ID: 949027782

View in Genome Browser
Species Human (GRCh38)
Location 2:241774453-241774475
Sequence CCGGGTCCGGGGCTGCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 380
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 344}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949027782 Original CRISPR CCGGGTCCGGGGCTGCAGGA AGG (reversed) Intergenic
900082612 1:869895-869917 CCGGCTCCGGAGCCGCGGGAGGG - Intergenic
900152025 1:1182957-1182979 CCGGGTCTTGGCCTGCAGGGCGG - Exonic
900176087 1:1292053-1292075 CCGGGCGCGGGGCGGCTGGAGGG - Intergenic
900339170 1:2179734-2179756 CCGGGCCCAGGGCTGCTGGTGGG + Intronic
900438712 1:2643068-2643090 CCGGGTCCATGGCAGCAGGAGGG + Intronic
900471223 1:2855970-2855992 CAGGCTCCGGGCCTGCAGCAGGG + Intergenic
900473573 1:2866032-2866054 CTGGGTGCCAGGCTGCAGGATGG - Intergenic
900527178 1:3135030-3135052 CCGGGTCAGGGGCTTCTGGAAGG + Intronic
900527190 1:3135061-3135083 CCGGGTCAGGGGCTTCTGGAAGG + Intronic
900630652 1:3633429-3633451 CCCGGCCCGGGGCGGCGGGAAGG + Exonic
901006003 1:6171791-6171813 CCGGGTGAGGGGCTCCAGGGAGG + Intronic
901037907 1:6347299-6347321 CCGGATCTGGGGCTGCTGGAGGG - Intronic
901200260 1:7462959-7462981 CTGGGTCGGGGGCTCCTGGAGGG + Intronic
901443405 1:9292958-9292980 CCGGGGCCGGGGCCGCGGGGAGG + Exonic
901638274 1:10680310-10680332 CCGGCTCTGGGGGTGGAGGAAGG + Intronic
902514125 1:16980685-16980707 GCGGCTCCGGGGCTGGAGGGCGG - Exonic
902581856 1:17412905-17412927 CAGAGTCCGGGGGTACAGGAGGG - Intronic
903448444 1:23437099-23437121 CCGGGGCCGGGGCAGGAGGGAGG - Intronic
904446940 1:30581426-30581448 CAGGGTCGGGGGCTGGAGGAGGG - Intergenic
904591461 1:31617769-31617791 TAGGGGCCGGGACTGCAGGAGGG - Exonic
904618650 1:31763041-31763063 CCGGCCCTGGGGCTGCGGGAGGG + Intronic
905548577 1:38818392-38818414 CCGGGTCCGCGGCTGCGCGGCGG + Intergenic
905797853 1:40825574-40825596 CCAGGTCTGGGGCTGGAGGGAGG + Intronic
906118043 1:43368254-43368276 CCGGGCCCCGGGCTGCACGTCGG - Intergenic
906208111 1:43997674-43997696 CCCTGTCCGGTGCTCCAGGAGGG + Exonic
906214580 1:44031305-44031327 CTGGGCCGGGGGCTGCAGCATGG - Intronic
907407551 1:54262910-54262932 CAGGGTCCAGGGCAGCTGGAAGG - Intronic
909736488 1:78968735-78968757 TTGGGTCAGGGTCTGCAGGATGG + Intronic
910337797 1:86154775-86154797 TCGGGGCAGGAGCTGCAGGAGGG + Intronic
911175486 1:94813275-94813297 CTGGGTCAGGGTCTGCAGGTCGG + Intergenic
912764390 1:112395977-112395999 CTGGGTCCTGGGCTTCAGGGTGG - Intergenic
915246307 1:154558498-154558520 CCGGGGCCGGGGCAGCAGCTGGG - Exonic
915308287 1:154993603-154993625 CTGTGTCCGGGGCTGCATGTGGG - Exonic
915317478 1:155037291-155037313 CAGGGACTGGCGCTGCAGGAAGG - Intronic
915326191 1:155082307-155082329 CCGGGGCTGGGGGTGGAGGATGG + Intronic
915543312 1:156582297-156582319 CAGGGGCAGGGCCTGCAGGAAGG - Exonic
915815264 1:158959160-158959182 TTGGGTCAGGGTCTGCAGGATGG - Intronic
915828853 1:159106174-159106196 CTGGGTCCGGAGCTGCAGCTGGG + Intronic
916817629 1:168369020-168369042 CAGGATCCGGGGCTGAAGGAAGG + Intergenic
917631613 1:176896501-176896523 CCTGGTGAGGGGCTGGAGGAGGG - Intronic
920315763 1:205074714-205074736 CAGAGTCTGGGGCTGCAGGTCGG - Exonic
921183125 1:212646861-212646883 CTGGGTCCGGGGCCTCAGCATGG + Intergenic
922726170 1:227924039-227924061 CTGGGGGCGGGGCTGCAGCAGGG - Intronic
923141331 1:231163126-231163148 CGGGGATCGGGGCTGCAGGCGGG + Exonic
