ID: 949017243

View in Genome Browser
Species Human (GRCh38)
Location 2:241720387-241720409
Sequence GTGGGGAACAGGCCTGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 325
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 298}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949017243_949017252 -3 Left 949017243 2:241720387-241720409 CCCTCTTCAGGCCTGTTCCCCAC 0: 1
1: 0
2: 2
3: 24
4: 298
Right 949017252 2:241720407-241720429 CACGTGCCCGGGGCTCTTCCTGG 0: 1
1: 0
2: 0
3: 11
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949017243 Original CRISPR GTGGGGAACAGGCCTGAAGA GGG (reversed) Intronic
900090757 1:919408-919430 GTGCGTAACAGGCCCGATGAGGG - Intergenic
900340862 1:2188473-2188495 GGGGGACACAGGCCAGAAGAGGG - Intronic
900948420 1:5844165-5844187 GTGGGGCTCAGGCCAGCAGATGG - Intergenic
901011008 1:6202036-6202058 GTGGGGAGTAGGGCTGAACATGG - Intronic
901102636 1:6730974-6730996 GTGTGGAAGAGGCTTGTAGAGGG - Intergenic
901500965 1:9652368-9652390 GTGGGGAGCGGGGCTGCAGAGGG + Intronic
901641640 1:10695603-10695625 GAAGGGGACAGGCCTGGAGACGG - Intronic
902507022 1:16945363-16945385 CTGGGGACCAGGCCTGAGGCAGG - Intronic
905473733 1:38211490-38211512 GTGGGGAACAGGTTTGCAGAGGG - Intergenic
905569262 1:38991192-38991214 GAGGGGGGCAGGCCGGAAGAGGG - Intergenic
906041609 1:42792395-42792417 TGGGGGAACAGGCCTAGAGATGG + Intronic
906215555 1:44036172-44036194 GTGGGGAGCAGGCCGGAAGAGGG + Intergenic
906665887 1:47621758-47621780 GTGTGGAGCTGGCCTGCAGACGG + Intergenic
907338761 1:53718671-53718693 ATGGGGAACAAGTCTGCAGATGG - Intronic
910666226 1:89728385-89728407 CTGGGGAGCAGGCTTGAAGGAGG - Intronic
913099385 1:115549345-115549367 GTGTGAAAGAGGCCTGAAAAAGG + Intergenic
914248964 1:145906496-145906518 GAGGGGCACAGGCCTGGGGATGG + Exonic
914676693 1:149911630-149911652 GGGAGGAGCTGGCCTGAAGATGG + Intronic
914902095 1:151716403-151716425 GCGGGGAAAGGGCCTGAGGAGGG + Exonic
915138178 1:153748775-153748797 GTGGGGTACAGGCCAGATAATGG + Intronic
917377730 1:174367458-174367480 TTTCGGAAGAGGCCTGAAGAAGG - Intronic
918489325 1:185063799-185063821 CTGGGAAGCTGGCCTGAAGATGG - Intronic
920110616 1:203584592-203584614 GTGTGGAACAGGCTTGGAGAAGG - Intergenic
921421757 1:214956949-214956971 GAGGGGCACAGGTCTGAAAAAGG + Intergenic
922470137 1:225871633-225871655 CTGGGAAACAGGGCTGGAGAGGG + Intronic
923163151 1:231335659-231335681 GTGGAGAAAAGGTTTGAAGAAGG - Exonic
923668109 1:236016372-236016394 GTGAGGAAGAGGCAAGAAGATGG + Intronic
924113877 1:240726736-240726758 GTGGGGAATTGGACTGGAGATGG + Intergenic
924144675 1:241061644-241061666 GTAGGGAACAGGCGAGGAGAAGG + Intronic
1064106290 10:12503467-12503489 GAGGCGAAGAGGCCAGAAGAAGG + Intronic
1066317016 10:34258260-34258282 GTGGAGAACAAGACTGGAGATGG + Intronic
1066372039 10:34825390-34825412 GTGGAAAACAGGCTTGAAGGTGG - Intergenic
1067474493 10:46556812-46556834 GTGGGGACCCGGCCTGAGGAGGG - Intergenic
