ID: 949027355

View in Genome Browser
Species Human (GRCh38)
Location 2:241772813-241772835
Sequence GACCTAAACCCCGAGCGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949027355_949027360 27 Left 949027355 2:241772813-241772835 CCTGAGCGCTCGGGGTTTAGGTC No data
Right 949027360 2:241772863-241772885 ACCTGAAAAGGCCCTACCCTCGG No data
949027355_949027358 15 Left 949027355 2:241772813-241772835 CCTGAGCGCTCGGGGTTTAGGTC No data
Right 949027358 2:241772851-241772873 TGAGCACCTGTGACCTGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949027355 Original CRISPR GACCTAAACCCCGAGCGCTC AGG (reversed) Intergenic
No off target data available for this crispr