923631278 1:235650351-235650373 GCGGGGCCGGGGTTGCTGGAGGG + Intronic
924940929 1:248812126-248812148 GAGGGTGCGGGGCTGGAGGAGGG - Exonic
1064215247 10:13394777-13394799 CAGGGCCTGGGGCTGCAGAAGGG - Intergenic
1066602572 10:37124739-37124761 GTGGGTCCCCGGCTGCAGGAGGG + Intergenic
1066602689 10:37125310-37125332 GTGGGTCCCTGGCTGCAGGAGGG + Intergenic
1067239362 10:44477159-44477181 CCTGGTCCAGGGCTGCAGCTGGG + Intergenic
1067319607 10:45205522-45205544 TTGGGCCCTGGGCTGCAGGAGGG - Intergenic
1070003455 10:72399312-72399334 CAGGGTCGGGGGCTGGGGGAGGG + Intronic
1070592402 10:77810485-77810507 CCTGGCCTGGGGCTGCAGGGAGG - Intronic
1073125498 10:101146523-101146545 CCGGGTCTGGGGTCCCAGGAAGG - Intergenic
1073212652 10:101817855-101817877 CGGTGGCCGGGGCTGCAGGAGGG - Exonic
1074522750 10:114239889-114239911 CCGGGTACAGGGGTGGAGGAGGG + Intronic
1074532253 10:114305675-114305697 GAGGGGACGGGGCTGCAGGAGGG + Intronic
1074532347 10:114305977-114305999 GAGGGGTCGGGGCTGCAGGAGGG + Intronic
1074532381 10:114306139-114306161 GAGGGGACGGGGCTGCAGGACGG + Intronic
1074532394 10:114306175-114306197 GAGGGAGCGGGGCTGCAGGAGGG + Intronic
1075037428 10:119080846-119080868 CCGGGGCCTGGGCGGCAGCAGGG - Intergenic
1075589833 10:123683561-123683583 CCTGGTCCCGGGAGGCAGGAGGG - Intronic
1076140844 10:128077606-128077628 GCGGGCCTGGGGCTGCAGGGAGG - Exonic
1076499400 10:130924462-130924484 CTGGGTGAGGGGCTGCAGCAAGG + Intergenic
1076736617 10:132461974-132461996 CCGGGTGCAGGGCTGCAGGCTGG - Intergenic
1076857583 10:133124825-133124847 CCGGGGCCGGGGCCGGGGGAAGG - Intronic
1076880604 10:133237588-133237610 CGCGGGCCGAGGCTGCAGGAAGG - Exonic
1076890912 10:133282888-133282910 CCAGGGCAGGGGCTCCAGGAGGG + Intronic
1076991681 11:279129-279151 CCGGGTCCGGGGACGGGGGAGGG + Intronic
1077216561 11:1397568-1397590 CAGGGGCCTGGGCTGCAGGCTGG + Intronic
1077332569 11:1989908-1989930 CAGGGTCCGGGGTGGCAGCATGG - Intergenic
1077495552 11:2885009-2885031 CCGGGGCCGGGGCTGGAGCCAGG + Exonic
1078303217 11:10156035-10156057 CCGGGTCCAGAGCTGCAGCTGGG - Intronic
1080388372 11:31823560-31823582 CCGGGTCTGAGGCTGCTGGGTGG + Intronic
1080533424 11:33198686-33198708 CTGGGCCCGGGGCTTCATGAGGG - Intergenic
1081534538 11:43987429-43987451 CGGGGGACGGGGCTGCAGGGTGG + Intergenic
1083861650 11:65423220-65423242 GTGGGTGCAGGGCTGCAGGAGGG + Intergenic
1084269463 11:68021320-68021342 CAGGGCCCTGGGCTGCAGGGTGG + Intronic
1084295729 11:68212857-68212879 CCGGGCCCGCGGCCGCACGAGGG - Intronic
1084771127 11:71343553-71343575 CCGTGTCAGGGGCCGCAGGGAGG - Intergenic
1085051578 11:73382841-73382863 CCGAGTCTGGGGCTAGAGGAGGG - Intronic
1091769416 12:3141447-3141469 CAGGGCCCGGGGCAGGAGGAAGG - Intronic
1091800476 12:3321598-3321620 CTGTGTACGGGCCTGCAGGACGG - Intergenic
1091917506 12:4280501-4280523 CCGCCCCCAGGGCTGCAGGAAGG - Intronic
1092609159 12:10153775-10153797 CCGGAACCTGGGGTGCAGGATGG - Intergenic
1093435569 12:19130551-19130573 CGGGGTCCGGGGCTGCAGGGAGG - Intronic
1096807937 12:54151661-54151683 CCTGGTCCTGGGCAGCAGTATGG + Intergenic
1101705939 12:107221449-107221471 AGTGGTCCAGGGCTGCAGGAAGG + Intergenic
1101959418 12:109237451-109237473 CTGGGTCCTGGGCTGCATGCTGG + Intronic
1102024580 12:109706971-109706993 CCAGGTCTGGGGCTGCGGGAGGG + Intergenic
1103032003 12:117623372-117623394 CGGGGTGCGGGGCTGGGGGAGGG - Intronic