1068447288 10:57139252-57139274 GTGGGGAAGAGGCATGTGGATGG + Intergenic
1068766877 10:60773982-60774004 GGGGGGAAAAGTCATGAAGAGGG - Intergenic
1069722563 10:70559208-70559230 GTGTTGAACAGACCTGAAGGAGG + Intronic
1070245936 10:74731157-74731179 GTGGGCAACAGGCCTCATGCGGG - Intergenic
1070288722 10:75101087-75101109 GTGGGGAGAAGGCCTGCAGAAGG + Intronic
1070329963 10:75409611-75409633 GAGGGGAACGGGCCTCAGGAGGG + Intergenic
1070934196 10:80280818-80280840 GTGGGGAACAGGTCAGAAGGAGG + Intronic
1072356284 10:94614819-94614841 GTGGCAAACAGACTTGAAGATGG - Intergenic
1072419055 10:95274120-95274142 GTGGGGAAGAGGCATGATGTGGG - Intronic
1072533623 10:96342841-96342863 GTGAGGAACAGGCAGGCAGAAGG + Intergenic
1073179476 10:101575060-101575082 GCAGGGAACATCCCTGAAGAAGG - Intronic
1074495473 10:113976562-113976584 GTGGGCATCAGACCTGAGGATGG + Intergenic
1076750935 10:132542609-132542631 CTGGGGCAGAGGCCTGGAGAAGG - Intronic
1077140505 11:1022209-1022231 GAGGGGCACAGGGCTGCAGAGGG - Intronic
1077503136 11:2918165-2918187 GTGGGGCACAGGCCAGAGGAAGG - Intronic
1078822678 11:14897789-14897811 GTCTGGAGCAGGCCTGAGGAGGG - Intergenic
1079136654 11:17779377-17779399 GGGGGGGACAGGCCAGAAGCGGG - Intronic
1080505611 11:32910138-32910160 GTTAGGAAAAGGCCTGAAGTGGG - Intronic
1080642125 11:34164218-34164240 GTGGGGACCAGGCCTGCCCAGGG - Intronic
1080647091 11:34195165-34195187 CAGGGCAACAGGCCTGAAGAAGG + Intronic
1083312807 11:61793406-61793428 GGGTTGAACAGGCCTGGAGAGGG + Intronic
1083778037 11:64903664-64903686 GGGGGGAACAGGGCTGAGAAGGG + Intronic
1083938037 11:65880659-65880681 GTGGGGAACAGGCATGGCCAAGG + Intronic
1084069772 11:66726995-66727017 GTTAGGAACTGGGCTGAAGAGGG + Intronic
1085178163 11:74508729-74508751 GTGGAGAACAGGCTTGAGGAAGG + Intronic
1085252274 11:75151685-75151707 GAGGGGAAACGGCTTGAAGAGGG - Intronic
1085758545 11:79221948-79221970 GTGGAAACCAGGCCAGAAGAAGG - Intronic
1085794003 11:79520221-79520243 GTGGGGGAGAGGTATGAAGATGG + Intergenic
1086268344 11:85028728-85028750 GTGGGGGCCAGGGCTGGAGAGGG + Intronic
1089098100 11:115936573-115936595 GTGGGGAAAATGTCTGGAGAAGG + Intergenic
1090393321 11:126403513-126403535 GTGGGGCCCAGGCATGAATAGGG - Intronic
1090831167 11:130421810-130421832 GTGGGGATCAGGCCTGCGGCTGG + Intronic
1091657313 12:2355000-2355022 GTGGGGTGGAGGGCTGAAGAAGG + Intronic
1091797765 12:3306992-3307014 GTGGGAAACAGGGCAGAAGATGG + Intergenic
1091831067 12:3551516-3551538 GTGGGGGACAGGGCTGAGCATGG + Intronic
1092576014 12:9783206-9783228 GTGGGGCAAAGGCAAGAAGAAGG + Intergenic
1094012547 12:25824576-25824598 CTGGGGAACAGGTCAGGAGAGGG - Intergenic
1094285123 12:28783948-28783970 ATGGGGGAAAAGCCTGAAGAGGG + Intergenic
1096546808 12:52345698-52345720 GTGGGGGAATGGCTTGAAGAAGG + Intergenic
1096651880 12:53065893-53065915 GTGGGGAAGAAGCCTCCAGAAGG + Exonic
1097942406 12:65325768-65325790 GTGGGAAAGAGGCCTGCAGATGG - Intronic
1101799824 12:108011508-108011530 GTGGTGAACAGGAGTGAGGAAGG - Intergenic
