ID: 949014745

View in Genome Browser
Species Human (GRCh38)
Location 2:241702638-241702660
Sequence GGGGACTGCGGCGCGGAGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 570
Summary {0: 1, 1: 0, 2: 6, 3: 51, 4: 512}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949014734_949014745 2 Left 949014734 2:241702613-241702635 CCGCGGGGCGTCTCTCCCCGGCA 0: 1
1: 0
2: 0
3: 7
4: 112
Right 949014745 2:241702638-241702660 GGGGACTGCGGCGCGGAGGCGGG 0: 1
1: 0
2: 6
3: 51
4: 512
949014727_949014745 26 Left 949014727 2:241702589-241702611 CCGCGGCTGGGGAGGGCGTGCGG 0: 1
1: 0
2: 4
3: 23
4: 252
Right 949014745 2:241702638-241702660 GGGGACTGCGGCGCGGAGGCGGG 0: 1
1: 0
2: 6
3: 51
4: 512

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949014745 Original CRISPR GGGGACTGCGGCGCGGAGGC GGG Intronic
900113522 1:1019551-1019573 GGGAGCTGCGGCGCGGAGGCGGG - Intergenic
900172157 1:1274336-1274358 GGGTGCTGCGGCGCGGACGTGGG - Intergenic
900409482 1:2506295-2506317 CGGGCCTGAGGCCCGGAGGCCGG + Intergenic
900591283 1:3461297-3461319 GGTCACTGCGGCGCAGACGCAGG + Intronic
900930300 1:5732721-5732743 GGGGACTGTGGTGGGGAGGGGGG - Intergenic
901012291 1:6208681-6208703 GGGCACTGCGGCTCAGAGGCTGG - Intronic
901361305 1:8703222-8703244 GGGCACCGCGGCGCGGGCGCAGG + Intronic
901801304 1:11709544-11709566 GGAGACTGAGGCACGGGGGCAGG + Intronic
902687203 1:18086049-18086071 GAGGACTGGGGCCAGGAGGCTGG - Intergenic
902698759 1:18157483-18157505 GTGGGCTGCAGCGTGGAGGCAGG - Intronic
903510064 1:23868172-23868194 GGGTGTAGCGGCGCGGAGGCTGG + Exonic
903559339 1:24216195-24216217 GGGGACGGCTGAGCGGGGGCGGG + Intergenic
905239102 1:36571091-36571113 GGGGACAGCTGGGCTGAGGCAGG - Intergenic
905239187 1:36571422-36571444 GGGGACTGCTGGGCTGAGGTGGG - Intergenic
906152986 1:43598619-43598641 GGGGAGTGGGGTGCTGAGGCAGG + Intronic
906719973 1:47997391-47997413 CGGGAGAGCGGCGCGGAGCCGGG + Intergenic
906904508 1:49875308-49875330 GGGGACTGTGGTGTGGAGGGGGG - Intronic
907322566 1:53614507-53614529 GGGGGCTGCGGTGAGGATGCTGG + Intronic
907510523 1:54954619-54954641 GGGGGCTGCAGGGAGGAGGCTGG + Intergenic
907863168 1:58373324-58373346 GGGGACTGTGGTGGGGAGGGGGG - Intronic
910232048 1:84997286-84997308 GGGGTCGGCGACGCGGAGGCGGG + Intergenic
910777881 1:90893855-90893877 GGCGACTGGGGCGCTGCGGCGGG - Intergenic
913985134 1:143558243-143558265 GGGGACTGTGGTGGGGAGGGGGG - Intergenic
914827371 1:151145697-151145719 GGGGGTTGGGGAGCGGAGGCGGG + Intronic
915325588 1:155079968-155079990 GGGGTGTGTGGCGCGGTGGCCGG + Intronic
915326854 1:155085186-155085208 CGGGACCGGGGCCCGGAGGCGGG + Exonic
915538259 1:156550724-156550746 GGGGAGTGGGGCGTGGGGGCAGG - Intronic
915639264 1:157209674-157209696 GGGGACTGAGGGGCAGAGGGAGG - Intergenic
915912719 1:159924579-159924601 GGGGGCGGCGGCTGGGAGGCCGG - Intronic
917359830 1:174162929-174162951 GGGGACTGTGGTGGGGAGGGGGG + Intronic
918979177 1:191533316-191533338 AGGGACTGCTGTGGGGAGGCTGG - Intergenic
919194930 1:194272152-194272174 GGGGACTGTGGTGGGGAGGTGGG - Intergenic
919801868 1:201359147-201359169 GGGGAGTGCAGGCCGGAGGCAGG + Exonic
920528485 1:206685278-206685300 GGGGGCTGCGGCGGCGGGGCCGG - Exonic
920572130 1:207025082-207025104 GGGGGCGGGGGCGGGGAGGCGGG + Intronic
920771743 1:208892932-208892954 GAGGACTGGGGAGAGGAGGCAGG + Intergenic
922200410 1:223395689-223395711 GGGGACTGTGGTGGGGAGGGGGG - Intergenic
922766397 1:228158683-228158705 GGGGGCCGCGGCGCGGGGGCGGG - Exonic
924385232 1:243493308-243493330 GGGGTCTGCGGCCCAGAGCCTGG + Intronic
924801420 1:247331712-247331734 GGAGGCGGCGCCGCGGAGGCCGG + Exonic
924857438 1:247888473-247888495 GGGGACTGTGGTGGGGAGGGGGG - Intergenic
1062890542 10:1056684-1056706 CGGGGCTGCGGGGCGGAAGCCGG + Intronic
1063553756 10:7058181-7058203 GGGGACTGTGGTGGGGAGGGGGG - Intergenic
1063995137 10:11611690-11611712 GGGGCCGGAGGCGCGGAGGCGGG - Intronic
1065091931 10:22244101-22244123 GGGGACTGCGGGGAGGAGGAGGG - Intergenic
1065926135 10:30434748-30434770 GGTGAGTGCAGCTCGGAGGCTGG + Intronic
1067082033 10:43217423-43217445 GGGGATGGAGGCGCTGAGGCGGG - Intronic
1067211007 10:44260583-44260605 TGGGTCTGCGGGGCGCAGGCAGG - Intergenic
1069043317 10:63717564-63717586 GGGGGGGGCGGCGCCGAGGCAGG - Intergenic
1069544478 10:69318766-69318788 GGGGACGGGAGCGCGGAGACCGG + Intronic
1069667126 10:70170330-70170352 GGGGAGGTCGGAGCGGAGGCTGG - Intronic
1069703256 10:70441363-70441385 GGGGGCTGCGGCTCCGAGCCGGG - Intronic
1069761942 10:70816822-70816844 GGGGAGCGCGGAGAGGAGGCTGG + Exonic
1069881569 10:71596875-71596897 GGGGACCGGGGCTGGGAGGCAGG - Intronic
1070947877 10:80408419-80408441 GGAGACCGCGGCCCGGAGGTCGG + Intronic
1072151814 10:92690125-92690147 GGGGACGGCAGCGTGGGGGCGGG - Exonic
1072650625 10:97292412-97292434 GGGGGCTGAGGCGCGGGGGTCGG - Intronic
1072926279 10:99620196-99620218 GGGGCCGGCGGCGGGGAGGCCGG - Exonic
1073020429 10:100439015-100439037 GGAGATTGCGGCGGTGAGGCAGG - Intergenic
1073290057 10:102409099-102409121 GGGGGCCGCGGCGCGCCGGCCGG - Intronic
1073781586 10:106844733-106844755 GGGGACTGTGGTGGGGAGGGGGG - Intronic
1075438476 10:122461707-122461729 CGGGACAGCTGCGCCGAGGCGGG - Exonic