1104459620 12:128944938-128944960 GGGGGTCGGGGGCTGGAGGAGGG - Intronic
1104682534 12:130761496-130761518 CCTGGAACGGAGCTGCAGGAAGG + Intergenic
1104945776 12:132414338-132414360 GCGGGTCCCGGGCTGCAGGGAGG - Intergenic
1104977941 12:132560460-132560482 CGGGGTCCGGGGGTGGAGGCGGG + Intronic
1106032411 13:26015286-26015308 GCTGGTCCTGGGGTGCAGGATGG + Intronic
1106410490 13:29507990-29508012 CAGGGTCTGAGGCTGCAGCAGGG - Intergenic
1107549116 13:41458274-41458296 CCAGGGCCGGGGCTGCGGGCAGG - Exonic
1107804605 13:44142098-44142120 CCGGCTTCGGGCCTGGAGGAGGG + Intergenic
1108541595 13:51452044-51452066 CCGGGCACGGAGCTGCGGGACGG + Exonic
1113138748 13:107123035-107123057 CTGGGTCCATGGCAGCAGGAGGG - Intergenic
1113494502 13:110715893-110715915 TCGGGGCCGGGGCTGCAGTTCGG + Exonic
1113960372 13:114122605-114122627 CTGGGCCCGGGGGTGCAGGTGGG + Intronic
1114031413 14:18583838-18583860 CCGGCTCCGGAGCCGCGGGAGGG - Intergenic
1116864571 14:50021077-50021099 CCTGGGCAGGGGCTCCAGGAAGG + Intergenic
1118752660 14:68817965-68817987 CTGGATCCTGGACTGCAGGAGGG - Intergenic
1119540913 14:75437842-75437864 CCAGGTTGGGGGCTCCAGGAGGG - Intronic
1119601911 14:75982335-75982357 CCGGGACCGGGGGACCAGGAGGG - Intronic
1119851182 14:77867713-77867735 CAGGGTACAGGCCTGCAGGAGGG - Intronic
1121259659 14:92557033-92557055 GTGGTTACGGGGCTGCAGGAGGG - Intronic
1122295953 14:100705879-100705901 CCGGGCTCGGGGCTGCAGCAAGG + Intergenic
1122295966 14:100705929-100705951 CCGGGCTCGGGGCTGCAGCAAGG + Intergenic
1122295978 14:100705979-100706001 CTGGGCTCGGGGCTGCAGCAAGG + Intergenic
1122295991 14:100706029-100706051 CCGGGCTCGGGGCTGCAGCAAGG + Intergenic
1122296016 14:100706129-100706151 CCGGGCTCGGGGCTGCAGCAAGG + Intergenic
1125536160 15:40441871-40441893 CCGGGCCGGGGGCGGCAGGGGGG + Intronic
1128072198 15:64804737-64804759 CAGGGTCCAAGACTGCAGGAGGG + Intergenic
1129535593 15:76311415-76311437 CCGGGCACGGGGCTGCTGTAAGG - Exonic
1131067956 15:89446092-89446114 CCTGGACCAGGGCTGGAGGAAGG + Intergenic
1132105419 15:99059361-99059383 CCGCGCCTGGGGCTGCAGGGTGG - Intergenic
1132527835 16:426226-426248 CCGGCCCCGGGGCTGGAGGGAGG + Exonic
1132585775 16:705304-705326 CGGGGCGCGGGGCTGCGGGAAGG + Intronic
1132616722 16:844701-844723 CCAGGTCAGAGGCGGCAGGATGG - Intergenic
1132701894 16:1225539-1225561 CCGGGGCCAGGGCTGAGGGAGGG + Intergenic
1132736593 16:1389051-1389073 CCGGGGCCGGGGCCGGGGGAGGG - Intronic
1132744051 16:1429431-1429453 CAGTGTCCGGGGCTGCAGTCAGG - Intergenic
1135119603 16:19754156-19754178 CCAGGTCAGGAGCTGCAGGGTGG + Intronic
1135582673 16:23641509-23641531 CAGGATCCGGGGCTGAGGGAAGG + Exonic
1136144317 16:28307028-28307050 CTGGGGCTGGGGCTGCTGGAGGG - Intronic
1136278167 16:29191718-29191740 CTGGGTCCAGGGCTCCAGGTGGG + Intergenic
1139528132 16:67528929-67528951 CCGTTTCCGGGGCTGCAGGCCGG + Intronic
1139547457 16:67656426-67656448 CCTGGGCCAGGTCTGCAGGAAGG - Exonic
1140500922 16:75433040-75433062 CCGGTTCCCGCGCTGCAAGAGGG + Intronic
1140835737 16:78792066-78792088 CCTGGTGCGGGGGAGCAGGACGG + Intronic
1141456245 16:84144675-84144697 CCGGGTGAGAGGCTGCAGGGAGG + Intronic
1141698035 16:85629497-85629519 CCTGCTCCAGGGCCGCAGGAGGG - Intronic
1142029916 16:87833355-87833377 CCGGGTGTGGACCTGCAGGAAGG - Intronic
1142082544 16:88157758-88157780 CTGGGTCCAGGGCTCCAGGTGGG + Intergenic
1142247611 16:88977033-88977055 GCGGGCCTGGGGCTGCAGGCTGG + Exonic