1102615717 12:114152360-114152382 GCTGGGAAAATGCCTGAAGAAGG + Intergenic
1103595934 12:122024121-122024143 GCGGGGACCAGGCCTGTAGTTGG + Intronic
1103907489 12:124335070-124335092 GGGGGCACCAGGCCTGGAGAGGG - Intronic
1105782886 13:23719929-23719951 GTGGTGCACAGCCCTGAACATGG + Intergenic
1106050706 13:26187158-26187180 TGGGGCCACAGGCCTGAAGACGG + Intronic
1106791095 13:33155219-33155241 GTGGGGAACAACCATGAAGGAGG - Intronic
1110236321 13:73221407-73221429 GTGGGGAAAAGGATTGCAGAGGG - Intergenic
1111683875 13:91477637-91477659 GTTGGGAAAAGGGCTGCAGATGG + Intronic
1114301058 14:21378460-21378482 GTGGGGAAAAGTTATGAAGAAGG + Intronic
1115554346 14:34532556-34532578 GGGGGGAAAAGCCCTGAGGAGGG + Intronic
1117328715 14:54691745-54691767 CTGGGGCACAGCCCTGTAGAGGG - Intronic
1117472504 14:56060343-56060365 GTGGGGAAGATGCATGAAGAAGG - Intergenic
1120231708 14:81847547-81847569 CTGGGGAACAGGCATGGAAATGG - Intergenic
1121317948 14:92973428-92973450 GTCTGGAACAGCCTTGAAGATGG + Intronic
1121569377 14:94936019-94936041 GTGTGCAGCAGGCCTGCAGATGG - Intergenic
1121744097 14:96274431-96274453 GTGGGGAACAGGGGGGAAGGGGG + Intergenic
1122011324 14:98751370-98751392 GTGCAGAAAAGGCCTGGAGAAGG + Intergenic
1122373172 14:101240575-101240597 GTCAGGAACAGACCTGATGATGG + Intergenic
1123401268 15:19989604-19989626 GTGGGGAAAGGCCCTGGAGATGG - Intergenic
1123435287 15:20249734-20249756 GAGGGGTGCAGGCCTGCAGAGGG - Intergenic
1124011792 15:25844950-25844972 AAGGGGCACAGGCCTGAACAAGG + Intronic
1124144973 15:27116224-27116246 CTGGGGAACATGCCCAAAGACGG + Intronic
1124610293 15:31203427-31203449 GTGGGGAACAGGGGTGGAGGTGG - Intergenic
1125433961 15:39626298-39626320 GTGTTGAGCTGGCCTGAAGATGG + Intronic
1128126040 15:65193764-65193786 GAGGGGAACAGGCAGGTAGATGG - Intergenic
1128419972 15:67482771-67482793 GTGGGAAACGGGCCTGAGTAGGG + Intronic
1128521835 15:68380519-68380541 GTGGAGAACATGCCGCAAGAGGG + Intronic
1128676639 15:69614821-69614843 GTGGGGATCTGGGCTGAAGCTGG - Intergenic
1128692226 15:69733522-69733544 GTGGGGGCCAGGCCTGGAGATGG - Intergenic
1131073452 15:89480133-89480155 GTGGGGATCAGGTCTGATCATGG + Intronic
1131456935 15:92588918-92588940 GTTGGGACCAGGCAGGAAGAGGG - Intergenic
1131825885 15:96322346-96322368 GGGGGGAGCAGGCCTCAAGGGGG - Intergenic
1133343609 16:5055370-5055392 CTGGGGGGCAGGCCTGCAGAGGG - Intronic
1133477748 16:6139785-6139807 ATGGGGAACAGGACAGGAGAAGG - Intronic
1135135040 16:19881137-19881159 GTGGGAGGCAGGCCAGAAGAGGG + Intronic
1135544544 16:23356930-23356952 GTGGGAAGGAGGCCTGAGGATGG + Intronic
1138356277 16:56383542-56383564 GGGAGGAACAGGCATGAGGATGG - Intronic
1139352426 16:66345519-66345541 TCGGGGCAGAGGCCTGAAGAGGG - Intergenic
1142904525 17:3033288-3033310 GTGGGGAACACGCCTGCCCATGG - Intronic
1144058353 17:11560376-11560398 CTGGGGACCAGCCCTTAAGAAGG - Exonic
1144293894 17:13855042-13855064 GAGGGCAACAGGCATAAAGATGG - Intergenic