1075520959 10:123143230-123143252 GGGGGCTGGGGAGCGGAGGAAGG + Intergenic
1075698066 10:124450071-124450093 GGGGAGGGGGGCGGGGAGGCGGG + Exonic
1076035532 10:127196221-127196243 GCGAGCTGCGGCGCGGGGGCCGG - Intronic
1076230732 10:128818002-128818024 GGGGAATGAGGAGTGGAGGCTGG - Intergenic
1076373796 10:129970709-129970731 GGCGACTGCGACGATGAGGCCGG + Intergenic
1076786524 10:132752442-132752464 GGGGGCTGTGGCGTGGAGGGGGG + Intronic
1076895441 10:133309139-133309161 GGGGCCTACGGCGGCGAGGCGGG + Exonic
1077014742 11:394534-394556 GGGGACAGCGGCGGGGATGGCGG + Intronic
1077089475 11:771925-771947 GGTGGCTGCTGTGCGGAGGCTGG - Intronic
1077359986 11:2136583-2136605 TGGGTCTGCGGAGCGAAGGCTGG - Intronic
1077923118 11:6655910-6655932 GGGGGCGGCGGCGCGGAGCGCGG - Intergenic
1077983604 11:7327911-7327933 GGGGACTGTGGTGGGGAGGGGGG + Intronic
1078023491 11:7673625-7673647 GAGGCCAGAGGCGCGGAGGCCGG - Intronic
1078684378 11:13514444-13514466 GGGGACTGTGGTGGGGAGGGGGG + Intergenic
1079126489 11:17721446-17721468 GGGCACTGCGGGGCGGCGTCCGG - Exonic
1081620827 11:44618373-44618395 GGGGGCTGCGGATCGGGGGCGGG + Intronic
1081705483 11:45180418-45180440 GGCGACAGCGCCGCGGAGGCCGG - Intronic
1081938138 11:46918595-46918617 CGGGGCTGCGGCGCGGGGGGCGG - Exonic
1082028736 11:47590155-47590177 GGCGACTTCGACGCGGCGGCCGG - Exonic
1082231618 11:49775272-49775294 GGGGACTGTGGTGGGGAGGGGGG - Intergenic
1083269882 11:61566661-61566683 CGGGAATGCGGAGCAGAGGCAGG + Intronic
1083329852 11:61892174-61892196 GGGCACTGGCGCGTGGAGGCGGG + Intergenic
1083766463 11:64843756-64843778 GGGGGCTGTGGCGCCGGGGCCGG - Intronic
1083822610 11:65181652-65181674 GGGGGCTGGGGCGCGGCGGAAGG - Exonic
1084070136 11:66728378-66728400 CGGGACTGCGGCGCCGCGGAAGG + Intronic
1084295868 11:68213215-68213237 GGGGACTGGGACGCGGGGCCCGG - Exonic
1084310434 11:68313159-68313181 GGGACTTGGGGCGCGGAGGCGGG + Intronic
1084888134 11:72223853-72223875 GGGGCGGGCGGCGCGGAGGGCGG + Intronic
1085123628 11:73982898-73982920 GGGGCCTGCGGGGCGGGGCCGGG + Exonic
1086652722 11:89313403-89313425 GGGGACTGTGGTGGGGAGGGGGG - Intergenic
1088407142 11:109494567-109494589 GGGGACTGTGGTGGGGAGGGGGG - Intergenic
1089248850 11:117143286-117143308 GGGGACTGCGGGGCTGGGGGAGG + Intergenic
1089300764 11:117497431-117497453 GGGGGCTGCGGCGGGGAGCCTGG + Intronic
1089675104 11:120084067-120084089 GGGAAATGCGGAGCTGAGGCAGG - Intergenic
1091000957 11:131910629-131910651 GAGGAAGGCGGCGCGGAGGCCGG + Intronic
1091108455 11:132943873-132943895 GAGGAAGGCGGCGCGGAGGCCGG - Intronic
1091726328 12:2848976-2848998 GAGGACTGCGGCCAGGAGGCTGG - Intronic
1092385364 12:8032677-8032699 GCGGAGCGCGGCGCGGAGGCCGG + Intergenic
1092707803 12:11303511-11303533 GGGGACTGTGGTGGGGAGGGGGG + Intergenic
1093138217 12:15477340-15477362 GGGGACTGTGGTGGGGAGGGGGG + Intronic
1093316358 12:17656130-17656152 GGGGACTGTGGCGGGGTGGGGGG - Intergenic
1094025867 12:25959029-25959051 GGGGAGTGCGGCGCGGGGACGGG + Intronic
1094809444 12:34123560-34123582 GGGGACTGGGGTGGGGAGGGGGG - Intergenic
1095388567 12:41678301-41678323 GGGGACTGTGGTGGGGAGGGGGG + Intergenic
1095476152 12:42589406-42589428 GGGGGCTGCGGCGCGGTGGTGGG - Intronic
1095752373 12:45727547-45727569 GGCGGCGGCGGCGCGGCGGCAGG + Intergenic
1096036833 12:48479351-48479373 GGGGACTGCTGTGTGGTGGCGGG + Intergenic
1096121185 12:49090378-49090400 GGGAACTGCACCGCGGAGACTGG - Exonic
1096460847 12:51820894-51820916 CGGGACGACGGCGCGGCGGCAGG - Intergenic
1097167100 12:57091695-57091717 GGGGACTGGGGCTGGGGGGCTGG + Exonic
1097621776 12:61947296-61947318 GGGGACTGTGGTGGGGAGGTGGG + Intronic
1098106139 12:67069907-67069929 AGGGAGAGCGGCGCGGAGGAGGG - Intergenic
1098893477 12:76032009-76032031 GAGGACGGGGGCGCGGAGGCGGG + Exonic
1099956107 12:89353709-89353731 GGGGACGGCGGGGCGGTGGCAGG - Intergenic
1100476682 12:94941527-94941549 GGGGACTGCTGAGCAGGGGCTGG + Intronic
1100680645 12:96916407-96916429 GGGGACTGTGGTGGGGAGGGGGG - Intronic
1101121677 12:101587112-101587134 GGGGACTGTGGTGGGGAGGGGGG + Intronic
1101466912 12:104958333-104958355 CGGGGCTGCCGCGCGGGGGCGGG - Intronic
1103700527 12:122846774-122846796 GGGGACTGCGGGGCTGGGCCAGG - Intronic
1104030905 12:125065377-125065399 GGGGCCTGCGGGGCGGGGCCTGG + Exonic
1104939034 12:132386313-132386335 GGCGGCTGCGGCTCCGAGGCCGG - Intergenic
1104939110 12:132386585-132386607 AGGCACTGAGGCGCCGAGGCCGG - Intergenic
1105867171 13:24471323-24471345 GGGGACTCCTGCGCAAAGGCGGG - Intronic
1106057768 13:26254435-26254457 GGGGACGGCGGGGCAGAGGCCGG - Exonic
1106865730 13:33961686-33961708 GGGGACTGCAGTTAGGAGGCAGG + Intronic
1107047376 13:36008375-36008397 GGGGACTGTGGTGGGGAGGGGGG - Intronic
1107051610 13:36056455-36056477 GGGGACTGTGGTGGGGAGGGGGG + Intronic
1108717311 13:53093839-53093861 GGGGACTGTGGTGGGGAGGGGGG - Intergenic
1108987470 13:56611355-56611377 GGGGACTGTGGTGCGGTGGAGGG - Intergenic
1110117511 13:71837993-71838015 GGGGACTGTGGTGGGGAGGGGGG + Intronic
1112255668 13:97828594-97828616 GGGGACTGTGGTGGGGAGGGGGG - Intergenic
1112584324 13:100703951-100703973 GGGGACTGTGGTGGGGAGGGGGG + Intergenic