1142559046 17:799117-799139 CGGTGGCCAGGGCTGCAGGAGGG + Intergenic
1142591164 17:1006737-1006759 CCGGGCCCGTGGCTGGCGGAGGG - Intronic
1142591184 17:1006802-1006824 CCGGGCCCGTGGCTGGCGGAGGG - Intronic
1142591204 17:1006867-1006889 CCGGGCCCGTGGCTGGCGGAGGG - Intronic
1142591224 17:1006932-1006954 CCGGGCCCGTGGCTGGCGGAGGG - Intronic
1142591244 17:1006997-1007019 CCGGGCCCGTGGCTGGCGGAGGG - Intronic
1142591264 17:1007062-1007084 CCGGGCCCGTGGCTGGCGGAGGG - Intronic
1142591284 17:1007127-1007149 CCGGGCCCGTGGCTGGCGGAGGG - Intronic
1142614243 17:1125563-1125585 CCCGCTCCGGGGCTGCTGGGAGG + Intronic
1143530545 17:7500700-7500722 CAGGGGCCGGGGCTTTAGGATGG - Exonic
1143617837 17:8064220-8064242 GCAGGGCCGGGGCTGCAGGAGGG + Intergenic
1144764248 17:17724254-17724276 CGGAGTCCGGGGCTGCAGGCTGG + Intronic
1146956001 17:36936669-36936691 CCGGGCCGGGGGATGCAGAATGG + Intergenic
1147155567 17:38543041-38543063 CCTGGTCAGAGGCTGCAGGGTGG - Intronic
1147330641 17:39697026-39697048 CCAGGTCCTGGGCTGGATGATGG + Intronic
1149491259 17:57086210-57086232 CCGGGCCCTGGGCCGCAGGCGGG - Intronic
1150692764 17:67378917-67378939 CCGGGGCCGCGGCTGCCGGCTGG + Intronic
1151460842 17:74253212-74253234 CTGGGCCGGGGGCTGCAGGCTGG - Exonic
1151970450 17:77454905-77454927 CCGACTCCGGGGCTGCGGGAAGG + Intronic
1152469732 17:80484036-80484058 CAGGGTGCCAGGCTGCAGGATGG + Intergenic
1152494940 17:80664446-80664468 CAGGGAGCGAGGCTGCAGGATGG - Intronic
1152580435 17:81163369-81163391 CCGGGTCCAGGCTGGCAGGAAGG - Intronic
1152628357 17:81398708-81398730 CCGGCTCCGGGACAGCAGGCCGG + Intronic
1152640065 17:81445582-81445604 CCAGGCCCGGGGCTGCTGGCAGG - Exonic
1152643889 17:81460117-81460139 CCCGCTCCTGGGCTGCAGGGCGG + Intronic
1152700792 17:81817964-81817986 CAGGGTCCGGGGTAGCAGCAGGG - Intergenic
1152737439 17:82004397-82004419 CCAGGTCCCGGCCTCCAGGAGGG - Intronic
1152742222 17:82023348-82023370 CGGGGGTCGGGGCTGCAGGCGGG + Exonic
1152809608 17:82375352-82375374 GCGGGCGCGGGGCTGCAGGGAGG - Exonic
1153597320 18:6740939-6740961 CTGGGTTCGGGGAAGCAGGAAGG + Intronic
1153608057 18:6854766-6854788 CCGGGTCCAGAGCTGCAGGTGGG - Intronic
1157537526 18:48470922-48470944 CCGGGGCTGGGGCTGGAGGCAGG + Intergenic
1157582405 18:48781263-48781285 CGGGGGCCGGGCCTGCAGAAGGG + Intronic
1158804664 18:60955917-60955939 CCAGGTCTGGGGCTGTAGGAGGG + Intergenic
1160111480 18:76036362-76036384 ACGGGTCGGGGGCTAGAGGAGGG + Intergenic
1160660523 19:296154-296176 CCTGGGTCTGGGCTGCAGGAAGG + Intergenic
1160698522 19:495778-495800 CCCGTTCCGGAGCTGCAGGCCGG - Intronic
1160775429 19:853103-853125 CCGGGGCCGGGGCTGCTGGCGGG + Intronic
1160779716 19:872421-872443 CCGGGCCCGCAGCTGTAGGAGGG - Intronic
1160859965 19:1233583-1233605 GAGGGCCCGGGGCTGCAGCAGGG - Exonic
1160863658 19:1248249-1248271 CCGGGCCTGGGGCGACAGGAAGG + Intergenic
1160907436 19:1458087-1458109 CCTGTTCGGGGGCTGGAGGATGG - Intronic
1160923047 19:1529507-1529529 CCCAGCCCGGGGCTGCAGGTGGG + Intronic
1161014370 19:1976331-1976353 CCGGGCTCAGGGCTGCAGGGAGG + Intronic
1161091041 19:2360201-2360223 CTGGGCCCGGGGCTGGAGGAAGG - Intergenic
1161105743 19:2443219-2443241 CGGGGCCTGGGGCTCCAGGAGGG - Intronic
1161471115 19:4457296-4457318 TCGGGGGCGGGGCCGCAGGAGGG - Intronic
1161977732 19:7615615-7615637 CGGGGTCCGGGGGTCCAGGTCGG + Exonic
1162228395 19:9243933-9243955 CAGGGACTGGGGCTGAAGGAGGG - Intergenic
