ID: 949022710

View in Genome Browser
Species Human (GRCh38)
Location 2:241750401-241750423
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 587
Summary {0: 1, 1: 0, 2: 5, 3: 52, 4: 529}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949022694_949022710 4 Left 949022694 2:241750374-241750396 CCGGGTGGGCGGGGGGTGCCCGG 0: 1
1: 0
2: 3
3: 37
4: 451
Right 949022710 2:241750401-241750423 GCGGGTGGGGGGTCCCTGGGCGG 0: 1
1: 0
2: 5
3: 52
4: 529
949022693_949022710 5 Left 949022693 2:241750373-241750395 CCCGGGTGGGCGGGGGGTGCCCG 0: 1
1: 1
2: 4
3: 46
4: 520
Right 949022710 2:241750401-241750423 GCGGGTGGGGGGTCCCTGGGCGG 0: 1
1: 0
2: 5
3: 52
4: 529
949022692_949022710 6 Left 949022692 2:241750372-241750394 CCCCGGGTGGGCGGGGGGTGCCC 0: 1
1: 0
2: 1
3: 32
4: 288
Right 949022710 2:241750401-241750423 GCGGGTGGGGGGTCCCTGGGCGG 0: 1
1: 0
2: 5
3: 52
4: 529

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type