1144794029 17:17878920-17878942 CTGGGAAACAGGCCTGAGGTGGG + Intronic
1146404905 17:32528581-32528603 GTGGCAAAAAGGCCTGCAGATGG + Intronic
1146953043 17:36919978-36920000 ATGCGAAACAGGCCTGGAGAGGG - Intergenic
1147533513 17:41302174-41302196 GCAGGGAACAGGCATGTAGAGGG + Exonic
1147544388 17:41389270-41389292 GTGGGGAACAGGGCCCTAGAGGG - Intronic
1148687557 17:49509230-49509252 GAGTGGAAGAGGCCAGAAGATGG + Intronic
1149258986 17:54858637-54858659 CTGGGGAACCAGCCTGAAGGTGG + Intergenic
1149383744 17:56121633-56121655 GTGGGGGAGAGGTCTGAATATGG + Intronic
1150443358 17:65209686-65209708 AGAGGGAAGAGGCCTGAAGAGGG - Intronic
1151699675 17:75736615-75736637 GTGGGGCACCGGCGAGAAGAAGG + Exonic
1151758828 17:76089395-76089417 GTGGGGTACAGGCCAGGAGCTGG - Intronic
1151957155 17:77386194-77386216 GTGGGGCACAGGGCTGCAGGAGG - Intronic
1152133581 17:78491558-78491580 GTGGAGAACAGGCCTGGGGGAGG + Exonic
1152889870 17:82874265-82874287 GTGGGCTGCAGGCTTGAAGAAGG + Intronic
1153378061 18:4403918-4403940 GTGGGAAAAAGGGCTGCAGAAGG - Intronic
1153381656 18:4446865-4446887 GTGGGGAACATGTATGAATAAGG + Intronic
1153999020 18:10467800-10467822 GTGGTGAGCAGCCCTGTAGAGGG + Intronic
1155871394 18:31033191-31033213 TTGGGGAATAGCCATGAAGATGG - Intronic
1157623306 18:49028315-49028337 GTGGGAAACAGGCCTGGGCATGG + Intergenic
1157625352 18:49045991-49046013 GGGGGAAACAGGCCTGAACTAGG + Intronic
1158346446 18:56521343-56521365 GTGGGGATCAGGCAAGAAGCTGG - Intergenic
1158480992 18:57821720-57821742 TTGAGGAACAAGCCTCAAGAAGG - Intergenic
1160331416 18:77995617-77995639 GAGGGGAACAGTTCTGGAGATGG + Intergenic
1160487895 18:79310090-79310112 GTGGAGAAGAGGCAGGAAGAAGG + Intronic
1161250367 19:3276657-3276679 GTGGGGACGGGCCCTGAAGAGGG + Intronic
1162299178 19:9834719-9834741 GTGGGAAACAGGTGGGAAGAGGG + Intergenic
1162343564 19:10106662-10106684 GTGGGGTACAAACCTGCAGACGG - Exonic
1162851034 19:13431190-13431212 GTGGGGAACAGTCCTGGGGGTGG + Intronic
1163453956 19:17395096-17395118 GTGGCGAGCAGGCGGGAAGACGG - Intergenic
1165407139 19:35637822-35637844 GTGTGGAAGAGGTTTGAAGAGGG - Intergenic
1165737061 19:38183513-38183535 GTGGGGAGCAGGCTTGGGGAAGG + Intronic
1165897361 19:39150832-39150854 GTGGGCAGCAGGCCTGAACGGGG - Intronic
1166076171 19:40414940-40414962 ATGGGGGACAGGTCTGCAGAGGG - Intergenic
1166686708 19:44800705-44800727 GTGGGGACCAGGCCTGGGGACGG - Intergenic
1166806143 19:45488569-45488591 GTGGGGGACAGGGCTCCAGATGG - Intronic
1167106109 19:47430623-47430645 GTGGCGAGCAGGCCTAAAGGTGG - Intronic
1167470457 19:49672758-49672780 GTGGGGAGCAGGACTGGAGGTGG + Intronic
927318868 2:21719797-21719819 GTGGGCAAAAGGACTGAATAGGG - Intergenic
927436104 2:23067965-23067987 GTGCGGTAGTGGCCTGAAGAGGG - Intergenic
929486097 2:42356192-42356214 GTTGGGTAAAGACCTGAAGAAGG - Intronic
929552479 2:42903429-42903451 GTGGGGCACTGGCCTGAGCAGGG - Intergenic
931951565 2:67369226-67369248 GTAGTGAACAGACTTGAAGATGG + Intergenic