1162257041 19:9498831-9498853 CCGGGGGCGGGGCTGGAGGTGGG + Intergenic
1162824764 19:13244668-13244690 CCAGGCCCGGGGCTAGAGGAGGG + Intronic
1163188159 19:15654076-15654098 CCAGGCCAGGGGCTGGAGGAAGG + Intronic
1163216731 19:15884772-15884794 CCAGGCCAGGGGCTGGAGGAAGG - Intronic
1163678832 19:18669211-18669233 CCCGGCCCGGGGCAGCAGGACGG - Exonic
1163777496 19:19226899-19226921 CCGGAGCCGGGGCTGCAAGGGGG + Exonic
1165080155 19:33302261-33302283 GCGGCTCCGGGGCGGCAGGTGGG + Exonic
1165432464 19:35780627-35780649 CCAGGTCCGGGCCTGAAGGCGGG + Exonic
1165860189 19:38905350-38905372 CCGGGGGCGGGGCTGAAGCAGGG - Exonic
1166871224 19:45872288-45872310 CCGGGTCCTGGGCTGGTGCACGG + Exonic
1166882988 19:45940319-45940341 CCGGGGCCGGGCCAGCCGGAGGG - Exonic
1167353915 19:48992113-48992135 CCAGGGCCTGGGCTCCAGGATGG - Intronic
1167648916 19:50719347-50719369 GCGGGGCCGGGGCCGCGGGAGGG - Intronic
1168078625 19:53993522-53993544 CCTGGTCTGGGGGTACAGGATGG - Intronic
1168281813 19:55309955-55309977 CGGGGTCCAGGGGTCCAGGAAGG - Intronic
925917231 2:8615410-8615432 CCGGGTCAGGGGATGGAGGGCGG + Intergenic
926799797 2:16650095-16650117 ACGTGTCAGGGGCTGCAGGTTGG - Intronic
928880649 2:36092653-36092675 CCCGCACCGGGGCTGCAGGGTGG - Intergenic
931671593 2:64653425-64653447 CCCGGACCGGGGCCGCGGGAGGG + Intronic
935147371 2:100405067-100405089 CCGGCTCTAGGGCTTCAGGAGGG + Intronic
936525236 2:113236770-113236792 CAGGCTCAGGGTCTGCAGGAAGG - Intronic
936556934 2:113503988-113504010 GCGGGTCCGGGGCCACAGGCTGG + Intergenic
937290662 2:120779807-120779829 CCTGGCCCGGGGAGGCAGGATGG - Intronic
937950898 2:127387549-127387571 CCAGGTCGGGGGCTGCCGCAGGG + Intronic
938124391 2:128661451-128661473 CCGGGGCAGAGGCTGCAGGTGGG - Intergenic
938422710 2:131156996-131157018 CCAGGCCCGGGCCTGCTGGATGG + Intronic
938496787 2:131801958-131801980 CCGGCTCCGGAGCCGCGGGAGGG + Intergenic
938942253 2:136179513-136179535 CCGAGTCCAGGCCTGCAGCAGGG + Intergenic
943367430 2:186979659-186979681 CAGGGTCAGGGACTGCAGGTGGG - Intergenic
946421568 2:219567944-219567966 CCGGGGCAGGCGCTTCAGGATGG + Exonic
946865671 2:224039343-224039365 CGGGGGCGGGGGCGGCAGGAAGG - Intergenic
947517132 2:230815588-230815610 CTGGGGCCGGGGGTGCAGGGTGG + Intronic
947708992 2:232299463-232299485 CTGGGGCAGGAGCTGCAGGATGG - Intronic
948019130 2:234715807-234715829 CCGGGTCCAGGGTTTGAGGAGGG + Intergenic
948393446 2:237627952-237627974 CTGGGCCCGGGGCTGGAGAACGG - Intronic
949027782 2:241774453-241774475 CCGGGTCCGGGGCTGCAGGAAGG - Intergenic
1168769730 20:407889-407911 CCGGAGCCGGGGCTGGAGGGCGG - Intronic
1168886857 20:1266285-1266307 CCGGGGCTGGGGCTGCCGGGAGG - Intronic
1169219223 20:3811877-3811899 CGGGGCCTGGGGCAGCAGGAAGG + Intergenic
1172848063 20:37941787-37941809 GCAGGACAGGGGCTGCAGGAAGG + Intronic
1172903383 20:38350901-38350923 CCGGGTCCAGGGCAGGTGGAAGG + Exonic
1173791919 20:45833725-45833747 CCGGGCCCTTGGCTCCAGGAGGG - Intronic
1174179568 20:48666251-48666273 CCGGGGGCTGGGCTGCAGGTGGG + Intronic
1174246932 20:49188404-49188426 CCGGGGCCGGGCCTGGAGGCGGG - Intergenic
1174368599 20:50071359-50071381 CCGAGGCTGGGGCTGGAGGAGGG - Intergenic
1174420344 20:50395416-50395438 CCTGGTCAGAGGCTGCTGGAAGG - Intergenic
1175229352 20:57463908-57463930 CAGGGACAGGGCCTGCAGGAAGG - Intergenic
1175916372 20:62427844-62427866 CTGGGTCGGGGGCTGCAGGTGGG + Intergenic
