ID: 949017069

View in Genome Browser
Species Human (GRCh38)
Location 2:241719545-241719567
Sequence ACTTTCACGCAGAAAAGGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 146}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949017069_949017078 23 Left 949017069 2:241719545-241719567 CCGTGCCTTTTCTGCGTGAAAGT 0: 1
1: 0
2: 1
3: 9
4: 146
Right 949017078 2:241719591-241719613 CACCCAGTGCTGTTTCTCAAGGG 0: 1
1: 0
2: 3
3: 16
4: 207
949017069_949017073 -9 Left 949017069 2:241719545-241719567 CCGTGCCTTTTCTGCGTGAAAGT 0: 1
1: 0
2: 1
3: 9
4: 146
Right 949017073 2:241719559-241719581 CGTGAAAGTGGGACTCCTCCTGG 0: 1
1: 0
2: 0
3: 5
4: 89
949017069_949017077 22 Left 949017069 2:241719545-241719567 CCGTGCCTTTTCTGCGTGAAAGT 0: 1
1: 0
2: 1
3: 9
4: 146
Right 949017077 2:241719590-241719612 TCACCCAGTGCTGTTTCTCAAGG 0: 1
1: 0
2: 4
3: 15
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949017069 Original CRISPR ACTTTCACGCAGAAAAGGCA CGG (reversed) Intronic
901781687 1:11598712-11598734 CCTCTCACCCAGAAAAGGTATGG + Intergenic
902996443 1:20229154-20229176 ACTGTCAGGCAGAACAGGGATGG + Intergenic
903875191 1:26469186-26469208 CCTTTCACCAAGAAAAGGAAGGG - Exonic
904038449 1:27571061-27571083 ACTTTCAGGAAGAAAAGGCAGGG + Intronic
906985718 1:50681367-50681389 ACTTTTCCACAGAACAGGCATGG + Intronic
907321341 1:53604457-53604479 ACTCTCACGCAGACTTGGCAGGG - Intronic
908203951 1:61825867-61825889 ACTTACACTAAAAAAAGGCACGG - Intronic
908678935 1:66637190-66637212 ACTTTCAAGAAGAAGAAGCAAGG - Intronic
912174402 1:107139763-107139785 TCTTTCTCTTAGAAAAGGCAAGG + Intergenic
918792395 1:188846261-188846283 GCTTTCACTCAGAAAATTCATGG - Intergenic
920661057 1:207914677-207914699 ACTTACAGGCAGAAAAGGATAGG - Intergenic
922022576 1:221719319-221719341 ACTTGCAGAAAGAAAAGGCATGG + Intronic
924466980 1:244307424-244307446 ACTTTCACAAAGAACAAGCATGG + Intergenic
1063097347 10:2920148-2920170 ACTTTCTAGTAGAAAAGGCATGG + Intergenic
1066454590 10:35561855-35561877 ACTTGCAGGCAGAATAGTCAGGG + Intronic
1071674915 10:87646497-87646519 ACTTTTAGGCAGAAAAGGGGAGG + Intergenic
1074559256 10:114520403-114520425 AATTTCAAGCAGAAAAGACTAGG - Intronic
1076610831 10:131725103-131725125 GCTTTCACTCAGACCAGGCAGGG - Intergenic
1078499595 11:11857721-11857743 TCTGCCACGCAGAAAAGGTAGGG - Intronic
1080425766 11:32152921-32152943 TCTACCAGGCAGAAAAGGCAAGG - Intergenic
1083593969 11:63910306-63910328 AGTGTCAGGAAGAAAAGGCAAGG - Exonic
1086139809 11:83484228-83484250 ACTGTGAAGGAGAAAAGGCATGG + Exonic
1086836681 11:91632760-91632782 ACTTTGACCCATAAAAGGTAGGG + Intergenic
1087269860 11:96100138-96100160 GCTTTCACCCAGGAAGGGCATGG - Intronic
1088910993 11:114192537-114192559 TTTTCCACTCAGAAAAGGCAAGG - Intronic
1089822696 11:121242083-121242105 ACTTTAACTCAGAAGGGGCAGGG + Intergenic
1090744103 11:129693111-129693133 ACTGACGCGCAGAAAATGCAAGG + Intergenic
1092143798 12:6201076-6201098 ACTTTTACGCAGGAGCGGCAGGG + Intronic
1092551548 12:9507466-9507488 ACATTCCAGGAGAAAAGGCATGG + Intergenic
