ID: 949022693

View in Genome Browser
Species Human (GRCh38)
Location 2:241750373-241750395
Sequence CGGGCACCCCCCGCCCACCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 572
Summary {0: 1, 1: 1, 2: 4, 3: 46, 4: 520}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949022693_949022709 2 Left 949022693 2:241750373-241750395 CCCGGGTGGGCGGGGGGTGCCCG 0: 1
1: 1
2: 4
3: 46
4: 520
Right 949022709 2:241750398-241750420 CGGGCGGGTGGGGGGTCCCTGGG 0: 1
1: 0
2: 1
3: 17
4: 329
949022693_949022705 -6 Left 949022693 2:241750373-241750395 CCCGGGTGGGCGGGGGGTGCCCG 0: 1
1: 1
2: 4
3: 46
4: 520
Right 949022705 2:241750390-241750412 TGCCCGGGCGGGCGGGTGGGGGG 0: 1
1: 0
2: 8
3: 88
4: 765
949022693_949022701 -10 Left 949022693 2:241750373-241750395 CCCGGGTGGGCGGGGGGTGCCCG 0: 1
1: 1
2: 4
3: 46
4: 520
Right 949022701 2:241750386-241750408 GGGGTGCCCGGGCGGGCGGGTGG 0: 1
1: 0
2: 10
3: 403
4: 4344
949022693_949022711 12 Left 949022693 2:241750373-241750395 CCCGGGTGGGCGGGGGGTGCCCG 0: 1
1: 1
2: 4
3: 46
4: 520
Right 949022711 2:241750408-241750430 GGGGGTCCCTGGGCGGAGCATGG 0: 1
1: 0
2: 2
3: 35
4: 395
949022693_949022715 24 Left 949022693 2:241750373-241750395 CCCGGGTGGGCGGGGGGTGCCCG 0: 1
1: 1
2: 4
3: 46
4: 520
Right 949022715 2:241750420-241750442 GCGGAGCATGGAGTGGCCGTTGG 0: 1
1: 0
2: 1
3: 9
4: 115
949022693_949022702 -9 Left 949022693 2:241750373-241750395 CCCGGGTGGGCGGGGGGTGCCCG 0: 1
1: 1
2: 4
3: 46
4: 520
Right 949022702 2:241750387-241750409 GGGTGCCCGGGCGGGCGGGTGGG 0: 1
1: 0
2: 3
3: 48
4: 504
949022693_949022708 1 Left 949022693 2:241750373-241750395 CCCGGGTGGGCGGGGGGTGCCCG 0: 1
1: 1
2: 4
3: 46
4: 520
Right 949022708 2:241750397-241750419 GCGGGCGGGTGGGGGGTCCCTGG 0: 1
1: 1
2: 4
3: 67
4: 610
949022693_949022712 17 Left 949022693 2:241750373-241750395 CCCGGGTGGGCGGGGGGTGCCCG 0: 1
1: 1
2: 4
3: 46
4: 520
Right 949022712 2:241750413-241750435 TCCCTGGGCGGAGCATGGAGTGG 0: 1
1: 0
2: 2
3: 25
4: 235
949022693_949022703 -8 Left 949022693 2:241750373-241750395 CCCGGGTGGGCGGGGGGTGCCCG 0: 1
1: 1
2: 4
3: 46
4: 520
Right 949022703 2:241750388-241750410 GGTGCCCGGGCGGGCGGGTGGGG 0: 1
1: 0
2: 3
3: 69
4: 564
949022693_949022716 25 Left 949022693 2:241750373-241750395 CCCGGGTGGGCGGGGGGTGCCCG 0: 1
1: 1
2: 4
3: 46
4: 520
Right 949022716 2:241750421-241750443 CGGAGCATGGAGTGGCCGTTGGG 0: 1
1: 0
2: 0
3: 3
4: 62
949022693_949022710 5 Left 949022693 2:241750373-241750395 CCCGGGTGGGCGGGGGGTGCCCG 0: 1
1: 1
2: 4
3: 46
4: 520
Right 949022710 2:241750401-241750423 GCGGGTGGGGGGTCCCTGGGCGG 0: 1
1: 0
2: 5
3: 52
4: 529
949022693_949022704 -7 Left 949022693 2:241750373-241750395 CCCGGGTGGGCGGGGGGTGCCCG 0: 1
1: 1
2: 4
3: 46
4: 520
Right 949022704 2:241750389-241750411 GTGCCCGGGCGGGCGGGTGGGGG 0: 1
1: 0
2: 4
3: 82
4: 659

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949022693 Original CRISPR CGGGCACCCCCCGCCCACCC GGG (reversed) Intronic