1175924851 20:62466587-62466609 CCGGGTGCGCGGCTGGAGCAGGG + Intronic
1176113783 20:63422414-63422436 CTGGGTCTGGGGCTTCTGGAAGG - Intronic
1176183900 20:63767562-63767584 CCGGGTCCCGGGCTCCAGCTGGG - Intronic
1176197557 20:63844412-63844434 CCAGGGGTGGGGCTGCAGGAAGG + Intergenic
1176217567 20:63955623-63955645 CAGTGCCCGGGGCTGCAAGAGGG - Intronic
1176455989 21:6911192-6911214 CCGAGGCCGTGGCTGCAGGCTGG + Intergenic
1176834163 21:13776240-13776262 CCGAGGCCGTGGCTGCAGGCTGG + Intergenic
1179656967 21:42851709-42851731 CCGTGGCTGCGGCTGCAGGAAGG - Intronic
1180000810 21:44994738-44994760 CCAGGTCCCGGCCTGCAGGGTGG + Intergenic
1180037212 21:45256137-45256159 GGGAGTCCAGGGCTGCAGGACGG + Intergenic
1180180669 21:46117471-46117493 CCTGGGCCGAGGCTGAAGGAGGG - Intronic
1180211484 21:46297591-46297613 CCGGGTCAGGGGCTGCAGCCGGG - Exonic
1180455526 22:15510895-15510917 CCGGCTCCGGAGCCGCGGGAGGG - Intergenic
1180514908 22:16131924-16131946 TTGGGTCCTTGGCTGCAGGAGGG + Intergenic
1181085542 22:20437832-20437854 CCGGGCGGGGGGCGGCAGGAGGG + Exonic
1182886282 22:33776914-33776936 CCAGGTCCAGGGCTGGAGAATGG + Intronic
1183300675 22:37057566-37057588 CCAAGGCTGGGGCTGCAGGAAGG - Intronic
1183366950 22:37411917-37411939 TTGGGGCAGGGGCTGCAGGAAGG - Intronic
1183486231 22:38089064-38089086 CCCGCCCCGGGGCGGCAGGAGGG - Intronic
1184188204 22:42878335-42878357 CAGTGCCTGGGGCTGCAGGAAGG + Intronic
1184276348 22:43411605-43411627 CCCGGTCCGGGGCTGGGGGCGGG + Intronic
1184298992 22:43543848-43543870 GCGGGACTGGGGCTGCCGGAGGG - Intronic
1184664224 22:45978836-45978858 CAGGGTCCCGGGCTCCGGGAGGG - Intergenic
1184833823 22:47008597-47008619 CCTGGTCCGTATCTGCAGGAAGG + Intronic
1184861863 22:47176866-47176888 CAGGGTCGTAGGCTGCAGGACGG + Intergenic
1184867972 22:47213700-47213722 CCTGGCCCGGGGCTGCAGACCGG - Intergenic
953033109 3:39190778-39190800 GTGGGTCAGGGGCAGCAGGAGGG - Intronic
953124433 3:40077856-40077878 CCCGCACCGGGGCTGCAGGTGGG + Intronic
953920734 3:46949536-46949558 CCCAGTCCAGGGCTGCAGGCTGG - Intronic
954293688 3:49662723-49662745 CCTGGTCCGTGGTTGCGGGAGGG + Intronic
954409736 3:50365239-50365261 CCGGGGGCGGGGCCGCAGGATGG - Intronic
954800350 3:53183593-53183615 CCCGCCCCTGGGCTGCAGGAGGG + Intronic
956060319 3:65342191-65342213 CTGTGTCCAGGGCTGCAGAAAGG + Intergenic
956605060 3:71065256-71065278 GCGGGGCCGGGGCTGCCGGCGGG + Intronic
959089331 3:101885597-101885619 CGGGGTAGGGGGCTGGAGGAGGG - Intergenic
966956332 3:184884213-184884235 GCGGGTCGGGGGCTGGGGGAGGG - Intronic
968043842 3:195612436-195612458 GCGGGGGCGGGGCTGGAGGAGGG + Intergenic
968503855 4:963099-963121 CCTGGTCCAGGGCAGCAGCAGGG - Intronic
968782427 4:2593207-2593229 CTTGGACCAGGGCTGCAGGAAGG - Intronic
968955634 4:3717457-3717479 CCTGGTCCAGGGCTGGTGGAGGG - Intergenic
969060731 4:4432339-4432361 CAGGGTCAGGGCATGCAGGATGG - Intronic
969322930 4:6424027-6424049 CAGGGTCCCCGGCTGGAGGAAGG + Intronic
969486350 4:7474496-7474518 CACGGTCCCTGGCTGCAGGAGGG + Intronic
969674823 4:8608699-8608721 CCTGGTCTGGGACTTCAGGAGGG + Intronic
972967942 4:44535517-44535539 CCTGGTCTGGGGCAGCAGGGGGG + Intergenic
973292436 4:48483673-48483695 CCGGGGCCGGCGCTGGAGGCAGG - Exonic
979536207 4:121823488-121823510 CCGGGTCCGCGGTTGTTGGACGG + Exonic
979624141 4:122827096-122827118 CCGGGGCCGGGGCCGGGGGACGG + Exonic