935244006 2:101202837-101202859 GTGGGGAACAGGCCAGGGGCAGG + Intronic
937917442 2:127106107-127106129 GTGGGGAGCTGGCCTGGAGGAGG - Intronic
938083242 2:128381298-128381320 CTGGAGACCAGGCCTGAGGAGGG + Intergenic
938240910 2:129741733-129741755 CTGGGGAACAGGCAGGAGGAAGG - Intergenic
938262132 2:129903740-129903762 CTGAGGAACAGGCCTGCAGAGGG - Intergenic
938566051 2:132520142-132520164 GTGGGGAAGAAGCCAAAAGAGGG - Intronic
940055422 2:149507921-149507943 GTTGGGAACAGGGGTGAGGAGGG - Intergenic
941010740 2:160297001-160297023 GTTGGGTACAGGTCTGGAGAGGG - Intronic
941305185 2:163855972-163855994 GTGGGAAAAAGACCTAAAGACGG + Intergenic
941963880 2:171281302-171281324 GTAGGGATCAGGCCTGAGGGTGG + Intergenic
943735450 2:191348898-191348920 GTGGGAAACAAGGCTGGAGAGGG - Intronic
945941858 2:215958683-215958705 CTAGAGAGCAGGCCTGAAGAAGG - Intronic
947092606 2:226529347-226529369 GTGGAAAACAGAGCTGAAGATGG + Intergenic
947765390 2:232634172-232634194 GTGGGGGACGGGGCCGAAGAGGG + Intronic
948236117 2:236391949-236391971 GTGGGGAAGGAGCCTGCAGAGGG - Intronic
948275999 2:236709263-236709285 GTGTGGACCAGGCCTGGAGTCGG + Intergenic
948467624 2:238159789-238159811 GTGTGGCCCAGGCCTGAGGAGGG + Intronic
949017243 2:241720387-241720409 GTGGGGAACAGGCCTGAAGAGGG - Intronic
1168854390 20:998551-998573 GTGGGAACCAGGCCTCAAGCAGG + Intronic
1168903189 20:1383184-1383206 CTGGGTAACAGGACTGAAGAAGG + Intronic
1171432425 20:25091431-25091453 CGGGGGAACAGGCCATAAGATGG + Intergenic
1172072805 20:32270875-32270897 TTGGGGAGGAGGGCTGAAGAGGG - Intergenic
1172593211 20:36131995-36132017 CTGGGGAACAGGCCTGAGCTGGG - Intronic
1172869522 20:38127034-38127056 GTGGGAAAGAGGCCTGAGGAGGG + Intronic
1172985298 20:38982606-38982628 GAGGGGAACAGGGATAAAGAGGG - Intronic
1173562788 20:44018164-44018186 GTGGTGATCAGGTCTGAACAGGG - Intronic
1175388833 20:58613839-58613861 GTGGGGATCAGACATGAAGCTGG + Intergenic
1175964907 20:62655559-62655581 GTGGGGAACAGGGCTGGTGAGGG + Intronic
1176010842 20:62894182-62894204 GAGGGAACCTGGCCTGAAGAAGG + Exonic
1177878927 21:26669335-26669357 GTCAGGATCAGGCCTGGAGAGGG + Intergenic
1179081181 21:38172037-38172059 TTGGGGAAGAGGCATGAGGAGGG + Intronic
1179183731 21:39067259-39067281 GAGAGGAAAAGGCCTGATGATGG - Intergenic
1181089123 22:20460010-20460032 CTGGGGCACAAGCCAGAAGAAGG + Intronic
1181164414 22:20975793-20975815 GTGGGAAACAGGCCCGAGGAGGG + Intronic
1181882858 22:25994994-25995016 GTGGGTGACAGGCTGGAAGAAGG + Intronic
1182194219 22:28497830-28497852 GTGAGGAATAGGGCTGAGGATGG + Intronic
1182269657 22:29145438-29145460 GCGGGGAACAGGGGTGAGGATGG - Intronic
1182446005 22:30390077-30390099 GTGGGGGACAAGCGTGAACAAGG - Intronic
1182691343 22:32165668-32165690 GATGGGAACAGGCCCTAAGAGGG + Intergenic
1183124126 22:35759141-35759163 ATGGGGAAAAGGAGTGAAGATGG - Intronic
1183736580 22:39648039-39648061 GAGGGAGACAGGCCTGCAGAGGG - Intronic