1092651406 12:10639342-10639364 ACTTTCATACAAAGAAGGCAAGG + Intronic
1094607926 12:31965275-31965297 ACTTTGACACAGAAAAAGGAGGG - Intronic
1095545735 12:43367068-43367090 ACTTTCACGAAGAAAAGCCCAGG + Intronic
1097969755 12:65620584-65620606 ACTTTTACGTAGCAAACGCATGG - Intergenic
1100572580 12:95857323-95857345 ACTGCCACGCAGAAAAAGGAGGG - Intergenic
1101886930 12:108672535-108672557 TCTTTCACACAGAGAATGCAGGG - Intronic
1103008671 12:117440901-117440923 ATTTTCACGCAGCCCAGGCAGGG - Intronic
1108854036 13:54771608-54771630 AATTTCAAGCAGAAAGAGCAAGG - Intergenic
1110394107 13:75010009-75010031 ACATACACACAGAAAAGACAAGG + Intergenic
1110625720 13:77653520-77653542 ACTCTCATTCAGAAAAGGGAAGG + Intergenic
1112765674 13:102740038-102740060 ACTTTCTTGCAAAATAGGCATGG + Exonic
1114349971 14:21839039-21839061 TCTTTCAGGCAGAAAAGAAATGG + Intergenic
1114574933 14:23704210-23704232 ACTTGCACACAAAAAAAGCATGG + Intergenic
1117194741 14:53328592-53328614 ACCTTCACGCTGAAGAGGCTAGG - Intergenic
1120475834 14:84985556-84985578 ACTATCAAGGAGAAAAGCCAAGG + Intergenic
1121422142 14:93823730-93823752 ACATCCACGCAGAGCAGGCAAGG + Intergenic
1122109928 14:99492135-99492157 ACTTTCACTTAGACAAGTCATGG - Intronic
1124240085 15:28021322-28021344 CCTTTCACCCAGAAAAGGCTGGG + Intronic
1124440791 15:29685087-29685109 CCTTTCCTGCAGAAAAGGCCTGG + Intergenic
1125011677 15:34883650-34883672 ACTTTCAGGTAGAAAGGTCAGGG - Intronic
1126779305 15:52125047-52125069 TCTGTCATGCAGAGAAGGCAGGG + Intronic
1128458485 15:67847666-67847688 AGTTCCAAGCAGGAAAGGCAAGG + Intergenic
1128660594 15:69498121-69498143 TCTTTCTCACAGGAAAGGCAGGG - Intergenic
1135254419 16:20929517-20929539 ACTTTCATCCTGAAAAGGCTGGG - Intergenic
1138445487 16:57060754-57060776 ATTTTATCTCAGAAAAGGCAAGG - Intronic
1138996056 16:62454474-62454496 GCTTTCAGGCAGATAAGGGAAGG - Intergenic
1148812755 17:50304562-50304584 ACTTTGACTCAGAAAAGGATGGG + Intergenic
1149126408 17:53239504-53239526 ATGTTCATGCAAAAAAGGCAAGG - Intergenic
1154169740 18:12042722-12042744 GCTTTCACACAGAAAAGGGGAGG - Intergenic
1156126109 18:33906880-33906902 ACTTTCACACACAAAAAGCAGGG + Intronic
1163130112 19:15267184-15267206 ACCTACCCTCAGAAAAGGCAGGG + Intronic
926082016 2:9994948-9994970 ACCTTCAAGCAGAAAAACCAGGG - Intronic
926083526 2:10007029-10007051 ACCTTCAGGCAGACAGGGCAGGG + Intergenic
926660575 2:15461332-15461354 ACTTTCCTGTACAAAAGGCAAGG + Exonic
931087356 2:58847638-58847660 AGTTTCTCACAGAAAAGGAATGG - Intergenic
934810595 2:97273346-97273368 ACTTTGAGGCAGAAGAGGAAGGG - Intergenic
934827097 2:97434593-97434615 ACTTTGAGGCAGAAGAGGAAGGG + Intergenic
939543679 2:143525568-143525590 ATTTTAACTCAGAAAAGCCAAGG - Intronic
941656885 2:168153881-168153903 ACTTTCACTCTGAAATGGCAAGG + Intronic
946999093 2:225432713-225432735 ACTATCACACAGAGAAGGGAGGG - Intronic
948189998 2:236051313-236051335 ACTTTCTCGTAGAAAAGCAACGG + Intronic
949017069 2:241719545-241719567 ACTTTCACGCAGAAAAGGCACGG - Intronic
