ID: 949017980

View in Genome Browser
Species Human (GRCh38)
Location 2:241724338-241724360
Sequence TGCACCGAGGGTTTTGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 111}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949017973_949017980 2 Left 949017973 2:241724313-241724335 CCCACGCCGTGCGGCTGGGGGAT 0: 1
1: 0
2: 0
3: 2
4: 48
Right 949017980 2:241724338-241724360 TGCACCGAGGGTTTTGAGAAGGG 0: 1
1: 0
2: 0
3: 5
4: 111
949017976_949017980 -4 Left 949017976 2:241724319-241724341 CCGTGCGGCTGGGGGATGGTGCA 0: 1
1: 0
2: 1
3: 18
4: 218
Right 949017980 2:241724338-241724360 TGCACCGAGGGTTTTGAGAAGGG 0: 1
1: 0
2: 0
3: 5
4: 111
949017972_949017980 3 Left 949017972 2:241724312-241724334 CCCCACGCCGTGCGGCTGGGGGA 0: 1
1: 0
2: 0
3: 3
4: 85
Right 949017980 2:241724338-241724360 TGCACCGAGGGTTTTGAGAAGGG 0: 1
1: 0
2: 0
3: 5
4: 111
949017974_949017980 1 Left 949017974 2:241724314-241724336 CCACGCCGTGCGGCTGGGGGATG 0: 1
1: 0
2: 0
3: 7
4: 91
Right 949017980 2:241724338-241724360 TGCACCGAGGGTTTTGAGAAGGG 0: 1
1: 0
2: 0
3: 5
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949017980 Original CRISPR TGCACCGAGGGTTTTGAGAA GGG Intronic