ID: 949022707

View in Genome Browser
Species Human (GRCh38)
Location 2:241750393-241750415
Sequence GGACCCCCCACCCGCCCGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 557
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 522}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949022707_949022716 5 Left 949022707 2:241750393-241750415 CCGGGCGGGCGGGTGGGGGGTCC 0: 1
1: 0
2: 1
3: 33
4: 522
Right 949022716 2:241750421-241750443 CGGAGCATGGAGTGGCCGTTGGG 0: 1
1: 0
2: 0
3: 3
4: 62
949022707_949022715 4 Left 949022707 2:241750393-241750415 CCGGGCGGGCGGGTGGGGGGTCC 0: 1
1: 0
2: 1
3: 33
4: 522
Right 949022715 2:241750420-241750442 GCGGAGCATGGAGTGGCCGTTGG 0: 1
1: 0
2: 1
3: 9
4: 115
949022707_949022712 -3 Left 949022707 2:241750393-241750415 CCGGGCGGGCGGGTGGGGGGTCC 0: 1
1: 0
2: 1
3: 33
4: 522
Right 949022712 2:241750413-241750435 TCCCTGGGCGGAGCATGGAGTGG 0: 1
1: 0
2: 2
3: 25
4: 235
949022707_949022711 -8 Left 949022707 2:241750393-241750415 CCGGGCGGGCGGGTGGGGGGTCC 0: 1
1: 0
2: 1
3: 33
4: 522
Right 949022711 2:241750408-241750430 GGGGGTCCCTGGGCGGAGCATGG 0: 1
1: 0
2: 2
3: 35
4: 395

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949022707 Original CRISPR GGACCCCCCACCCGCCCGCC CGG (reversed) Intronic