1184557821 22:45242518-45242540 CTGGGGCAGAGGCCTGAAGCAGG - Intergenic
1184736155 22:46398828-46398850 GAGGGGACCAGGCCAGAGGATGG + Intronic
949838215 3:8291971-8291993 GTGGGGAGCAGGTTTGAGGAAGG + Intergenic
950053415 3:10008512-10008534 GTGGGGAGCAGGCCTCAGCAGGG + Intronic
950305053 3:11910797-11910819 GTGGGGAGCAGGCCTGAGCAGGG + Intergenic
950415051 3:12864361-12864383 GTGGGTAGCAGGCCTGAGCAGGG + Intronic
950416814 3:12873507-12873529 GTGGGGAGCAGGCCTGAGAAGGG + Intergenic
950446475 3:13041763-13041785 TTGGGAAACAGGCTTAAAGAGGG + Intronic
954848845 3:53583299-53583321 GTAGGGACCAGGCAGGAAGACGG - Intronic
955524873 3:59809760-59809782 GAGAGGCACAGGTCTGAAGACGG - Intronic
956888782 3:73588531-73588553 GTGGGAAACAGGACTGAGGAGGG - Intronic
957637044 3:82799925-82799947 GTGGGGAACCATCCTGGAGATGG - Intergenic
961001999 3:123380259-123380281 GTGGTGAACAGGCTTGAGTAGGG + Intronic
962770946 3:138609323-138609345 GTCGCGAACAGGCCGGAGGAGGG - Intronic
962874588 3:139526214-139526236 GGTGGGAACAGGACTGGAGAAGG + Intronic
962898466 3:139736654-139736676 GTGGGGAGCAGGTCAGAAGGAGG + Intergenic
965666211 3:171096279-171096301 GAGGGGGAAAGGACTGAAGACGG - Intronic
966862223 3:184236854-184236876 GTGGGGAGAAGGCCTGGTGAGGG - Intronic
967324102 3:188221648-188221670 GTGGGAAACAAACCTGAAAAGGG - Intronic
968236213 3:197031223-197031245 GTGGGGAACAAGCCCAGAGAGGG - Intergenic
969459515 4:7321657-7321679 GTGGGCTCCAGGCCTAAAGAGGG + Intronic
971264024 4:25082436-25082458 AAGGAGAACAGGCCTGCAGAAGG + Intergenic
976602886 4:86954615-86954637 GTGGGGTAAAGGCCTGAGGTGGG + Intronic
977323479 4:95548060-95548082 GTGGGAAGCAGGCATGAAGCGGG + Intronic
981159758 4:141483949-141483971 GTGGGGAAGGGGACTGCAGAGGG - Intergenic
982810888 4:159824620-159824642 ATGGGGGACAGGGATGAAGATGG + Intergenic
983168945 4:164513704-164513726 GTAAGGCACAGGCCTGGAGAGGG + Intergenic
985782583 5:1878864-1878886 GTCGGGAACAGGCCTCATAATGG - Intronic
986004525 5:3656970-3656992 TTGGGGACCAGGCCTGAAGTCGG + Intergenic
986693272 5:10331353-10331375 GAGGGAAGGAGGCCTGAAGATGG - Intergenic
989463221 5:41725233-41725255 GTGGGGATCAGGTCAGGAGAAGG - Intergenic
989644055 5:43610135-43610157 CTGGGGTACAGGCCAGAAGGAGG + Intronic
992955283 5:81901780-81901802 GTGCAGAAGAGGCCTGCAGAGGG + Intergenic
997461260 5:134053941-134053963 GTGGGTTACAGGCCAGAGGAGGG + Intergenic
997612463 5:135224746-135224768 CCAGGGACCAGGCCTGAAGATGG - Intronic
997660414 5:135585137-135585159 GTGGGGGACAGCTCTAAAGATGG - Intergenic
997665229 5:135625223-135625245 GTGGGGAAGAGTCCTGCAGGAGG + Intergenic
998370112 5:141655477-141655499 GTGGGGAATGGGGGTGAAGAAGG + Intronic
1000565411 5:162841017-162841039 ATGGGGGACAAACCTGAAGAAGG + Intergenic
1001226419 5:169948223-169948245 GTGGGGAACAGTGCAGATGAAGG + Intronic
1001525497 5:172425780-172425802 GTGTGGAAACGGCTTGAAGAGGG + Intronic
1003443087 6:6161278-6161300 GTGGGCCACTGGCCTGAAGTGGG - Intronic