1113378666 13:109784933-109784955 GGCGACGGCGGCGCGGCGGCGGG - Exonic
1113665831 13:112141859-112141881 GTGGACTGTGGCTGGGAGGCTGG - Intergenic
1113665841 13:112141892-112141914 GTGGACTGTGGCTGGGAGGCTGG - Intergenic
1113665851 13:112141925-112141947 GTGGACTGTGGCTGGGAGGCTGG - Intergenic
1113665885 13:112142032-112142054 GGGGACTGTGGCTTGGAGGCTGG - Intergenic
1113665897 13:112142073-112142095 GGGGACTGTGGCTTGGAGGCTGG - Intergenic
1113665909 13:112142114-112142136 GGGGACTATGGCTTGGAGGCTGG - Intergenic
1114159399 14:20146663-20146685 GGGGACTGTGGTGGGGAGGGGGG - Intergenic
1114952904 14:27779416-27779438 GGGGACTGTGGTGGGGAGGGGGG + Intergenic
1115028328 14:28767216-28767238 CGGGACAGCGGCGCGGCGGGCGG - Exonic
1115217339 14:31026261-31026283 GCTGGCTGCGGGGCGGAGGCCGG + Exonic
1115474571 14:33800612-33800634 GGGGGCGGCGGCGCGGGGGGCGG + Exonic
1115704114 14:35980853-35980875 GGGGACTGTTGCGGGGTGGCAGG - Intergenic
1117478348 14:56118875-56118897 CCGGACGGCGGCGCGGGGGCGGG + Intronic
1117547341 14:56804426-56804448 GGGGACTGCTGCGGGGTGGAGGG - Intronic
1118276216 14:64388186-64388208 GGGGACTGCGGGACGGAAGAGGG - Intronic
1118796829 14:69152243-69152265 GGGGGCTGCGACCCGGGGGCTGG - Intronic
1118943319 14:70359321-70359343 GGGGACAGCGGCGGGGAAGTGGG + Intronic
1121473349 14:94173972-94173994 GGGGGCTGGGGGGCGGGGGCTGG - Intronic
1121718961 14:96096065-96096087 GGGCAGTGCGGCTCAGAGGCCGG - Intergenic
1122108796 14:99480908-99480930 GGCGGCTGCGGCCCGGGGGCGGG - Intergenic
1122558011 14:102592006-102592028 GGGGGCCGCGGCGCGGGGGACGG - Intergenic
1123042964 14:105497938-105497960 GGAGGCTGCGGAGCGCAGGCGGG + Exonic
1124014388 15:25863293-25863315 GGGGACTGCGGCCGGGCGGCGGG - Intronic
1124118315 15:26867571-26867593 GGCGACTGCGGGGCTGAAGCCGG + Intronic
1124533229 15:30523795-30523817 GGAGACTGCCCCGCTGAGGCTGG + Intergenic
1124765428 15:32483849-32483871 GGAGACTGCCCCGCTGAGGCTGG - Intergenic
1126678085 15:51178837-51178859 GGGGACTGTGGTGGGGAGGGGGG + Intergenic
1126800906 15:52295692-52295714 TGGGCCTGCGCCGCAGAGGCCGG + Exonic
1128264505 15:66254621-66254643 CGGGACTTGGGCGCAGAGGCAGG - Intergenic
1128462899 15:67884704-67884726 GGGGAGGGCGGAGCGGGGGCTGG - Intergenic
1129520989 15:76186237-76186259 GGGAACTGAGGCCCGGAGGTGGG - Intronic
1130335222 15:82952466-82952488 AGGGACTGCGGGGCCGCGGCTGG - Intronic
1130572966 15:85065321-85065343 GGGGACTGTGGTGGGGAGGGGGG + Intronic
1131049091 15:89334641-89334663 GGGGTCGGCGGCGGGGAGGCCGG - Intronic
1132555367 16:569817-569839 GGGGCTGGCGGCCCGGAGGCAGG + Intronic
1132601473 16:774931-774953 GGGGTCTGCGGCACCGATGCTGG + Exonic
1132689811 16:1177420-1177442 GGGGACTCCGGGGCGACGGCAGG - Intronic
1132725110 16:1335031-1335053 GGGGGCAGCGGAGCAGAGGCTGG - Intronic
1132741373 16:1414838-1414860 GGGGTCTGCGGGCCGGGGGCGGG - Intergenic
1132759394 16:1501477-1501499 GGTGACGGCGCCTCGGAGGCGGG + Exonic
1132931160 16:2459934-2459956 GGGGACTCCGGCTCGGAGCTGGG - Intergenic
1133057024 16:3150430-3150452 GGGGCCTGCTGCGGGGAGGGTGG + Intergenic
1133223057 16:4327553-4327575 GGGGACTGCGGGCGGGGGGCCGG + Intronic
1133286801 16:4694382-4694404 GGGGTCTGGGGCTGGGAGGCCGG + Intronic
1134033830 16:11014685-11014707 CGGGACTGAGGCACTGAGGCTGG - Intronic
1136181262 16:28554159-28554181 GGGAGCCGCGGCGCGGAGGGAGG - Intronic
1136348866 16:29694511-29694533 GGGGACTGCGGTGAGGAAGGGGG - Intronic
1137368998 16:47887335-47887357 GGGGGCTGCGGGTGGGAGGCAGG - Intergenic
1137471908 16:48768728-48768750 GGGGACTGTGGTGGGGAGGGGGG - Intergenic
1137552992 16:49453205-49453227 GGGGAGGGCTGCGTGGAGGCAGG - Intergenic
1137558829 16:49490124-49490146 GGGGACTGCAGAGCAGAGCCAGG - Exonic
1137892311 16:52175446-52175468 GGGGACTGTGGTGGGGAGGTGGG + Intergenic
1138142788 16:54582967-54582989 GGGGCCAGCGGCCCAGAGGCTGG + Intergenic
1138179140 16:54930647-54930669 GGGGGCCGCGGAGGGGAGGCGGG + Intergenic
1138247634 16:55479298-55479320 GGGGGCTGGGGCGCGGGGGCCGG + Exonic
1138651386 16:58463476-58463498 GGGGACCGCGACGCGGAGCCTGG - Intronic
1138750921 16:59420198-59420220 GGGGACTTGGGAGGGGAGGCTGG - Intergenic
1138761768 16:59552795-59552817 GGGGGGTGCGGCGGGTAGGCAGG - Intergenic
1139314083 16:66053092-66053114 GGGGACTGGGGAGCAGGGGCTGG + Intergenic
1139364776 16:66426889-66426911 GGGCAGGGCGGCGAGGAGGCCGG - Intergenic
1139754541 16:69132269-69132291 CGGGAGGGCGGCGCGGAGGTGGG - Intronic
1140478628 16:75251118-75251140 GGAAACTGAGGCTCGGAGGCAGG + Intronic
1141737099 16:85861021-85861043 GGGCACTGCAGCATGGAGGCAGG + Intergenic
1142120089 16:88382943-88382965 GGGGTCTGCCCCCCGGAGGCTGG - Intergenic
1142176319 16:88647048-88647070 GGGGGCTGCGGGGCCCAGGCAGG - Intronic
1142259843 16:89037529-89037551 GTGGGCTGTGGCGCCGAGGCTGG + Intergenic
1142278423 16:89135244-89135266 GGGGGCTGCAGCGTGCAGGCGGG + Intronic
1142567675 17:851203-851225 GGGGGATGCGGTGGGGAGGCCGG + Intronic
1142590266 17:1001744-1001766 GGGGGATGGGGCGCTGAGGCAGG + Exonic
1142695156 17:1629222-1629244 GGGGACGGCGGGGCGGCCGCGGG - Intergenic
1143240433 17:5439002-5439024 GGGCGCGGCAGCGCGGAGGCCGG + Exonic
