ID: 949022716

View in Genome Browser
Species Human (GRCh38)
Location 2:241750421-241750443
Sequence CGGAGCATGGAGTGGCCGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 62}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949022694_949022716 24 Left 949022694 2:241750374-241750396 CCGGGTGGGCGGGGGGTGCCCGG 0: 1
1: 0
2: 3
3: 37
4: 451
Right 949022716 2:241750421-241750443 CGGAGCATGGAGTGGCCGTTGGG 0: 1
1: 0
2: 0
3: 3
4: 62
949022693_949022716 25 Left 949022693 2:241750373-241750395 CCCGGGTGGGCGGGGGGTGCCCG 0: 1
1: 1
2: 4
3: 46
4: 520
Right 949022716 2:241750421-241750443 CGGAGCATGGAGTGGCCGTTGGG 0: 1
1: 0
2: 0
3: 3
4: 62
949022707_949022716 5 Left 949022707 2:241750393-241750415 CCGGGCGGGCGGGTGGGGGGTCC 0: 1
1: 0
2: 1
3: 33
4: 522
Right 949022716 2:241750421-241750443 CGGAGCATGGAGTGGCCGTTGGG 0: 1
1: 0
2: 0
3: 3
4: 62
949022692_949022716 26 Left 949022692 2:241750372-241750394 CCCCGGGTGGGCGGGGGGTGCCC 0: 1
1: 0
2: 1
3: 32
4: 288
Right 949022716 2:241750421-241750443 CGGAGCATGGAGTGGCCGTTGGG 0: 1
1: 0
2: 0
3: 3
4: 62
949022706_949022716 6 Left 949022706 2:241750392-241750414 CCCGGGCGGGCGGGTGGGGGGTC 0: 1
1: 0
2: 7
3: 59
4: 571
Right 949022716 2:241750421-241750443 CGGAGCATGGAGTGGCCGTTGGG 0: 1
1: 0
2: 0
3: 3
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949022716 Original CRISPR CGGAGCATGGAGTGGCCGTT GGG Intronic