1171027325 20:21642626-21642648 AAGTTCACACAGAAAAGACATGG - Intergenic
1175093770 20:56525545-56525567 TCTTTCAGGTAGAAAAGGAAGGG + Intronic
1178002008 21:28172253-28172275 AATTTCATGGAGAAAAGGGAGGG - Intergenic
1180124866 21:45783898-45783920 ACTTTCACACACACAAAGCACGG + Intronic
1182160559 22:28116913-28116935 ACTCACAGGCAGAAGAGGCAGGG - Intronic
1182295956 22:29311395-29311417 ACTGGCATGCAGAACAGGCAGGG - Intronic
1184917475 22:47580233-47580255 ACTTTTGCTCAAAAAAGGCAAGG - Intergenic
954278191 3:49555840-49555862 GCTTCCACACAGAAAAGCCAGGG - Intronic
963025814 3:140917746-140917768 ACTTCCCCTCAGAAAAGCCACGG + Intergenic
963973259 3:151452883-151452905 ACCATCAAGCAGAAAAGGAAAGG + Intronic
967099102 3:186201280-186201302 ACTTTCCTGCAGACAAAGCAGGG + Intronic
968546326 4:1200786-1200808 ACTTGCTCACAGCAAAGGCAGGG - Intronic
972153805 4:36130559-36130581 AATTTTACCCAGAGAAGGCATGG - Intronic
972926663 4:44016810-44016832 ACTGCCACGCAGAAAAAGGAGGG + Intergenic
972926684 4:44016968-44016990 ACTGCCACGCAGAAAAAGGAGGG + Intergenic
972926690 4:44017011-44017033 ACTGCCACGCAGAAAAAGGAGGG + Intergenic
975639934 4:76490359-76490381 TCTGACATGCAGAAAAGGCAGGG + Intronic
976164032 4:82234491-82234513 ACTTTCACACAGAGGGGGCAAGG + Intergenic
980492982 4:133553135-133553157 AATTCTAGGCAGAAAAGGCAGGG - Intergenic
985843981 5:2330469-2330491 ACTTTCACGCCACAATGGCAGGG - Intergenic
987448252 5:18048655-18048677 GCTTTCACTCAGTAAAGACAGGG + Intergenic
989843051 5:46105463-46105485 ACTTTCCAGCAGAAAAGTCTGGG + Intergenic
990176597 5:53114809-53114831 AATTTTAGGCAGAAAAGGGAGGG - Intergenic
991022093 5:61990040-61990062 ACATTCAAGAAGGAAAGGCATGG - Intergenic
992743344 5:79795605-79795627 ATTTTTGAGCAGAAAAGGCAGGG - Intronic
995285114 5:110379190-110379212 AATTTCTCGGAGAAATGGCAAGG - Intronic
995506145 5:112862359-112862381 ACTGCCACGCAGAAAAAGGAGGG + Intronic
999176809 5:149637642-149637664 ACATTCAGGCAGAATATGCAAGG - Intergenic
1000635202 5:163636173-163636195 ACTTCCTGGCAGAAAAGACAAGG - Intergenic
1001013528 5:168119813-168119835 AAGTTCATGCAGAATAGGCAGGG - Intronic
1001183583 5:169544963-169544985 ATTTTCAGACAGAAAAGACATGG - Intergenic
1002015451 5:176318217-176318239 TCTGCCACGCAGAAAAAGCAGGG + Intronic
1004706233 6:18126360-18126382 TCTGCCACGCAGAAAAGGCTAGG + Intergenic
1005587771 6:27293829-27293851 ACTTTCACGGAGAAGGGGCGAGG + Intronic
1007215810 6:40236214-40236236 ACTTGGAGGCAGCAAAGGCAGGG - Intergenic
1010469911 6:76215192-76215214 ACCTAAACACAGAAAAGGCATGG + Intergenic
1010914520 6:81599340-81599362 ACATTGACACAGAACAGGCAAGG + Intronic
1011263727 6:85494016-85494038 AGTTTCACACATTAAAGGCAAGG - Exonic
1011687128 6:89832482-89832504 AATGTCATACAGAAAAGGCATGG - Intronic
1014199385 6:118591345-118591367 TCTGCCACACAGAAAAGGCAGGG - Intronic
1014944777 6:127484241-127484263 ACGTTCAAGCACAGAAGGCAGGG + Intronic
1014986024 6:128010806-128010828 ATTCTCAAGCAGAAAAAGCAAGG + Intronic
1020735248 7:11940847-11940869 ACATTAAGGCAAAAAAGGCATGG + Intergenic