1143419298 17:6776371-6776393 GAGGCCCGCGGCGGGGAGGCGGG + Intronic
1143562675 17:7705027-7705049 GGGGGCTGAGGCGGGGCGGCGGG + Intergenic
1144438421 17:15261265-15261287 GGAGACAGCGGCGAGGAGGCTGG + Intronic
1144586853 17:16492258-16492280 CGGAGCTCCGGCGCGGAGGCGGG - Intergenic
1144794636 17:17882748-17882770 GGGGCCTGCGGTGCGGAGTAGGG + Exonic
1146409620 17:32571225-32571247 GGGGAGTGGGGCGTGGAAGCAGG + Intronic
1147168045 17:38603728-38603750 GGGGACAGCGGGGTGGAGGGGGG + Intronic
1147307422 17:39573698-39573720 GGGCACTGAGGAGCGGGGGCCGG - Intergenic
1147971003 17:44219132-44219154 GAGGACGGCGGCCGGGAGGCGGG + Intronic
1148093942 17:45039668-45039690 GGGGACTGAGGCTCAGAGGAGGG - Intronic
1148122747 17:45222253-45222275 GGTGAGTGCGACCCGGAGGCGGG + Exonic
1148156834 17:45429590-45429612 GGGCGCTGGGGCGCGGAGGCGGG - Intronic
1148271789 17:46267159-46267181 CGGGGCGGCGGCGCGGCGGCCGG - Intergenic
1149391270 17:56193241-56193263 GGGGACTGTGGTGGGGAGGGGGG + Intronic
1149477826 17:56978053-56978075 GGGGCCTGCGGGTCGGGGGCGGG - Intergenic
1149659346 17:58326261-58326283 GGAGGCTGCTGGGCGGAGGCTGG - Intronic
1149849397 17:60026308-60026330 GGGGTCTGCGGCCCCGCGGCGGG - Intergenic
1149860771 17:60120216-60120238 GGGGTCTGCGGCCCCGCGGCGGG + Intergenic
1150613088 17:66749247-66749269 AGGGAATGGGGCGGGGAGGCAGG - Intronic
1150700681 17:67444417-67444439 GGGGACTGGGTGGCGGAGGGGGG + Intronic
1150764596 17:67993395-67993417 CGGGGCGGCGGCGCGGCGGCCGG + Intronic
1152358125 17:79816283-79816305 AGGTACTGCGGTGGGGAGGCAGG + Intergenic
1152394330 17:80023391-80023413 TGGGACTGCGGGGCGGAAGGAGG - Intronic
1152581088 17:81165899-81165921 GGAGGCAGCGGCGCGCAGGCCGG + Intronic
1152845927 17:82599777-82599799 GGGGACTGCGAGTAGGAGGCGGG + Intronic
1153051816 18:907738-907760 GCGGCGCGCGGCGCGGAGGCGGG - Exonic
1153285154 18:3449995-3450017 GGGGGCGGCGGTGCGGACGCGGG - Intronic
1153636652 18:7118126-7118148 GGGGACTGCAGGGCCGCGGCGGG - Intergenic
1154218272 18:12431539-12431561 GGGGACGGGGGCGGAGAGGCTGG - Exonic
1154348574 18:13564683-13564705 GGGGGCGGCAGCGCAGAGGCGGG - Intronic
1154492845 18:14934429-14934451 GTGGACTGAGGTGGGGAGGCAGG - Intergenic
1154954681 18:21242406-21242428 GGGGACTCCGGGGCGCGGGCAGG + Intronic
1156361276 18:36386730-36386752 GGGGACAGCCGAGGGGAGGCAGG - Intronic
1157095168 18:44680440-44680462 GGGGCCCGCGGCGCGGAGGGAGG - Intronic
1157632437 18:49112110-49112132 GGGGGGTGCGGAGAGGAGGCGGG - Intronic
1157665925 18:49486993-49487015 GGGGAGGGCGGGGCGGAGGGCGG + Intronic
1158103484 18:53858031-53858053 GGGGACTGTGGTGGGGAGGGGGG + Intergenic
1158194152 18:54866276-54866298 GGGGGCAGGGGCGGGGAGGCGGG - Intronic
1158648895 18:59269377-59269399 GGCGACAGCGTCGCGGAGGGCGG + Exonic
1158874285 18:61718280-61718302 GGGGACTGTGGTGGGGAGGGGGG + Intergenic
1160426832 18:78783513-78783535 GGGGAGTGCAGAGAGGAGGCTGG - Intergenic
1160467884 18:79097527-79097549 GGGGACTGTGGTGGGGAGGGGGG - Intronic
1160500996 18:79400952-79400974 GGAGACGGCGGCGGGGAGGGAGG - Intronic
1160763563 19:797560-797582 GGGGAGGCCGGCGCGGCGGCGGG - Intronic
1160859013 19:1229843-1229865 GGGGAGGGCGGCGGGAAGGCGGG + Exonic
1160887118 19:1355173-1355195 CGGGGCTGAGGCGAGGAGGCCGG + Intronic
1160910224 19:1470642-1470664 GGGGAGGGCGGCGCCGCGGCGGG + Exonic
1160930513 19:1567787-1567809 GGGGACGGCGCAGCGGCGGCGGG - Exonic
1162336246 19:10062213-10062235 GGGGACAGCTTCGCGGAAGCGGG - Intergenic
1163333976 19:16659849-16659871 GGGGCCTGCGGCTTGGGGGCGGG + Intronic
1163834311 19:19563730-19563752 GGGGGCTGAGGAGCAGAGGCCGG - Intronic
1164437025 19:28239433-28239455 GGGGACTGCGGTTCGAAGCCTGG - Intergenic
1164644053 19:29845072-29845094 GGGGCCTGCGGCGGGGTGGGTGG + Intergenic
1165093572 19:33398704-33398726 GGCGACTGCTTCGTGGAGGCTGG + Intronic
1165184222 19:34002817-34002839 GGGAACAGAGGCGGGGAGGCTGG + Intergenic
1165305571 19:35000674-35000696 GGGGAGTGGGGCGCGGACGCAGG + Intronic
1165793872 19:38507406-38507428 GGGGACTGGTGAGTGGAGGCGGG + Intronic
1165858701 19:38895220-38895242 GGAGACTGAGGCTGGGAGGCTGG - Intronic
1166349094 19:42186072-42186094 GGGGACTGGGACGCCGAGGCGGG + Intronic
1166546898 19:43639518-43639540 GGGGGCTGCGGCACGGCGGCCGG + Intronic
1166677485 19:44748635-44748657 GGGGCCGGGGGCGGGGAGGCGGG + Exonic
1166991906 19:46697689-46697711 GGGTACGGCGGAGCGAAGGCTGG - Intronic
1167634967 19:50649104-50649126 GGGGACAGAGGGGAGGAGGCAGG + Intronic
1168144910 19:54415517-54415539 GGGGGCAGCGGGGCGGACGCCGG - Exonic
1168326165 19:55539540-55539562 TGGGACTGCGGGGCGCGGGCTGG + Intergenic
1168339121 19:55613802-55613824 GGGGGCTGCGGCGGGGGGCCGGG - Exonic
1168544727 19:57240842-57240864 GGGGGCTGCGGCGAGCAGGGCGG - Intronic
925016037 2:525132-525154 GTGGCCTGGGGCACGGAGGCTGG - Intergenic
925984983 2:9207644-9207666 GGGGGCTGCGGCGGGGAGCTCGG - Intronic
927153034 2:20206369-20206391 GGGGGCGGGGGCGGGGAGGCAGG + Intronic
927472214 2:23385238-23385260 GGCGGCGGCGGCGCGGGGGCTGG - Exonic
927479570 2:23441318-23441340 GGGGACTGTGGCGGGGTGGGGGG + Intronic
927558159 2:24050111-24050133 GGGGTCTGCGGCCCGGAGGCGGG + Intronic
929122189 2:38492759-38492781 GGGGACTGTGGTGGGGAGGGGGG - Intergenic