1003626528 6:7746383-7746405 GTGTGGAAGAGGCCTGAAATGGG + Intronic
1004165484 6:13253097-13253119 GTGGGGAAGAAGCCAGGAGACGG - Intronic
1006400254 6:33813464-33813486 GCTGGGCCCAGGCCTGAAGAGGG - Intergenic
1006443557 6:34066689-34066711 GAGAGGAACAGGACTGAAGAAGG + Intronic
1006640257 6:35485975-35485997 GTGGGGAAGGGGACTGAGGAGGG + Intronic
1006913287 6:37578227-37578249 GTGGAGCACAGACCTGAAGGAGG + Intergenic
1007387306 6:41528505-41528527 GTGGGGGTCAGGCCTGGAGCAGG + Intergenic
1007582970 6:42970109-42970131 GTGGGGAAAAGGAATGCAGATGG + Intronic
1010196849 6:73248172-73248194 GTGGGAGACAGACCTGAGGAGGG + Intronic
1011627105 6:89291559-89291581 GTGAGGAAAAGGCAAGAAGAAGG - Intronic
1013625132 6:111929299-111929321 GTGGGGAACATGGATGAAGCTGG - Intergenic
1014484749 6:121984976-121984998 GTCAGGGTCAGGCCTGAAGAGGG + Intergenic
1015318729 6:131847104-131847126 GTGGGAACGAGCCCTGAAGAGGG - Intronic
1016175999 6:141078134-141078156 GTGGCTGACAGACCTGAAGATGG + Intergenic
1016447946 6:144151886-144151908 GTGGGTAACAGCCCTTAGGAAGG + Intronic
1018023260 6:159782973-159782995 ATGGAGAACAGGGCTGAAAAGGG + Intronic
1019437553 7:1029837-1029859 CATGGGAACAGGCCTGGAGATGG - Intronic
1019727107 7:2609107-2609129 GTGGGTACCAGAGCTGAAGAAGG - Intronic
1024291434 7:47807412-47807434 GGGGAGAAGGGGCCTGAAGATGG + Intronic
1024392905 7:48835700-48835722 GTGGCGAGCAGCCTTGAAGAAGG + Intergenic
1026679864 7:72457681-72457703 GTGGGGGACAGTCCTGTGGAGGG - Intergenic
1026791113 7:73332548-73332570 GGGGGGATAAGGGCTGAAGAGGG + Intronic
1026945724 7:74314802-74314824 GTGGGGAAGAGGCCTGGGGGTGG + Intronic
1029535526 7:101155141-101155163 GTGGGGAGCAAGCAGGAAGACGG - Intronic
1029851338 7:103464685-103464707 GACGGAAACAAGCCTGAAGAAGG + Intergenic
1033241024 7:139680250-139680272 GTGGGAAACAGTCCTGCAGTCGG - Intronic
1033489621 7:141829503-141829525 GTATGGAACAGCCATGAAGATGG + Intergenic
1033653872 7:143361193-143361215 GTGGTGAACCGGACTGAGGAGGG + Intronic
1034138067 7:148789896-148789918 GAAGGGGACAGGCCTGCAGATGG + Intronic
1034266060 7:149781186-149781208 GTGAGAGACAGGACTGAAGATGG - Intergenic
1034276683 7:149826841-149826863 GTGGGGAGCAGGGATGAGGAAGG + Intergenic
1035637926 8:1161285-1161307 GTGTGGAACAGGCATGAACTAGG + Intergenic
1035834459 8:2733800-2733822 GTGGGGAATAGGCAGGAAAAAGG - Intergenic
1038022059 8:23558923-23558945 GTGGGGAGCAGGCCGGAGGCAGG - Intronic
1038247258 8:25870425-25870447 GTGGGGGACAGCCATGCAGATGG - Intronic
1039243364 8:35581228-35581250 GGAGGGAAGAGGCCTCAAGATGG - Intronic
1040083625 8:43314909-43314931 ATGGGGAAAAGGGCTAAAGATGG - Intergenic
1041105536 8:54440083-54440105 GTAGGAAACAGGGCTTAAGAAGG + Intergenic
1041508984 8:58633298-58633320 GTGGGGGAGAAGCCTGAAGGTGG - Intronic
1041731072 8:61063520-61063542 CTGGGGCACAGGCTTCAAGAAGG + Intronic
1041966042 8:63678206-63678228 GTCTGGGACAGGCCTGAACATGG - Intergenic
1047689872 8:127341095-127341117 GTGGGGAACAGGAGTTTAGAAGG + Intergenic