1020879660 7:13743677-13743699 CCTTTCAGGCAGAAAAAGCATGG + Intergenic
1021763835 7:23927414-23927436 ACTTACAGGCAGAAAAGCCGGGG - Intergenic
1023510516 7:40948219-40948241 ATTTTCATGCAGAGAAGGAATGG - Intergenic
1025992720 7:66507666-66507688 ACATTCACACAGACAAGGTAGGG + Intergenic
1026230380 7:68477919-68477941 AATTTCACTCTGTAAAGGCAAGG + Intergenic
1026999878 7:74645203-74645225 ACTTTCCCCCAGAAATGGGAAGG + Intergenic
1027633653 7:80641703-80641725 AACTCCACCCAGAAAAGGCATGG - Intronic
1027791251 7:82640521-82640543 ACTTTCAGGCATAAAAAGAAAGG - Intergenic
1032597837 7:133259747-133259769 ACATTCACATAGAAAAGGGAGGG - Intronic
1033158898 7:138980179-138980201 ACTTTGAGGCGGAAAAGGAAAGG - Intronic
1034341733 7:150361587-150361609 TCTTCCAGCCAGAAAAGGCAAGG + Intergenic
1037391781 8:18400442-18400464 TCTGTCAAGCAGAAAATGCAAGG - Exonic
1041002033 8:53463021-53463043 ACTTTCAGGCATAAAAAGAAAGG - Intergenic
1042017749 8:64335243-64335265 ACTTTAATGCAGAAATAGCATGG - Intergenic
1042772038 8:72391385-72391407 ACTTTCAGGCATAACAGGAAAGG - Intergenic
1042919730 8:73909452-73909474 ACTTTCAGGCATAAAAAGAAAGG - Intergenic
1044459934 8:92432172-92432194 AATTTCTTGCAGCAAAGGCAAGG + Intergenic
1046681231 8:117172361-117172383 ACATTCACACAGACAAGGCAGGG - Intronic
1048925738 8:139269559-139269581 ACAGTAAAGCAGAAAAGGCATGG + Intergenic
1050158753 9:2695279-2695301 CATTTCAAGCAGAAGAGGCAAGG - Intergenic
1050473101 9:6013385-6013407 ACATTCCAGGAGAAAAGGCATGG + Exonic
1051078677 9:13271417-13271439 ACTTTTACACAGAAAGGGCCAGG - Intronic
1052418785 9:28214211-28214233 ACTTTCATGCAGAAAAGCAATGG + Intronic
1052430926 9:28365699-28365721 TCTTTAACTCTGAAAAGGCAGGG - Intronic
1054140533 9:61525348-61525370 AATTTCACCCAGAAAATGCAAGG - Intergenic
1055562095 9:77531129-77531151 CCTTTCATCCAGTAAAGGCAGGG + Intronic
1055574744 9:77649232-77649254 ATTTTGATGCAGAAAAGGGAAGG + Intergenic
1056252186 9:84761005-84761027 GCTTTCTCACAGAAAATGCAGGG - Intronic
1060783857 9:126433620-126433642 GCTTCCAAGCAGGAAAGGCAGGG - Intronic
1061602252 9:131678926-131678948 AGTTTCACTCATAAAAAGCAGGG - Intronic
1061702326 9:132425094-132425116 ACATCCACGCTGACAAGGCAGGG - Intronic
1186099912 X:6144958-6144980 ACTTGTAGGCAGAAAAGTCATGG - Intronic
1186873416 X:13794071-13794093 ACTTTCAAGCTACAAAGGCAGGG + Intronic
1186942784 X:14529224-14529246 AATTTGAAGCAGAAAAGGGAAGG - Intergenic
1188323053 X:28764115-28764137 GCTTTAACCCAGAACAGGCAAGG - Intronic
1188407723 X:29832439-29832461 AATTAGAGGCAGAAAAGGCAAGG + Intronic
1192449471 X:71234829-71234851 ACTTTCACTAAGAATTGGCAGGG - Intergenic
1193353780 X:80492626-80492648 ACTCTCAGGCAGAACAAGCAGGG - Intergenic
1193729475 X:85085614-85085636 TCTTTTATGCAGAAAAGGTATGG + Intronic
1194156691 X:90398753-90398775 ACTTTTCTGCAAAAAAGGCAAGG - Intergenic
1196059884 X:111396630-111396652 ACTTTCATGCATAAAAGTGATGG - Intronic
1196656867 X:118227678-118227700 AATTTGAAGGAGAAAAGGCAAGG + Intergenic
1200503039 Y:3975738-3975760 ACTTTTCTGCAAAAAAGGCAAGG - Intergenic