ID: 949030707

View in Genome Browser
Species Human (GRCh38)
Location 2:241795872-241795894
Sequence GGCCGCTGGGAGCCTCTTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 8, 3: 55, 4: 175}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949030695_949030707 28 Left 949030695 2:241795821-241795843 CCCTCTCGCTCTCCTCTCTGTGC 0: 1
1: 0
2: 3
3: 64
4: 743
Right 949030707 2:241795872-241795894 GGCCGCTGGGAGCCTCTTCAAGG 0: 1
1: 0
2: 8
3: 55
4: 175
949030694_949030707 29 Left 949030694 2:241795820-241795842 CCCCTCTCGCTCTCCTCTCTGTG 0: 1
1: 1
2: 10
3: 133
4: 885
Right 949030707 2:241795872-241795894 GGCCGCTGGGAGCCTCTTCAAGG 0: 1
1: 0
2: 8
3: 55
4: 175
949030699_949030707 16 Left 949030699 2:241795833-241795855 CCTCTCTGTGCCTGGGAATTCTA 0: 1
1: 0
2: 1
3: 32
4: 292
Right 949030707 2:241795872-241795894 GGCCGCTGGGAGCCTCTTCAAGG 0: 1
1: 0
2: 8
3: 55
4: 175
949030700_949030707 6 Left 949030700 2:241795843-241795865 CCTGGGAATTCTAGTGTTTACTG 0: 1
1: 0
2: 0
3: 8
4: 131
Right 949030707 2:241795872-241795894 GGCCGCTGGGAGCCTCTTCAAGG 0: 1
1: 0
2: 8
3: 55
4: 175
949030696_949030707 27 Left 949030696 2:241795822-241795844 CCTCTCGCTCTCCTCTCTGTGCC 0: 1
1: 0
2: 6
3: 77
4: 723
Right 949030707 2:241795872-241795894 GGCCGCTGGGAGCCTCTTCAAGG 0: 1
1: 0
2: 8
3: 55
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949030707 Original CRISPR GGCCGCTGGGAGCCTCTTCA AGG Intronic
900013302 1:133603-133625 GGCCGCTGGGAGCTGCTGCATGG + Intergenic
900043367 1:489590-489612 GGCCGCTGGGAGCTGCTGCATGG + Intergenic
900064804 1:724587-724609 GGCCGCTGGGAGCTGCTGCATGG + Intergenic
900505395 1:3027781-3027803 GTCTGTTGGGAGCCTCTTCCCGG - Intergenic
900539968 1:3197738-3197760 GGCCTCAGGGGGCCTCTCCAGGG - Intronic
900959114 1:5908141-5908163 GGACCCTGGCAGCATCTTCAGGG + Intronic
901000090 1:6144694-6144716 GGCCACTGGGAGGGTCTTTAGGG + Intronic
901853444 1:12029981-12030003 AACCGCTGGGAGGCTCCTCAGGG + Intronic
901862197 1:12081457-12081479 GGCTCCTGGGAGCCTCTCCAGGG - Intronic
902281927 1:15381169-15381191 GGCCGCTGGTGGCCGCTTTAAGG - Intronic
902742342 1:18447469-18447491 GACCGCTGTTGGCCTCTTCAGGG - Intergenic
903859026 1:26354178-26354200 GGCTGGTGGGAGCCTCCCCAGGG - Intergenic
904092568 1:27955645-27955667 GGCATCTGTGAGCCTCTTCTGGG + Intronic
904813465 1:33179227-33179249 GGCCTCTGGGAGCCTGCACAAGG - Intronic
906041314 1:42789727-42789749 GGTCCCTGGGAGCCTCTTCTGGG + Intronic
909021315 1:70434371-70434393 GGCCCCTGAGAGCCTCCTCCTGG - Intronic
909595832 1:77405476-77405498 GGCCCCAGCCAGCCTCTTCAAGG + Intronic
910061943 1:83104410-83104432 GTCAGCTGGTAGCCCCTTCAGGG + Intergenic