929188564 2:39120295-39120317 GGGGGCTGCGGCCGGGAAGCGGG + Intronic
929501416 2:42494082-42494104 GCGGAGGGCGGCGCGGAGGGAGG - Exonic
929775862 2:44930168-44930190 TGGGACTGCGGCTGGGAGCCCGG + Intergenic
929983190 2:46699491-46699513 GCGGACGACGGCGCGGGGGCCGG - Intronic
931211685 2:60203026-60203048 GGGGACTGTGGTGGGGAGGGGGG + Intergenic
932621947 2:73269750-73269772 GCGGCCTGGGGCGAGGAGGCTGG + Exonic
933054801 2:77648163-77648185 GGGGACTGTGGCGGGGTGGGGGG + Intergenic
933062908 2:77759604-77759626 GGGGACTGTGGCGGGGTGGGGGG + Intergenic
933658111 2:84905718-84905740 GGTGAGTGCGGCGCCGGGGCGGG + Exonic
933928576 2:87124404-87124426 GGGGACTGTGGTGGGGAGGGGGG + Intergenic
933999911 2:87700187-87700209 GGGGACTGTGGTGGGGAGGGGGG + Intergenic
934566974 2:95346591-95346613 GGCGGCGGCGGCGCGGCGGCGGG - Intronic
934714656 2:96536708-96536730 CGGGACTGCGGGGAGGTGGCCGG + Intergenic
935376112 2:102399488-102399510 GGGGCCTGCGGAGGGGAAGCGGG + Intergenic
936104576 2:109613888-109613910 GGCGACGGCGGCGGGAAGGCCGG + Exonic
936175080 2:110212546-110212568 GCGGTCTACGGCGCGGCGGCGGG + Intergenic
936531023 2:113277311-113277333 GGAGACTGCGCCGCAGAGCCCGG + Intronic
936556776 2:113503428-113503450 GGGGGCGGTGGCGCAGAGGCCGG - Intergenic
936860476 2:117012246-117012268 GGGGACTGTGGTGGGGAGGGGGG - Intergenic
936927470 2:117751961-117751983 GGGGACTGTGGTGGGGAGGGGGG + Intergenic
937337096 2:121068882-121068904 GGGGACTGGGGAGAGGAGGAGGG - Intergenic
937676137 2:124593287-124593309 GGGGACTGTGGTGGGGAGGTGGG - Intronic
938108371 2:128548557-128548579 GGGGCCTGAGGGGTGGAGGCGGG - Intergenic
938407393 2:131040064-131040086 GGGAACAGCGGAGCGGAGGACGG + Exonic
938692283 2:133802613-133802635 AGGGACTGCTGCGCTGATGCAGG - Intergenic
939420775 2:141965585-141965607 GGGGACTGTGGTGGGGAGGGGGG + Intronic
940252864 2:151699014-151699036 GGGGACTGTGGTGGGGAGGGGGG - Intronic
940729633 2:157374393-157374415 GGGGACTGTGGTGGGGTGGCGGG + Intergenic
942098473 2:172555913-172555935 CGGGACTCCGGCGAGGGGGCGGG + Intronic
942213910 2:173699530-173699552 GGGGACTGTGGTGGGGAGGGGGG - Intergenic
942584511 2:177460154-177460176 GGGGCCTGGGGCGCGGTGGGAGG + Intronic
944163345 2:196690214-196690236 GGGGACTGTTGTGGGGAGGCGGG + Intronic
945629628 2:212257056-212257078 GGGGACTGCTGGGTGGAGGAGGG - Intronic
946235752 2:218323486-218323508 GGGGACTGGGAGGCGGGGGCTGG + Intronic
947749064 2:232523494-232523516 GGGGACGGCTGCGGGGAGCCAGG + Exonic
948717439 2:239874431-239874453 GGGCAGTGGGGCGGGGAGGCAGG - Intergenic
948806688 2:240456151-240456173 GGAGGCTGAGGCGCGGGGGCCGG + Intronic
948873987 2:240817878-240817900 GAGGACTGCGGGGCACAGGCTGG + Intronic
949014745 2:241702638-241702660 GGGGACTGCGGCGCGGAGGCGGG + Intronic
949023248 2:241752966-241752988 GGGGACTGATGTGCAGAGGCTGG - Intronic
949032241 2:241802624-241802646 GGGGGCTGCGGGGCAGAGGGAGG + Intronic
1168802681 20:653316-653338 GGGGACCGCGGGGTCGAGGCCGG - Exonic
1169670850 20:8100164-8100186 GGGGACTTGGGAGCTGAGGCTGG + Intergenic
1169834373 20:9861489-9861511 GGGGACTGTGGTGGGGAGGGGGG + Intergenic
1171173452 20:23034974-23034996 GGGGTCTGCGGCGGCGGGGCTGG - Intergenic
1171756234 20:29112648-29112670 GGGGCCTGCTGCGAGGTGGCTGG - Intergenic
1172356952 20:34286975-34286997 GAGGACTGGGGCACTGAGGCTGG - Intronic
1172483312 20:35284546-35284568 GGGGCCTGAGGGACGGAGGCCGG - Intronic
1172662049 20:36574445-36574467 GGGGGGGGCGGCGCGGAGGTGGG + Intronic
1172698075 20:36835844-36835866 GGCGGCGGCGGCGGGGAGGCGGG - Intronic
1173615657 20:44401346-44401368 GGTGGCCGCGGCGTGGAGGCAGG + Exonic
1174407662 20:50312672-50312694 GGTGTCTGCGTGGCGGAGGCTGG - Intergenic
1174607023 20:51768431-51768453 GCGGGCGGCGGCGCGGAGGCCGG - Exonic
1175428880 20:58889251-58889273 CCGGGCTGCGGCGCGGCGGCTGG + Intronic
1175863755 20:62163713-62163735 GGGGAGTGAGGCGGGGAGCCTGG + Intronic
1176166283 20:63675742-63675764 GGGGACTGTGGAGAGGAGGGAGG - Intronic
1177143414 21:17381894-17381916 GGGGACTGTGGTGGGGAGGGGGG + Intergenic
1177555876 21:22687957-22687979 GGGGACTGTTGCGGGGTGGCGGG + Intergenic
1178769921 21:35493914-35493936 GGGGACTGTGGTGGGGAGGGGGG - Intronic
1179511874 21:41878948-41878970 GGGGACGGGGGCGCGGAGCCCGG + Intronic
1179558066 21:42193308-42193330 GGAGACTGTGGCGTGGTGGCTGG - Intergenic
1179908030 21:44434245-44434267 GGGGACGGTGGCGGGGACGCTGG + Intronic
1179908056 21:44434353-44434375 GGGGACTGTGGCGGGGACACTGG + Intronic
1180635224 22:17258461-17258483 GGGGACTGTGCTGGGGAGGCAGG - Intergenic
1181220013 22:21360368-21360390 GGGGAGTGCGGCTGGGAGCCGGG - Intergenic
1181934476 22:26429187-26429209 GGGGCCTGCGGGGCGGGGCCGGG - Intergenic
1183354367 22:37350541-37350563 GGGCCCTGCGGTGGGGAGGCAGG - Intergenic
1183546295 22:38456054-38456076 GGGGCCCGCGGCGCGGAGCAGGG + Intergenic
1183686434 22:39363701-39363723 GGGGACTGCCTGGAGGAGGCTGG + Intronic
1183702367 22:39457645-39457667 GGGGAGTGGGCCGCGGAGCCGGG - Intronic
1183720109 22:39557697-39557719 GGGGAGCGCGGGGCTGAGGCCGG - Intergenic
1184861961 22:47177398-47177420 GAGGACGGCGGCATGGAGGCTGG - Intergenic
