-73485240 AGCCCAGATGCACAAAGACAAGG + Intergenic
1055230927 9:74064425-74064447 ATCACACATGAAGAGAGACAGGG + Intergenic
1055376702 9:75656185-75656207 AGCACAAATGGACTAAGACAGGG + Intergenic
1057669021 9:97072219-97072241 AGCACTGATGTCTAAAGACATGG - Intergenic
1059358118 9:113717128-113717150 AGCACAAATGGACAAAGACAGGG + Intergenic
1059612502 9:115914446-115914468 TTCATAGATGTACACACACAGGG - Intergenic
1060549562 9:124478487-124478509 ATCACAGATAGGCAAAGACTGGG - Exonic
1061115347 9:128607080-128607102 CTCACAGCTGTACAACCACAAGG - Intronic
1203585271 Un_KI270746v1:63190-63212 AACACACATGCACAAAGCCAGGG + Intergenic
1186915290 X:14212548-14212570 AGGATAGATGTACAAAGAAAAGG - Intergenic
1187103237 X:16216425-16216447 AACACAAATGGACTAAGACATGG - Intergenic
1187361243 X:18629529-18629551 ATCACAAATGTATAAAAATATGG - Intronic
1188218075 X:27503431-27503453 ATCACAGATGTAAATACACAAGG - Intergenic
1189088533 X:38052752-38052774 ACCACAAATGTAAAAAGATATGG + Intronic
1189980202 X:46502445-46502467 ATTTCAAATGTACAAAGATAAGG + Intronic
1191102009 X:56740111-56740133 ATGACACATGTCAAAAGACAGGG - Intergenic
1191628584 X:63296430-63296452 AGCACACATGTACATAAACATGG + Intergenic
1192604335 X:72499224-72499246 AACACAGATGTACTAAGACAAGG + Intronic
1192920976 X:75706103-75706125 ATCACAGATCTAGAAAAAAATGG + Intergenic
1192941285 X:75914223-75914245 ATAACAGGTAGACAAAGACATGG - Intergenic
1193434595 X:81456836-81456858 ATGAAAGAAATACAAAGACATGG - Intergenic
1193961257 X:87927234-87927256 AACAAAGATTTAAAAAGACAAGG + Intergenic
1195271544 X:103236224-103236246 ATCTCAGTTCTACAAACACAAGG + Intergenic
1196648897 X:118148503-118148525 ATCACACAGGTAAAAAGTCATGG + Intergenic
1197098098 X:122619583-122619605 AACACAGATGAAAAGAGACAAGG - Intergenic
1197169245 X:123412731-123412753 ATTACAGATGGAAAAAGGCAAGG - Intronic
1197867910 X:131038028-131038050 ATCACAATTTTATAAAGACATGG + Intergenic
1198412617 X:136387012-136387034 ATGGCAGATGTGCAAAGAGAGGG + Intronic
1198884451 X:141319004-141319026 ATCACTGATGTAACAAGACCAGG - Intergenic
1199133740 X:144227269-144227291 ATCACACACGTACCAACACACGG + Intergenic
1199366809 X:146995891-146995913 ATCACACATGGACATAAACATGG - Intergenic
1201521104 Y:14874495-14874517 ATGAAAGAAGTACACAGACAGGG + Intergenic
1201638554 Y:16153215-16153237 ATCAGAGATTTTCAAGGACATGG + Intergenic