910839633 1:91548561-91548583 GGCCAGGGGAAGCCTCTTCAAGG - Intergenic
913424605 1:118713400-118713422 GTTCTCTGGGAGCCTCATCATGG - Intergenic
913969709 1:143405452-143405474 GGCAGCTGCGAGCCTCCTCATGG + Intergenic
914064082 1:144231045-144231067 GGCAGCTGCGAGCCTCCTCATGG + Intergenic
914115068 1:144735309-144735331 GGCAGCTGCGAGCCTCCTCATGG - Intergenic
915930448 1:160057615-160057637 GGCAGCTGGCAGCCTTCTCAAGG + Intronic
916197196 1:162235488-162235510 GGCCATGGGGAGCCTCGTCAAGG + Intronic
916268899 1:162919383-162919405 TGCCTCTGGGAGCCCCTCCAAGG + Intergenic
920700905 1:208217520-208217542 GGCCTGTGGGAGCCTCTACCAGG - Exonic
922099706 1:222470606-222470628 GGCCGCTGGGGGCCGCTGCATGG + Intergenic
922261741 1:223950101-223950123 GGCCGCTGGGAGCTGCTGCGTGG + Intergenic
922735340 1:227975644-227975666 GGCCGCTGGGAGCCGCTGCATGG - Intergenic
922912861 1:229232150-229232172 GGCAGGTGGGAGGCTCTCCAGGG + Intergenic
922977840 1:229799824-229799846 CGGCCCTGGGAGCCTCTTCATGG - Intergenic
924342906 1:243052275-243052297 GGCCGCTGGGAGCCGCTGCATGG + Intergenic
924780342 1:247141609-247141631 TGCCTCTGGGAGCCTCTCCATGG + Intronic
1063108417 10:3013919-3013941 GTCCAGTGGGAGCCTCCTCATGG - Intergenic
1066126247 10:32346328-32346350 GGCCGCTGGGTGGCGCTCCAGGG - Intronic
1066733578 10:38453279-38453301 GGCCGCTGGGAGCCACTGCATGG - Intergenic
1069906682 10:71736235-71736257 GGCCCCTGGGAGCCTCTCAGAGG - Intronic
1070611304 10:77934717-77934739 AGCCGCTGGGATCTTCTCCAGGG - Intergenic
1073640116 10:105243894-105243916 TGCAGCTGGGAGCCTCTGCAGGG + Intronic
1074863592 10:117532035-117532057 GGTGCCTGGGAGCCCCTTCAGGG + Intergenic
1075081762 10:119388873-119388895 GGCAGGAGGGAGCCTCTCCATGG + Intronic
1075354012 10:121754416-121754438 GGCCAGTAGGAGCCTTTTCAGGG - Intronic
1076969638 11:125807-125829 GGCCGCTGGGAGCTGCTGCATGG + Intergenic
1077467777 11:2741778-2741800 TGGGGCTGGGAGCCTCTTCCAGG + Intronic
1081647163 11:44798129-44798151 GGCCTCTCTGACCCTCTTCAGGG - Intronic
1081838228 11:46175436-46175458 GGCTGGTGGGAGCCTCTTTTGGG - Intergenic
1084837320 11:71812514-71812536 GGCCTCTTTGAGTCTCTTCAAGG + Intergenic
1085346331 11:75770367-75770389 AGCAGCTGGGTTCCTCTTCAAGG - Intronic
1085532875 11:77202195-77202217 GGACTCTGGGAGACTCTTCAGGG - Intronic
1085880774 11:80464032-80464054 TGCCTCTGGGAGCCTCTTCCTGG - Intergenic
1089004969 11:115083734-115083756 GGCTGCTGTGCGCCTCGTCAAGG - Intergenic
1089253083 11:117179078-117179100 GGACCCTGGGAGCCTCTTCGGGG + Exonic
1091473597 12:752307-752329 GGCTGATGGGAGCGTCATCACGG - Intergenic