1047768315 8:128008495-128008517 GTAGGGAACAGGCATGAGAAGGG - Intergenic
1049387995 8:142353933-142353955 GTGGGGAAGAGGACTGAATTTGG - Intronic
1049470849 8:142774434-142774456 GAGGGCACCAGGCCTGAAGCTGG - Intronic
1051617633 9:19021411-19021433 ATGGGGCACAGACCTGAAGGTGG - Intronic
1053136073 9:35650889-35650911 GCGGGGTACGGGCCTGAGGAGGG - Exonic
1053692095 9:40591742-40591764 GTAGGAAACAGGCATAAAGAAGG + Intergenic
1055866847 9:80824599-80824621 GTGTGGAACTGGCCTAAGGATGG + Intergenic
1057475782 9:95399789-95399811 ATGGCTGACAGGCCTGAAGATGG + Intergenic
1058424839 9:104867223-104867245 GTGGGGAACAGGAGAGAGGAAGG + Intronic
1058785923 9:108386760-108386782 GTGGGTCCCAGGCATGAAGAGGG + Intergenic
1059808098 9:117826524-117826546 GTGGTAAAAAGGCCTGGAGATGG - Intergenic
1060055970 9:120413385-120413407 TTGGGGAGCAGGCCTGAGAAAGG - Intronic
1060142419 9:121221656-121221678 TGGGAAAACAGGCCTGAAGAGGG - Intronic
1060311123 9:122463776-122463798 GTGGCGGAGAGACCTGAAGAGGG - Intergenic
1060966591 9:127715304-127715326 GTGGGGAAGGGGCGCGAAGAAGG + Intronic
1061002173 9:127908589-127908611 GTGGGGAACAGGGCTGGGGTGGG + Intronic
1061512578 9:131069995-131070017 GGCTGGAACAGGCCTGAAGCTGG - Intronic
1061619682 9:131803785-131803807 TGGGGGAACAGGCCTGAAAGTGG - Intergenic
1061841150 9:133359280-133359302 GAGGGAAACAGCCCTGGAGATGG + Intronic
1190343594 X:49317267-49317289 GAGGTGAAAAGGCCTGAAGAAGG + Exonic
1190344684 X:49326794-49326816 GAGGTGAAAACGCCTGAAGAAGG + Exonic
1190345777 X:49336351-49336373 GAGGTGAAAACGCCTGAAGAAGG + Exonic
1190346881 X:49345901-49345923 GAGGTGAAAACGCCTGAAGAAGG + Exonic
1190348130 X:49536928-49536950 GAGGTGAAAACGCCTGAAGAAGG + Exonic
1190349231 X:49546484-49546506 GAGGTGAAAACGCCTGAAGAAGG + Exonic
1190350335 X:49556040-49556062 GAGGTGAAAACGCCTGAAGAAGG + Exonic
1190351437 X:49565599-49565621 GAGGTGAAAACGCCTGAAGAAGG + Exonic
1190352537 X:49575152-49575174 GAGGTGAAAACGCCTGAAGAAGG + Exonic
1190353638 X:49584700-49584722 GAGGTGAAAACGCCTGAAGAAGG + Exonic
1190354740 X:49594222-49594244 GAGGTGAAAACGCCTGAAGAAGG + Exonic
1190355845 X:49603772-49603794 GAGGTGAAAACGCCTGAAGAAGG + Exonic
1192250186 X:69406533-69406555 GGCGGGAACAGGCCTCGAGATGG + Intergenic
1197351803 X:125390624-125390646 GTGAGGAACAGGAAAGAAGAAGG + Intergenic
1197765624 X:130057783-130057805 GTGGGGAGCAGTCCTACAGAAGG - Exonic
1198019621 X:132645070-132645092 GTGGGGGAAAGGCTGGAAGAAGG - Intronic
1198050794 X:132951474-132951496 ATGAGGAACAGGCCAGAAAAAGG - Intronic
1199014896 X:142804083-142804105 GTGGCTAAAAGACCTGAAGATGG - Intergenic
1199636055 X:149812086-149812108 TTGGGAAACAGCCCTGAAGGTGG + Intergenic
1200148417 X:153939565-153939587 GTAGGGAACAGGGCAGAAGCTGG - Intronic
1200664638 Y:6005507-6005529 GGATGCAACAGGCCTGAAGAGGG + Intergenic
1200765503 Y:7077480-7077502 GTGGTGAGCAGTCCAGAAGATGG - Intronic
1201945435 Y:19505057-19505079 GTGGGGAACAGGGGTGAAGAAGG + Intergenic