1185276190 22:49951082-49951104 CGGGACAGGGGCGGGGAGGCTGG + Intergenic
1185276252 22:49951270-49951292 GAGGACGGGGGCGGGGAGGCTGG + Intergenic
1185285900 22:49999763-49999785 GGGGCCCGGGGCGCGGAGGTGGG + Intronic
1185398446 22:50604206-50604228 GGGGGCTCCGGCTCCGAGGCGGG - Exonic
1185417946 22:50720339-50720361 GGGGGCGGCGGCGAGAAGGCCGG - Intergenic
950318573 3:12028026-12028048 GGGGACTGTGGTGGGGAGGGGGG - Intronic
950873319 3:16248003-16248025 TGGGACTGCGGCTAGGAGGCTGG - Intergenic
951573426 3:24089611-24089633 GGGGACTGTGGTGGGGAGGGGGG - Intergenic
951717390 3:25664263-25664285 GGTGGCTGCGGCGCGGGAGCCGG - Exonic
951734570 3:25850048-25850070 GGGGTTGGCGGCGAGGAGGCAGG - Intergenic
951780196 3:26354466-26354488 GGGGGCGGCGGAGCGGGGGCGGG - Intergenic
953459414 3:43070624-43070646 GGGGACTGTGGTGGGGAGGGGGG + Intergenic
954287536 3:49629624-49629646 AGTGACTGCGGTGCAGAGGCAGG + Intronic
954389253 3:50260303-50260325 GGGGTCGGCGCCGCGGAGGCGGG + Intergenic
954403824 3:50334076-50334098 GGGGACTCCAGGGCGGAGTCAGG - Intronic
955228439 3:57079313-57079335 GGGGCCGGGGGCGGGGAGGCCGG + Intronic
957145254 3:76414605-76414627 GGGGACTGTGGTGGGGAGGGGGG + Intronic
957215834 3:77317922-77317944 GGGGGCTGCGGCGCCAAGGCAGG + Intronic
959770283 3:110087140-110087162 GGGGACTGTGGTGGGGAGGGGGG + Intergenic
959941653 3:112086992-112087014 GGGGGCTGCGGCGAGGTGGGTGG - Intronic
961448795 3:126993173-126993195 TGGGACTGGGGTGAGGAGGCAGG - Intronic
962575510 3:136752120-136752142 GGCGGCAGCGGCGCGGGGGCTGG - Intronic
962854985 3:139336606-139336628 GGGGACTGTGGTGGGGAGGGGGG + Intronic
964959525 3:162406017-162406039 GGGGACTGTGGTGCGGTGGTGGG - Intergenic
965520096 3:169662614-169662636 GAGGACTGCGGCGGGGAGTAGGG - Intronic
965684536 3:171288157-171288179 GGGGACTGTGGTGGGGAGGGGGG + Intronic
966696278 3:182793513-182793535 GGTGGCTGCGGCGCGGCGGCAGG + Exonic
967685276 3:192409903-192409925 GGAGGCGGCGGCGCGGCGGCGGG - Intronic
968008875 3:195260266-195260288 AGGGACCGCGCCGCGGAGGAGGG + Intronic
968081577 3:195849929-195849951 GCGGACCGAGGCGCTGAGGCCGG - Intergenic
968133795 3:196207851-196207873 GGGGACAGCGGGGTGGAGTCAGG - Intronic
968230645 3:197003026-197003048 CGGGGCTGCGGGGAGGAGGCGGG + Exonic
968293272 3:197555186-197555208 GGGCGCTGTGGCGCGGAGGGAGG + Intronic
969259041 4:6022141-6022163 GGGGGCTGAGGAGTGGAGGCCGG - Intergenic
969291315 4:6241754-6241776 GGGGACACCGGCACGCAGGCAGG + Intergenic
969536064 4:7756732-7756754 GGGGACTGCGCCGAGGAGCCGGG + Intergenic
969918542 4:10514010-10514032 GGGGACTGTGGTGGGGAGGGGGG - Intronic
970351323 4:15204369-15204391 GGGGACTGTGGTGGGGAGGGGGG + Intergenic
971351955 4:25863040-25863062 GGGGACGGGGACGGGGAGGCGGG - Intronic
971920784 4:32936754-32936776 GGGGACTGTGGTGGGGAGGGGGG - Intergenic
973000111 4:44937419-44937441 GGGGACTGTGGTGGGGAGGGGGG - Intergenic
973907358 4:55546025-55546047 GCGGACTGCGGCACGCGGGCCGG + Intronic
974690121 4:65288385-65288407 GGGGACTGTGGCGGGGTGGGGGG - Intergenic
974815366 4:66996606-66996628 GGGGACTGTGGTGGGGAGGGGGG + Intergenic
976538987 4:86251327-86251349 GGGGACTGTGGTGGGGAGGGAGG - Intronic
976812447 4:89111427-89111449 GGGGACTCCGGCGAGCGGGCGGG - Intergenic
977501896 4:97850260-97850282 GGGGACTGTGGTGGGGAGGGGGG + Intronic
977880953 4:102205079-102205101 GGGGACTGTGGTGGGGAGGGGGG - Intergenic
978021345 4:103817126-103817148 GGGGACTGTGGTGGGGAGGGGGG - Intergenic
978088580 4:104687037-104687059 GGGGACTGTGGTGGGGAGGGGGG - Intergenic
979316748 4:119274249-119274271 GGGGACTGCGGTGGGGTGGGGGG - Intronic
979349266 4:119627302-119627324 ACGGGCGGCGGCGCGGAGGCCGG - Intronic
981051936 4:140317850-140317872 GGGGACTGTGGTGGGGAGGGGGG - Intronic
983380203 4:166981868-166981890 GGGGACTGAGGTGGGGAGGCTGG + Intronic
984756874 4:183332721-183332743 TGGGGCTGCGGCAGGGAGGCTGG + Intergenic
984966315 4:185143290-185143312 GGGGACTGCGCGGCGGTGCCAGG + Exonic
985714248 5:1446545-1446567 GGGGAGTGCGGGGCGGGCGCAGG - Intergenic
985908991 5:2864272-2864294 GGGGACTGAGGGGCAGAGGCAGG + Intergenic
986797874 5:11230206-11230228 GGGGACTGTGGTGGGGAGGGGGG + Intronic
988547650 5:32173764-32173786 GGGGGCGGCGGCGCGGGGCCCGG - Intronic
990339278 5:54806585-54806607 GGGGACTGTGGTGGGGAGGGGGG - Intergenic
990580762 5:57165588-57165610 GGGGACTGGGGGACAGAGGCAGG - Intergenic
990612452 5:57471740-57471762 GGGGACTGTGGTGGGGAGGGGGG - Intergenic
991088361 5:62669453-62669475 GGGGACTGCGGTGGGGTGGGGGG - Intergenic
991305256 5:65169875-65169897 GGGGACTGTGGTGGGGAGGGGGG + Intronic
991743809 5:69710625-69710647 GGGGACGGGGGCGGGGAGGAGGG + Intergenic
991753904 5:69844617-69844639 GGGGACGGGGGCGGGGAGGAGGG - Intergenic
991795381 5:70290357-70290379 GGGGACGGGGGCGGGGAGGAGGG + Intergenic
991803529 5:70401372-70401394 GGGGACGGGGGCGGGGAGGAGGG - Intergenic
991823176 5:70585893-70585915 GGGGACGGGGGCGGGGAGGAGGG + Intergenic
991833216 5:70719730-70719752 GGGGACGGGGGCGGGGAGGAGGG - Intergenic
991887748 5:71289876-71289898 GGGGACGGGGGCGGGGAGGAGGG + Intergenic
992080348 5:73230591-73230613 CGGGGCTGGAGCGCGGAGGCTGG + Intergenic
993654356 5:90559005-90559027 GGCGAGGGCGGCGCGGAGGGCGG + Intronic