1091675566 12:2486648-2486670 GGCCATTGGGAGCCCTTTCACGG + Intronic
1094324001 12:29216666-29216688 GGCTGCTGTTAGCCTTTTCAGGG + Intronic
1096178388 12:49538056-49538078 GGCTGCAGGGAGCCCCTTCCCGG - Intergenic
1101027298 12:100623598-100623620 GGAGGCTGGGATACTCTTCAAGG + Exonic
1101759328 12:107645973-107645995 GGCCCCTGGGAGCCTCCTGCTGG - Intronic
1102584391 12:113912867-113912889 GGTCGCTGTGAGCCTTCTCAGGG - Intronic
1102725521 12:115061078-115061100 TGCCTCTGGGAGCCTCTGCCAGG + Intergenic
1102956751 12:117063802-117063824 GGCCCCATGGAGACTCTTCAAGG + Intronic
1106415064 13:29539603-29539625 GGCCGCTGCGTACCTATTCAGGG - Intronic
1113929463 13:113958748-113958770 GTCCGCTAGGAGTCCCTTCATGG - Intergenic
1114007947 14:18333677-18333699 GGCGGCAGAGAGCCTCTCCATGG - Intergenic
1115262831 14:31471076-31471098 GGCTGCTGGGATCCTATTCTTGG + Intergenic
1117077680 14:52121152-52121174 GGCCAGTGGGAGCCCCTTAATGG + Intergenic
1117827663 14:59720335-59720357 GGCTGCTGGCAGCCTCATCCAGG + Intronic
1122439400 14:101719668-101719690 GGCCGTTGAGAGCTCCTTCAGGG - Intergenic
1122445141 14:101762151-101762173 GGCCGCTGGGACCTTCGTGATGG + Intronic
1124616901 15:31248618-31248640 GGCCTCTGAGGGCCTCTGCAGGG - Intergenic
1124700593 15:31908742-31908764 GACCGCTGGGAGCCCATTCTGGG - Intergenic
1125429582 15:39581362-39581384 AGCCGCTGGAGGACTCTTCAGGG + Intronic
1127338726 15:58018213-58018235 GTCCATTGGTAGCCTCTTCATGG - Intronic
1128509968 15:68307350-68307372 GGCGGCTGGGATCCTCCTCACGG + Exonic
1132763709 16:1523977-1523999 AGCCAGTGGGAGCCGCTTCAGGG - Intronic
1133171012 16:3982506-3982528 AGCCGCTGCGAGCCCCCTCAGGG + Intronic
1134002818 16:10795840-10795862 AGGCGCTGGGAGCCTCCTGATGG + Intronic
1135052575 16:19204581-19204603 GTCCACTGGAAGCCTCCTCAGGG - Intronic
1136068003 16:27771544-27771566 GGCCGTCGTGAGCTTCTTCATGG + Intronic
1139390983 16:66605963-66605985 GACCACTGGGAGCCACTTGAGGG + Intronic
1140663711 16:77211093-77211115 CTCTGCTGGGAGCCCCTTCATGG - Intronic
1141118278 16:81330398-81330420 GGCCTCTGGGAGTCCCTTCTGGG - Intronic
1142273786 16:89105102-89105124 GCCCTCAGGGAGGCTCTTCAGGG - Intronic
1142451040 16:90173315-90173337 GGCCGCTGGGAGCTGCTGCATGG - Intergenic
1142456523 17:60380-60402 GGCCGCTGGGAGCTGCTGCATGG + Intergenic
1143729783 17:8874522-8874544 GGTAGCTGGGAGCTTCTTCTAGG - Intergenic
1144461667 17:15463647-15463669 GGCAGCTGGGAGCAGCTTCATGG - Intronic
1144762260 17:17714006-17714028 GGCGGCTGGGACACTCTCCAGGG - Intronic
1148388725 17:47254634-47254656 GGCCCAAGGGAGCCTTTTCATGG - Intronic
1148896564 17:50842443-50842465 GGCCACTGGGAGCATCTTTGGGG + Intergenic
