ID: 949028261

View in Genome Browser
Species Human (GRCh38)
Location 2:241776383-241776405
Sequence CAGGCTCAGGAGGAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2232
Summary {0: 1, 1: 5, 2: 26, 3: 265, 4: 1935}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949028253_949028261 16 Left 949028253 2:241776344-241776366 CCAAGATTTTAAAAAGTCAGATT 0: 1
1: 1
2: 6
3: 88
4: 609
Right 949028261 2:241776383-241776405 CAGGCTCAGGAGGAGGAGGAGGG 0: 1
1: 5
2: 26
3: 265
4: 1935
949028251_949028261 21 Left 949028251 2:241776339-241776361 CCAGCCCAAGATTTTAAAAAGTC 0: 1
1: 0
2: 2
3: 38
4: 280
Right 949028261 2:241776383-241776405 CAGGCTCAGGAGGAGGAGGAGGG 0: 1
1: 5
2: 26
3: 265
4: 1935
949028252_949028261 17 Left 949028252 2:241776343-241776365 CCCAAGATTTTAAAAAGTCAGAT 0: 1
1: 0
2: 7
3: 54
4: 629
Right 949028261 2:241776383-241776405 CAGGCTCAGGAGGAGGAGGAGGG 0: 1
1: 5
2: 26
3: 265
4: 1935

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949028261 Original CRISPR CAGGCTCAGGAGGAGGAGGA GGG Intergenic
Too many off-targets to display for this crispr