994248923 5:97514065-97514087 GGGGACTGTGGTGGGGAGGTGGG - Intergenic
994451539 5:99950460-99950482 GGGGACTGGGGGGCTGAGGGCGG + Intergenic
994805783 5:104446528-104446550 GGGGACTGTGGTGGGGTGGCGGG - Intergenic
996609180 5:125359153-125359175 GGGGACTGTGGTGGGGAGGGGGG - Intergenic
996807854 5:127477780-127477802 GGGGACTGTGGTGGGGAGGGGGG + Intergenic
997176050 5:131778985-131779007 GGGGACTGTGGTGGGGAGGGGGG + Intronic
997454048 5:134004686-134004708 GGGGGCTGCGACGCGGAGGCAGG + Intronic
997977950 5:138451164-138451186 GGGGACTGGGGCGGGGAGGTAGG + Intergenic
998402073 5:141853270-141853292 GGGCACTGCGGCAGGGAGGAGGG + Exonic
998963033 5:147509197-147509219 CAGGAGTGCGGCGAGGAGGCAGG + Intronic
999342278 5:150782456-150782478 GGGGACTGAGGTGGGGAGGAGGG - Intronic
999507479 5:152213159-152213181 GGGGACTGTGGTGGGGAGGCGGG + Intergenic
1000303029 5:159972545-159972567 GGGGAGGGCGGGGCGGAGGGGGG + Intergenic
1002068616 5:176665173-176665195 GGGGGATGCGGCGCGGAGGCGGG + Intergenic
1003234275 6:4281945-4281967 GGGGACTGCCGCGGGGGAGCAGG - Intergenic
1003544904 6:7051443-7051465 GGCGGCTGCGGCGCGGAGCCGGG + Intergenic
1003872166 6:10412230-10412252 GGGGGCCGCGGCGCGGCGTCTGG + Intronic
1004146970 6:13076933-13076955 GGGGACTGCGGTGGGGTGGGGGG + Intronic
1005940567 6:30556611-30556633 GGGGGCGGCGGAGCGGAGGGCGG + Exonic
1006123493 6:31822104-31822126 GGGGAGTGCGGGGGGGGGGCGGG - Intergenic
1006155409 6:32010639-32010661 GGGGATTGCAGGGGGGAGGCTGG - Intergenic
1006161715 6:32043373-32043395 GGGGATTGCAGGGGGGAGGCTGG - Intronic
1009180412 6:60510932-60510954 GGGGACTGTGGTGGGGAGGGGGG + Intergenic
1009196240 6:60689195-60689217 GGGGACTGTGGTGGGGAGGGGGG - Intergenic
1009211035 6:60863446-60863468 GGGGACTGTGGTGGGGAGGGGGG + Intergenic
1009561850 6:65256421-65256443 GGGGACTGTGGTGGGGAGGGGGG - Intronic
1009607120 6:65885757-65885779 GGGGACTGTGGTGGGGAGGGGGG + Intergenic
1009880188 6:69557105-69557127 GGGGACTGTGGTGGGGAGGTGGG + Intergenic
1010451732 6:76011737-76011759 GGGGACTGTGGTGGGGAGGGGGG - Intronic
1011643232 6:89433736-89433758 GCGGTCTGCGGCGCGTAGGAGGG + Intronic
1011650582 6:89502869-89502891 GGGGACTGGGGTGTGGAGGTGGG + Intronic
1012364530 6:98422355-98422377 GGGGACTGTGGTGGGGAGGGGGG + Intergenic
1012398377 6:98824948-98824970 GGGGAATGCGGGGCGGGGGGTGG - Intergenic
1012495572 6:99829422-99829444 GGGGACTGTGGTGGGGAGGGGGG + Intergenic
1012852006 6:104457293-104457315 GGGGACTGTGGTGGGGAGGGGGG + Intergenic
1013385212 6:109621731-109621753 GGGGACTGTGGTGGGGAGGGGGG + Intronic
1015676800 6:135759781-135759803 GGGGACAGCTGAGAGGAGGCAGG - Intergenic
1015843866 6:137497832-137497854 GCGGGCTGCGCCGCGGAGGCGGG + Intergenic
1016330050 6:142945804-142945826 GGGGCTCGCGGCCCGGAGGCGGG - Intergenic
1016714092 6:147204054-147204076 AGGGACTGCGGGGCCGGGGCGGG + Intergenic
1018156603 6:160991544-160991566 GGGGACTGTGGAGCGGAGCCGGG - Intergenic
1019272123 7:156272-156294 AGGGCCTGTGGCGCGGGGGCTGG - Intergenic
1019513040 7:1427743-1427765 GGGGCCAGCGGGACGGAGGCTGG - Intergenic
1019536180 7:1530942-1530964 GGGGACCGGGGCGCGGGGCCGGG + Intronic
1019750462 7:2725908-2725930 GGGGACTGCAGCGGGCGGGCTGG - Intronic
1020274325 7:6615593-6615615 GGGGGCGGGGGCGCGGGGGCCGG - Intergenic
1020278204 7:6637238-6637260 GGGGGCAGCGGCGCGGAGCGGGG - Intergenic
1021313361 7:19117864-19117886 GGGGAGGGCGGCTAGGAGGCGGG - Intergenic
1023703093 7:42911882-42911904 GGGGAGCGAGGCGGGGAGGCTGG - Intronic
1025573723 7:62607656-62607678 GGGGACTGTGGCGGGGTGGGGGG - Intergenic
1025850198 7:65238509-65238531 GGGGAGTGAGGTGGGGAGGCAGG - Intergenic
1027177786 7:75915495-75915517 GGGGGCGGCGGCGCGGGGACTGG - Intronic
1027943171 7:84710925-84710947 GGGGACTGTGGTGGGGAGGGGGG + Intergenic
1028565670 7:92228016-92228038 GGGGGTTGCGGCGGGGAGGTGGG + Intronic
1029450645 7:100640475-100640497 GGGGACTGAGGCTCTGAGGGTGG - Intronic
1029483804 7:100827463-100827485 GGAGACTGCGGCGCGGAGCCGGG + Exonic
1030517598 7:110557677-110557699 GGGGACTGTGGTGGGGAGGGGGG - Intergenic
1030588641 7:111451551-111451573 GGGGACTGTGGTGGGGAGGGGGG + Intronic
1032652030 7:133889574-133889596 GGGGACTGTGGTGGGGAGGGGGG - Intronic
1032927389 7:136623101-136623123 GGGGACTGTGGTGGGGAGGGGGG + Intergenic
1034192723 7:149224075-149224097 GGGGGCGGCGGCGCGGAGGCGGG + Exonic
1034870530 7:154679431-154679453 GGGAACTGCGGACCGGATGCAGG - Intronic
1035125943 7:156607751-156607773 GGGGACGGCGGCGAGGAGGGAGG + Intergenic
1037825293 8:22156800-22156822 GCGGACTGCGGCGCGGGCGGCGG + Exonic
1038233651 8:25730492-25730514 GGGGACTGTGGTGGGGAGGGGGG - Intergenic
1038727702 8:30095727-30095749 GGGGGCTGCGGGGCGAAGCCGGG - Intronic
1039828674 8:41195521-41195543 AGGGACTGGGGCGTGGAGGCAGG + Intergenic
1041686817 8:60652202-60652224 GGAGTCTGCGAGGCGGAGGCGGG - Intergenic
1043012584 8:74899891-74899913 GGGAACTGCTGCAAGGAGGCTGG - Intergenic
1043363999 8:79510394-79510416 AGGGTCTGCGGCAAGGAGGCAGG - Intergenic
1043759522 8:84050050-84050072 GGGGACTGTGGTGGGGAGGGGGG - Intergenic
1044591605 8:93917786-93917808 GGAGGCGGCGGCGGGGAGGCGGG - Intronic