1149574504 17:57702182-57702204 GGCTGCTGGGAACCACTTCTGGG - Intergenic
1150148048 17:62786865-62786887 GGCATCTGGGTGCCTCTGCAGGG - Intronic
1150281771 17:63933047-63933069 AGCCACTGGGGGCTTCTTCAGGG + Intergenic
1151215689 17:72575107-72575129 GGCAGCTGGGAGCCGCATCAGGG + Intergenic
1151531867 17:74711730-74711752 GGCATCTGGGACCCTCTTCAGGG + Intronic
1151746541 17:76014646-76014668 GGCTGATGGGAGCCTCCTCCTGG + Intronic
1152268573 17:79310470-79310492 GGCCCATGGGAGCCTCTACTGGG - Intronic
1152381657 17:79945362-79945384 GGACGCTGGCAGCCGCTCCATGG + Intronic
1152810190 17:82378110-82378132 GGCTCCTGGGAGCCTCTGGAAGG - Intergenic
1154475216 18:14748418-14748440 GGCAGCTAAGAGCCTCTTCATGG - Exonic
1155199206 18:23503111-23503133 AGCCTCTGGGAGCTTCGTCAGGG - Intergenic
1160646443 19:195733-195755 GGCCGCTGGGAGCTGCTGCATGG + Intergenic
1161466514 19:4433553-4433575 GGCAGGTGGGGGCCTCTGCAGGG + Intronic
1161849107 19:6729824-6729846 GGGCACTGGGAGCCCCTTTAGGG + Intronic
1162034543 19:7932001-7932023 GGCCTCTGGAAGGCCCTTCATGG - Intronic
1162125610 19:8498248-8498270 GGCCGCTGGGCTCCACTTCCAGG - Exonic
1162931536 19:13960108-13960130 GGCCACTGGCAGACACTTCACGG + Intronic
1164639927 19:29817251-29817273 GGCAGCGGGGAGCCTCTGGATGG - Exonic
1165067803 19:33239250-33239272 GGCCGCTGGGAGCCACGGCAGGG - Intergenic
1166917269 19:46204066-46204088 GGCCTCAGGGAGCCTCTCCCAGG - Intergenic
1167502859 19:49857303-49857325 GGCCACTGGGCGGCTCTGCAGGG + Intronic
926356473 2:12045263-12045285 GGCCACTAGGAGCCTCTCCCTGG - Intergenic
927250123 2:20989476-20989498 GGCCTCTGGGAGCCTTTTTGGGG + Intergenic
928053685 2:28028453-28028475 GACCGCTGGGAGCCACTTAGAGG + Intronic
928110151 2:28500858-28500880 GGCCAGTGAGAGCCTCTTCAAGG + Intronic
932415795 2:71573269-71573291 GTCTGCTGGGTGCCCCTTCAGGG - Intronic
933587516 2:84195334-84195356 GGACCCTGGGAGCCTGTTCAGGG + Intergenic
934174403 2:89566363-89566385 GGCAGCTACGAGCCTCCTCATGG + Intergenic
934284719 2:91640713-91640735 GGCAGCTACGAGCCTCCTCATGG + Intergenic
936145910 2:109980548-109980570 GGAGGCTGGGGGCCACTTCATGG - Intergenic
936198780 2:110390930-110390952 GGAGGCTGGGGGCCACTTCATGG + Intergenic
938047947 2:128140058-128140080 ATCCGCTGAGAGCCTCTTCAAGG - Intronic
938528608 2:132161685-132161707 GGCGGCAGAGAGCCTCTCCATGG + Exonic
942181277 2:173383400-173383422 GGCAGGTGGGAGCAGCTTCAGGG + Intergenic
943115540 2:183665103-183665125 GGGCATTGAGAGCCTCTTCAGGG - Intergenic
944671714 2:201999599-201999621 GGTAGGTGGGAGGCTCTTCATGG + Intergenic
945271638 2:207946500-207946522 GATCGCTGGCAGCCTGTTCAAGG + Exonic