984274549 4:177594113-177594135 CAGAGTCAGGGGCTGCTGGATGG - Intergenic
985512852 5:321887-321909 CCGGGTGTGGGGCTGAGGGACGG + Intronic
985680312 5:1252700-1252722 CCGGATCCACGGCTGCAGGTGGG + Intergenic
985957745 5:3277296-3277318 CAGGGCCGGGGGCTGCAGGCTGG + Intergenic
991962066 5:72054945-72054967 CGGGGTGGGGGGCTGGAGGAGGG + Intergenic
994197170 5:96934836-96934858 CAGGGGCCGGGGCTGAGGGAGGG + Intronic
994210809 5:97085579-97085601 CGGGAACCGGGGCTGCAGGGTGG - Intergenic
995052730 5:107724759-107724781 CGGGGGCCGGGGCTGCGGGCAGG - Intergenic
999140425 5:149357953-149357975 CTGGGTCTGGCGCGGCAGGAAGG + Intergenic
1001561152 5:172669820-172669842 TCGGGGCCGGGGCCGCAGCACGG - Exonic
1002922216 6:1580852-1580874 GAGGGCCAGGGGCTGCAGGAAGG - Intergenic
1002929642 6:1624416-1624438 CGGGGCCCCGGGCTGCAGGGCGG - Intronic
1003218286 6:4135316-4135338 CCGGGCCCAGCGGTGCAGGAGGG + Intronic
1005514110 6:26538321-26538343 GCGCTTCCGGGGCTGCAGGCGGG - Intergenic
1005968714 6:30744462-30744484 CGGGGTCGGGGCCTGCAGGATGG + Exonic
1006026175 6:31148552-31148574 CCTGTTCCGGGGCTGCAGCCAGG - Intronic
1006456290 6:34133711-34133733 CAGTGGCCGGGGTTGCAGGAAGG + Exonic
1007399157 6:41593943-41593965 CAGGGTCCAGGGATGCAGGCAGG + Intronic
1007790391 6:44305187-44305209 CCGTGCCCGGTGCTGCAGGGTGG + Exonic
1009684179 6:66935739-66935761 CCAGGTCCGGAGCTGCAGCTGGG - Intergenic
1014018650 6:116564007-116564029 CCGGCTCCAGGGCTGCAGGTGGG - Intergenic
1017442644 6:154478061-154478083 CAGGCACCGGGGCTGCAGAATGG + Intronic
1017692497 6:156980736-156980758 CCGGGTTCCGGGCTGCTGCACGG - Intronic
1018724130 6:166597462-166597484 GCGGGTGCTGGGCTGCAGGGTGG + Intronic
1018876595 6:167827084-167827106 GCGGGGCCGGGGCCGGAGGACGG - Exonic
1019145390 6:169972451-169972473 CCCGTTCCCGGGCTGCAGAAGGG + Intergenic
1019443064 7:1057033-1057055 CCGGGTCCTGAGCTGCCGGGAGG + Intronic
1019578020 7:1746800-1746822 CCGGGTGAGTGGCTCCAGGATGG - Exonic
1019597326 7:1864171-1864193 CCGGGCCAGGGTCTCCAGGAGGG + Intronic
1019768915 7:2871180-2871202 CCGTGGCTGGGGCTGCAGGCAGG - Intergenic
1019909883 7:4093774-4093796 CCGGATCCTGGGCTGATGGATGG + Intronic
1022375352 7:29806826-29806848 CTGGGCCCGGGGCTGCAGCCCGG - Intronic
1023410224 7:39882831-39882853 TTGGGTCAGGGTCTGCAGGATGG + Intergenic
1023834666 7:44061112-44061134 GAGGGTCGGGGGATGCAGGAAGG - Exonic
1024997108 7:55280243-55280265 CTGGGTCTGGGTCTGCAGGAGGG - Intergenic
1025250625 7:57349070-57349092 CCCGGTCAGAGGCTGCTGGAAGG + Intergenic
1026559544 7:71436883-71436905 TTGGGTCAGGGTCTGCAGGATGG - Intronic
1028621610 7:92834118-92834140 CGGGGTCCAGGGGTGCCGGAGGG + Intronic
1029145573 7:98443463-98443485 CAGGGTCTGTGGCTGCAGGAAGG + Intergenic
1029535320 7:101154496-101154518 CCGAGCCGGAGGCTGCAGGATGG + Exonic
1029709245 7:102290576-102290598 GAGGGTCCAGGGCTGCAGAATGG - Intronic
1031604089 7:123748488-123748510 CCGGGGCCGGGGCTGGCGGGAGG + Intronic
1031707544 7:124999589-124999611 CTGGGTCAGGGTCTGCAGGTCGG + Intergenic
1032882916 7:136109045-136109067 GCGGATTGGGGGCTGCAGGAGGG - Intergenic
1034265258 7:149777627-149777649 CCCTGCCAGGGGCTGCAGGAGGG - Intergenic
1036759336 8:11496568-11496590 CTGTGGCAGGGGCTGCAGGACGG + Intronic
1037884432 8:22589012-22589034 CCGGGGACCGGGCAGCAGGAAGG - Intronic
1037988504 8:23304383-23304405 CCAGGCCCGGGGCTGAAGGAAGG + Intronic
