ID: 949022706

View in Genome Browser
Species Human (GRCh38)
Location 2:241750392-241750414
Sequence GACCCCCCACCCGCCCGCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 638
Summary {0: 1, 1: 0, 2: 7, 3: 59, 4: 571}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949022706_949022715 5 Left 949022706 2:241750392-241750414 CCCGGGCGGGCGGGTGGGGGGTC 0: 1
1: 0
2: 7
3: 59
4: 571
Right 949022715 2:241750420-241750442 GCGGAGCATGGAGTGGCCGTTGG 0: 1
1: 0
2: 1
3: 9
4: 115
949022706_949022716 6 Left 949022706 2:241750392-241750414 CCCGGGCGGGCGGGTGGGGGGTC 0: 1
1: 0
2: 7
3: 59
4: 571
Right 949022716 2:241750421-241750443 CGGAGCATGGAGTGGCCGTTGGG 0: 1
1: 0
2: 0
3: 3
4: 62
949022706_949022711 -7 Left 949022706 2:241750392-241750414 CCCGGGCGGGCGGGTGGGGGGTC 0: 1
1: 0
2: 7
3: 59
4: 571
Right 949022711 2:241750408-241750430 GGGGGTCCCTGGGCGGAGCATGG 0: 1
1: 0
2: 2
3: 35
4: 395
949022706_949022712 -2 Left 949022706 2:241750392-241750414 CCCGGGCGGGCGGGTGGGGGGTC 0: 1
1: 0
2: 7
3: 59
4: 571
Right 949022712 2:241750413-241750435 TCCCTGGGCGGAGCATGGAGTGG 0: 1
1: 0
2: 2
3: 25
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949022706 Original CRISPR GACCCCCCACCCGCCCGCCC GGG (reversed) Intronic