946408780 2:219506367-219506389 GGACAGTGAGAGCCTCTTCAAGG + Exonic
947500483 2:230667602-230667624 GGGCTCTGGGAGCCTGTCCAGGG + Intergenic
947774604 2:232697591-232697613 GGCCGGAGGGAGCCTCCTCCTGG + Intronic
947819388 2:233059789-233059811 GGCCGCTGGGAGTCTCTAAAGGG + Intergenic
948379369 2:237542068-237542090 GGCCCCTGGGGGCCACTGCAAGG + Intronic
949030707 2:241795872-241795894 GGCCGCTGGGAGCCTCTTCAAGG + Intronic
1168998244 20:2148141-2148163 GGAGGAAGGGAGCCTCTTCAGGG + Exonic
1169142808 20:3235739-3235761 GGCTGCAGGGAGCCACTGCAGGG - Intronic
1169146312 20:3254784-3254806 GGAGGCTGGGAGGCTCATCAAGG + Intronic
1169968223 20:11240600-11240622 AGCTGATGGGAGCATCTTCAAGG + Intergenic
1173410934 20:42808898-42808920 GGCAGCTGAGAGCCCCTGCAGGG - Intronic
1175390508 20:58624385-58624407 AGACTCTGGGAGGCTCTTCATGG + Intergenic
1176279067 20:64290483-64290505 GGCCGCTGGGAGCTGCTGCATGG - Intergenic
1179332307 21:40415743-40415765 GGCCGGTGGGACCCTCTTCGAGG + Intronic
1179634505 21:42698927-42698949 TGCCGCTGTGAGACTCTGCAAGG - Intronic
1180432454 22:15264487-15264509 GGCGGCAGAGAGCCTCTCCATGG - Intergenic
1180515027 22:16132467-16132489 GGCGGCAGAGAGCCTCTCCATGG - Intergenic
1181957996 22:26602127-26602149 GGCTGCTGGGGGACTCTCCAGGG + Intronic
1182484341 22:30630282-30630304 GGCAAGTGGGAGCCGCTTCATGG + Intergenic
1183308474 22:37096736-37096758 AGCCCCTGGGACCCTCTGCAGGG + Intronic
1184148616 22:42625783-42625805 GGCCTCAGGGATCCTCTCCAGGG - Intronic
1184155070 22:42662162-42662184 GGGCGCCGGGAGCCTTTTCCTGG - Intergenic
1184381312 22:44146707-44146729 GGCCTAGGGGAGCCTCCTCAGGG - Intronic
1184890639 22:47376901-47376923 TGCCCCCGGGAGCCCCTTCAGGG + Intergenic
950096673 3:10334724-10334746 GGCCACAGGGAGCCTGTTGATGG - Intronic
950148650 3:10669338-10669360 GTCTCCTGGGAGCCTCTTCCTGG + Intronic
952537210 3:34323492-34323514 GGGCTCTGGGATCCTCTTAAGGG - Intergenic
954367431 3:50154178-50154200 CGCCCCTGGGAGCCTCCGCAGGG + Intergenic
961322960 3:126090937-126090959 GTTCTCTGGGAGCCTCTGCATGG + Intronic
961523444 3:127481758-127481780 GAGAGCTGGGAGCCTCTGCAGGG - Intergenic
967130095 3:186462966-186462988 GGCCACTGGGAGCTTTTTCATGG - Intergenic
968371238 3:198223793-198223815 GGCCGCTGGGAGCTGCTGCATGG - Intergenic
969086480 4:4660255-4660277 GGCAGCAGGGAGCCACTTCAGGG + Intergenic
969564454 4:7969788-7969810 GGCGGCTGAGGGCCTCTTCCTGG - Intronic
969778729 4:9380005-9380027 GGCCTCTGTGAGTCTCTTCAAGG + Intergenic
969828256 4:9775306-9775328 GGCAGCTGCGAGCCTCCTCATGG + Intronic
969869357 4:10095058-10095080 GGCCACAGGGGGCCTCTGCAGGG + Intronic