1040469434 8:47724964-47724986 CCTGGTGCAGGGCTGTAGGAAGG + Intronic
1041552838 8:59119802-59119824 CCGGGGGCGGGGCTGCGGGGCGG - Intergenic
1041673769 8:60517441-60517463 CCGGGTCGGGGGCCGCAGACCGG - Intronic
1045299557 8:100899483-100899505 CAGAGTGCGGGGCTGCGGGAGGG - Intergenic
1049238599 8:141525252-141525274 CTGGGGCCGGGGCGGCGGGAAGG + Intergenic
1049415574 8:142493351-142493373 CAGGGGCGGGGGCAGCAGGACGG + Intronic
1049471770 8:142777894-142777916 GCTGGGCCTGGGCTGCAGGAGGG - Exonic
1049598051 8:143493438-143493460 CCAAGGCCGAGGCTGCAGGAGGG + Intronic
1049649985 8:143761310-143761332 CCGGGGCCGGAGCAGCAGGCAGG - Intergenic
1049651406 8:143771527-143771549 CCTGGCCCGGAGCTGCCGGAAGG - Intergenic
1049746588 8:144265716-144265738 CCGGGCCCCCTGCTGCAGGAGGG + Intronic
1049833066 8:144714255-144714277 CCGGGTCCAGTCCTGCAGGGGGG + Intergenic
1049896067 9:113313-113335 GCGGGTCCGGGGCCACAGGCTGG - Intergenic
1053166057 9:35844758-35844780 AAGGGTGAGGGGCTGCAGGAGGG - Intronic
1053206264 9:36188934-36188956 TCGGGTCCCTGGTTGCAGGATGG - Intergenic
1053602685 9:39626627-39626649 CTGGGTCAGGGTCTGCAGGTTGG + Intergenic
1053707337 9:40768568-40768590 TTGGGTCCCTGGCTGCAGGAGGG - Intergenic
1053860332 9:42380375-42380397 CTGGGTCAGGGTCTGCAGGTTGG + Intergenic
1054250853 9:62715808-62715830 CTGGGTCAGGGTCTGCAGGTTGG - Intergenic
1054417251 9:64889336-64889358 TTGGGTCCCTGGCTGCAGGAGGG - Intergenic
1054564958 9:66750321-66750343 CTGGGTCAGGGTCTGCAGGTTGG - Intergenic
1057139077 9:92716017-92716039 CCGGGTGCGGAGCTGTGGGAGGG + Intronic
1057367129 9:94433092-94433114 CCGTCTCAAGGGCTGCAGGAAGG - Intronic
1057489103 9:95508220-95508242 CCCGGTCCGGCGCGGCAGCACGG + Exonic
1057656207 9:96954978-96955000 CCGTCTCAAGGGCTGCAGGAAGG + Intronic
1060205689 9:121681499-121681521 CCCGGTTAGGGTCTGCAGGATGG + Intronic
1060236126 9:121863915-121863937 CCCAGTCCAGGGCTGCAGGAGGG + Intronic
1061394815 9:130338094-130338116 CCTGGGCGTGGGCTGCAGGAGGG - Intronic
1061422317 9:130479120-130479142 CTGGGTCCGGGGTGGCAGGAGGG - Intronic
1061444956 9:130632427-130632449 CCTGGTACAGGCCTGCAGGAGGG - Intronic
1061897248 9:133654918-133654940 CCGGGGCCGCGCCTGCAGAATGG - Intronic
1062004488 9:134232329-134232351 CAGGGCCCGGGGGAGCAGGAGGG - Intergenic
1062015239 9:134287957-134287979 CCGGGCCCAGGGTGGCAGGAAGG + Intergenic
1062084645 9:134642309-134642331 CGGGGCGCGGGGCTGCGGGATGG + Intronic
1062285536 9:135771032-135771054 TCGGGGCAGGGGCTGCACGAGGG + Exonic
1062318512 9:135979429-135979451 CCGGGGACGCGGCTGCAGGGAGG + Intergenic
1062388844 9:136326177-136326199 CCGGGGCCGTGGCTGCTGGCCGG - Intergenic
1062491452 9:136807082-136807104 CTGGGGCCCGGGCTGCAGGCGGG + Intronic
1062567368 9:137169232-137169254 GCGGGTCGGGGTCTGCAGGGCGG - Intronic
1062581059 9:137229448-137229470 CGGGGGCCTGGGCTGCAGGCTGG + Exonic
1062585494 9:137247611-137247633 CTGGGGCCAGGGCTGCAGGAGGG - Intronic
1185461280 X:333743-333765 CTGGGTCCGTGGCTCCGGGAGGG + Intergenic
1187154685 X:16712237-16712259 CCGGGGCTGGGGGTGCAGGGCGG + Intronic
1189137174 X:38561766-38561788 GCTGGGTCGGGGCTGCAGGATGG + Intronic
1190218059 X:48493262-48493284 CCGGGGCCTGGGCTGCAGACAGG - Intergenic
1191634842 X:63364157-63364179 CTGGGTCAGGGTCTGCAGGCCGG - Intergenic
1193086032 X:77448292-77448314 CCGGGACCGTGGCTGCAGCGCGG + Intronic
1200162551 X:154016902-154016924 CCGGGGCAGGGCCTGCAGCAAGG - Intronic