ID: 949022702

View in Genome Browser
Species Human (GRCh38)
Location 2:241750387-241750409
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 556
Summary {0: 1, 1: 0, 2: 3, 3: 48, 4: 504}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949022679_949022702 29 Left 949022679 2:241750335-241750357 CCTTCTGCACGTCTGGACACATG 0: 1
1: 0
2: 1
3: 12
4: 112
Right 949022702 2:241750387-241750409 GGGTGCCCGGGCGGGCGGGTGGG 0: 1
1: 0
2: 3
3: 48
4: 504
949022692_949022702 -8 Left 949022692 2:241750372-241750394 CCCCGGGTGGGCGGGGGGTGCCC 0: 1
1: 0
2: 1
3: 32
4: 288
Right 949022702 2:241750387-241750409 GGGTGCCCGGGCGGGCGGGTGGG 0: 1
1: 0
2: 3
3: 48
4: 504
949022693_949022702 -9 Left 949022693 2:241750373-241750395 CCCGGGTGGGCGGGGGGTGCCCG 0: 1
1: 1
2: 4
3: 46
4: 520
Right 949022702 2:241750387-241750409 GGGTGCCCGGGCGGGCGGGTGGG 0: 1
1: 0
2: 3
3: 48
4: 504
949022694_949022702 -10 Left 949022694 2:241750374-241750396 CCGGGTGGGCGGGGGGTGCCCGG 0: 1
1: 0
2: 3
3: 37
4: 451
Right 949022702 2:241750387-241750409 GGGTGCCCGGGCGGGCGGGTGGG 0: 1
1: 0
2: 3
3: 48
4: 504

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type