976401471 4:84611839-84611861 GGGAGCTGGGGGCCTCTTCCTGG - Intronic
979259927 4:118636266-118636288 GGCCACTGGGAGCCGCTGCATGG - Intergenic
979328457 4:119404360-119404382 GGCCACTGGGAGCCGCTGCATGG + Intergenic
980106996 4:128597673-128597695 AGCAGCTGGGATCTTCTTCAAGG + Intergenic
982154811 4:152508136-152508158 GGCCCCATGAAGCCTCTTCAAGG - Intronic
983939587 4:173525713-173525735 GGCCGCTGGGACTTTCTTCTGGG + Intronic
983940493 4:173530675-173530697 GGGCGCCGGGAGCCTCGTGACGG + Intergenic
985643864 5:1076009-1076031 GGACACTGGGTGCCTCTACAAGG - Intronic
987348175 5:16997283-16997305 GCCCGCAGGGAGACTCCTCATGG + Intergenic
988780131 5:34513043-34513065 GGCTGCTGAGCCCCTCTTCATGG - Intergenic
989285233 5:39691707-39691729 TGCCGCTGTCAGCCACTTCAAGG - Intergenic
991728479 5:69560303-69560325 GGCGGCTGGGAGCGTTTTCGTGG + Exonic
991804910 5:70415450-70415472 GGCGGCTGGGAGCGTTTTCGTGG + Intergenic
991866474 5:71067572-71067594 GGCGGCTGGGAGCGTTTTCGTGG - Exonic
997242232 5:132315778-132315800 GTGCTCTGGGAGCCTCTTCATGG + Intronic
999316299 5:150586130-150586152 GGCCGAGGGGAGCCTCTGCCTGG - Intergenic
999702685 5:154242560-154242582 GGCCACTGGGACCCTCTCCAGGG - Intronic
1000120265 5:158190711-158190733 GGCCAGTGGAACCCTCTTCAAGG + Intergenic
1000291875 5:159878300-159878322 GGCAGCTGGGATCCAGTTCAAGG + Intergenic
1002613765 5:180437618-180437640 GGCCCCTGGGAGCCAGGTCAAGG - Intergenic
1002730476 5:181329339-181329361 GGCCGCTGGGAGCTGCTGCATGG - Intergenic
1002754054 6:144765-144787 GGCCGCTGGGAGCTGCTGCATGG + Intergenic
1007735552 6:43980209-43980231 GGGCGCAGGGAGGCTCTTCAGGG - Intergenic
1007741273 6:44011026-44011048 GGAAGCTGGGAGGCTCTCCATGG - Intergenic
1007925780 6:45648458-45648480 GGCCGCTGGGAGAGGCTTCCTGG - Intronic
1010221512 6:73452348-73452370 GGCCGCGGCCAGCCTCTTCGCGG - Intergenic
1014747669 6:125219064-125219086 GGCCGGTGGGAGTTTCTCCAGGG + Intronic
1017962576 6:159234154-159234176 CGCCGATGGGAGCCTCGCCAAGG + Exonic
1018692358 6:166357607-166357629 GGCCACTGGGAGCCCTTTAATGG - Intergenic
1019333787 7:473193-473215 GGCTCCTGGGAGCATCTTCCCGG - Intergenic
1022103818 7:27184629-27184651 GGCCGCCGGGGGCCCCTTCTCGG + Exonic
1022303231 7:29121252-29121274 GGCTAATGGGAGACTCTTCAAGG + Intronic
1022816770 7:33921652-33921674 GGCTGCTGCCAGTCTCTTCATGG + Intronic
1023401646 7:39795890-39795912 GGCTGCTGGGAGCCGCTGCCTGG - Intergenic
1024075623 7:45816512-45816534 GGCCGCTGGGAGCCGCTGCATGG - Intergenic
1024647973 7:51384785-51384807 GGCTGCTGGGAGCCGCTGCATGG + Intergenic
1025051830 7:55739284-55739306 GGCCGCTGGGAGCCGCTGCATGG + Intergenic