1044692824 8:94896032-94896054 GGGGACTGCGGGGTGGCAGCTGG - Intronic
1044719877 8:95134347-95134369 CGGGTCTGCGGGGCGGGGGCCGG + Intronic
1046203541 8:110957471-110957493 GGGGACTGTGGTGGGGAGGTGGG + Intergenic
1047328199 8:123860132-123860154 GGGGACTGTGGTGGGGAGGGGGG - Intronic
1047877215 8:129152275-129152297 GGGGACTGTGGTGGGGAGGTGGG - Intergenic
1049093932 8:140536789-140536811 GGGGGCTGCAGCGGGGAGGAAGG + Intronic
1049177976 8:141205912-141205934 CGGGATTGCGGCGCGGTGGCCGG + Intergenic
1049222097 8:141432895-141432917 GGGGACAGGGGCATGGAGGCGGG + Intergenic
1049660194 8:143816301-143816323 GGGGTCTAGGGCGAGGAGGCAGG - Intergenic
1049798040 8:144505498-144505520 GGGGAGTGGGGCGGGGCGGCGGG - Intronic
1049798057 8:144505540-144505562 GGGGAGTGGGGCGGGGCGGCGGG - Intronic
1049798075 8:144505582-144505604 GGGGAGTGGGGCGGGGCGGCGGG - Intronic
1049798093 8:144505624-144505646 GGGGAGTGGGGCGGGGCGGCGGG - Intronic
1049896241 9:113910-113932 GGGGGCGGCGGCGCAGAGGCCGG + Intergenic
1051483118 9:17579728-17579750 GGGGGTGGCGGGGCGGAGGCCGG + Intronic
1051572792 9:18579334-18579356 GGGGACTGTGGTGGGGAGGGGGG + Intronic
1051893326 9:21965289-21965311 CGGGACTGCGGTTTGGAGGCGGG - Intronic
1053072903 9:35111526-35111548 GGAGTCGGCGGCGCGGAGCCGGG - Exonic
1053079472 9:35162314-35162336 GCGGACTGAGGCGGGGAGGCGGG + Intronic
1053250870 9:36573017-36573039 TGCGACTGCGGCGGGCAGGCGGG - Intronic
1053472977 9:38359948-38359970 GGGGACTGGGGCCAGGAGGAAGG + Intergenic
1055024305 9:71703126-71703148 GGGGACTGCTCCACGGAGCCAGG + Intronic
1056746991 9:89311445-89311467 GGGGCCTGGGGGGCGGAGCCCGG + Intronic
1056814663 9:89792459-89792481 GAGGACTGTGGCCAGGAGGCTGG - Intergenic
1057436830 9:95048452-95048474 GGGGCCTGGGGCGCAGGGGCGGG + Intronic
1058005141 9:99906580-99906602 GGGCCCTGCGGGGCGGGGGCGGG + Intergenic
1058559621 9:106212196-106212218 GGGGACTGTGGTGGGGAGGTGGG - Intergenic
1058904401 9:109469970-109469992 GGGGACTGCGCCACGGAGAAGGG - Intronic
1059264423 9:113012629-113012651 GGGGACGGTGGCGGGGGGGCGGG + Intergenic
1061030433 9:128078755-128078777 TGGGACTAAGGCTCGGAGGCTGG + Intronic
1061227806 9:129290906-129290928 CGGGAGTGCGGCGCGGAGCTGGG - Intergenic
1061301343 9:129706867-129706889 GGGGACTGCAGTGAGGATGCTGG - Intronic
1061541020 9:131277834-131277856 GGCGGCAGCGGCGCGGCGGCGGG - Intergenic
1061722935 9:132564869-132564891 AGGGACTGCGGTGCTGAGGAAGG + Intronic
1061975071 9:134063952-134063974 GGGGCCTGCGGCAAGGAGGGGGG + Intronic
1062162397 9:135087623-135087645 GGGGGCCGCGGCCGGGAGGCGGG - Intronic
1062325693 9:136011542-136011564 GGCGGCCGCGGCCCGGAGGCCGG - Exonic
1062532624 9:137008543-137008565 GGGGACTGCAGTGCGGATGGCGG + Exonic
1062562583 9:137148297-137148319 TGGGCCTGCGGCTCGGCGGCTGG - Intronic
1202802266 9_KI270720v1_random:10644-10666 GGGGCCTGCTGCGAGGTGGCTGG + Intergenic
1203771688 EBV:52931-52953 GGCGGCGGCGGCGCTGAGGCGGG + Intergenic
1203623545 Un_KI270749v1:146799-146821 GGGGACTGTGGTGGGGAGGGGGG + Intergenic
1186374080 X:8980024-8980046 GGGGACTGTGGTGGGGAGGGGGG + Intergenic
1187220293 X:17319290-17319312 GGGGACTGCGGTGGGGTGGGGGG - Intergenic
1187464407 X:19515017-19515039 GCGGCCGGCGGCCCGGAGGCTGG - Exonic
1188006751 X:25020988-25021010 GGGGGCTGAGGTGGGGAGGCTGG - Intergenic
1189439161 X:41018909-41018931 GAGGACTGAGGTGGGGAGGCCGG + Intergenic
1189485381 X:41426843-41426865 GGGGACTGTGGTGGGGAGGGGGG - Intergenic
1190220340 X:48508888-48508910 GGGGACGGGGACGCGGAGGAGGG - Intergenic
1190403804 X:50066001-50066023 GGGGACTGTGGTGGGGAGGGGGG + Intronic
1190993954 X:55586203-55586225 GGGGACTGTGGTGGGGAGGGGGG - Intergenic
1191274046 X:58516616-58516638 GGGGACTGTGGCGGGGTGGGGGG + Intergenic
1191748484 X:64515567-64515589 GGGGACTGTGGTGGGGAGGGGGG - Intergenic
1192287022 X:69749090-69749112 GGGGACTGTGGTGGGGAGGGGGG - Intronic
1192533840 X:71911522-71911544 GGCGACCGTGGGGCGGAGGCGGG - Intergenic
1192657933 X:73011835-73011857 GGGGACTGTGGTGGGGAGGGGGG + Intergenic
1192949594 X:76003246-76003268 GGGGACTGTGGTGGGGAGGGGGG - Intergenic
1193290331 X:79765748-79765770 GGGGACTGTGGTGGGGAGGTGGG - Intergenic
1193391011 X:80929432-80929454 AGGGGCTGCAGCGCGGAGGCAGG - Intergenic
1195275044 X:103273979-103274001 GGGGAGTGAGGGGCGGAGGTAGG - Exonic
1195339425 X:103891659-103891681 GGGGACTGTGGTGGGGAGGGGGG - Intergenic
1195639910 X:107161621-107161643 GGGGACTGTGGTGGGGAGGGGGG + Intronic
1195660167 X:107370190-107370212 GGGGACTGTGGTGGGGTGGCGGG + Intergenic
1196076983 X:111588850-111588872 GGGGACTGTGGTGGGGAGGGGGG - Intergenic
1196081842 X:111640920-111640942 GGGGACTGTGGTGGGGAGGGGGG + Intergenic
1196683933 X:118495362-118495384 GGGCACTGCAGCTCGGAGGCGGG + Intergenic
1198158626 X:133985780-133985802 GGGCACCGCGGCGCGGGGACCGG + Intronic
1198267344 X:135022011-135022033 GGGGAGGGAGGCGCGGAGGGAGG + Exonic
1198268545 X:135032810-135032832 GGGGAGGGAGGCGCGGAGGGAGG - Exonic
1198270427 X:135051660-135051682 GGGGAGGGAGGCGCGGAGGGAGG + Exonic
1198321241 X:135520957-135520979 GGAGAGTGGGGAGCGGAGGCAGG + Exonic
1200084832 X:153599025-153599047 GGGGCCTGCAGCGCGGGGCCCGG - Exonic