1025128785 7:56364952-56364974 GGCCGCTGGGAGCCGCTGCATGG + Intergenic
1025177165 7:56807830-56807852 GGCCGCTGGGAGCCGCTGCATGG + Intergenic
1025694627 7:63768556-63768578 GGCCGCTGGGAGCCGCTGCATGG - Intergenic
1029305533 7:99617012-99617034 GGCGGGTGAGAGCCTCTTCAGGG + Exonic
1029636020 7:101784305-101784327 GCCCGCTGGGAGTCACTCCATGG + Intergenic
1032052150 7:128656259-128656281 GGCCGCTGGGAGCTGCTGCATGG - Intergenic
1032329268 7:130962516-130962538 GGCTGGTGGGAGACTCTCCAGGG + Intergenic
1032911607 7:136438264-136438286 GGCCAATGGTAACCTCTTCAGGG - Intergenic
1033174013 7:139108859-139108881 CCCCTCTGGGAGCCTCTGCAGGG - Intronic
1036276177 8:7353978-7354000 GGCCTCTGTGAGTCTCTTCAAGG + Intergenic
1036345172 8:7956369-7956391 AGCCTCTGTGAGTCTCTTCAAGG - Intergenic
1036840503 8:12117136-12117158 GGCCTCTGTGAGTCTCTTCAAGG - Intergenic
1036862303 8:12363381-12363403 AGCCTCTGTGAGTCTCTTCAAGG - Intergenic
1042785257 8:72538091-72538113 GGCTGCTGGGAAGCTTTTCAGGG - Intronic
1048534239 8:135277544-135277566 GGCCAGTGGGAGCCTCTGGAAGG + Intergenic
1049088065 8:140493393-140493415 GGCCCCTCGGCGACTCTTCAGGG - Intergenic
1050331343 9:4549474-4549496 AGGCCCTGGGAGCCCCTTCAGGG - Intronic
1051641908 9:19231081-19231103 CGACGCGGGGAGGCTCTTCAGGG - Intronic
1053475968 9:38382243-38382265 GGCCCCTTGGAGCTTCCTCAGGG + Intergenic
1053707222 9:40768025-40768047 GGCGGCAGAGAGCCTCTCCATGG + Intergenic
1054417135 9:64888793-64888815 GGCGGCAGAGAGCCTCTCCATGG + Intergenic
1055117299 9:72619164-72619186 GGACACTGGGGGCCTCTTCATGG - Intronic
1056825747 9:89875213-89875235 GGCCTCGGGGAGCCGCTGCATGG - Intergenic
1056944733 9:90984617-90984639 AGCTGCAGGGAGCCACTTCATGG - Intergenic
1057054340 9:91949597-91949619 GGCGGCTGGGAGCCTCTCGGTGG - Intronic
1059219669 9:112602699-112602721 GGCCGCTGGAAGCTTCTCCCAGG - Intronic
1059639781 9:116205208-116205230 GGGATGTGGGAGCCTCTTCATGG - Intronic
1060827464 9:126695220-126695242 GGCCGCTGGGAGCCGCTGGAGGG - Intronic
1062754887 9:138281849-138281871 GGCCGCTGGGAGCTGCTGCATGG - Intergenic
1203578795 Un_KI270745v1:26018-26040 GGCCGCTGGGAGCTGCTGCATGG - Intergenic
1186674283 X:11799656-11799678 GAGCACTGGGGGCCTCTTCAAGG - Intergenic
1187910706 X:24108903-24108925 GGCCAGTGGGAGCCCCTTCAAGG + Intergenic
1198339301 X:135698700-135698722 GGCCCCTGAGAGCCCCTTTATGG - Intergenic
1201780937 Y:17722116-17722138 GGCAGCTGAGAACCCCTTCAGGG + Intergenic
1201820616 Y:18183874-18183896 GGCAGCTGAGAACCCCTTCAGGG - Intergenic
1202381420 Y:24278636-24278658 GGCCGCTGGGAGCTGCTGCATGG - Intergenic
1202489365 Y:25391490-25391512 GGCCGCTGGGAGCTGCTGCATGG + Intergenic