ID: 949032328

View in Genome Browser
Species Human (GRCh38)
Location 2:241802951-241802973
Sequence CTGTGCCAGGGGCCCGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 275}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949032316_949032328 14 Left 949032316 2:241802914-241802936 CCTGGCCTGTGGGCAGCTGGTGG 0: 1
1: 0
2: 4
3: 52
4: 518
Right 949032328 2:241802951-241802973 CTGTGCCAGGGGCCCGTGGAGGG 0: 1
1: 0
2: 1
3: 26
4: 275
949032315_949032328 15 Left 949032315 2:241802913-241802935 CCCTGGCCTGTGGGCAGCTGGTG 0: 1
1: 0
2: 5
3: 39
4: 424
Right 949032328 2:241802951-241802973 CTGTGCCAGGGGCCCGTGGAGGG 0: 1
1: 0
2: 1
3: 26
4: 275
949032318_949032328 9 Left 949032318 2:241802919-241802941 CCTGTGGGCAGCTGGTGGAGTGC 0: 1
1: 0
2: 1
3: 12
4: 180
Right 949032328 2:241802951-241802973 CTGTGCCAGGGGCCCGTGGAGGG 0: 1
1: 0
2: 1
3: 26
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949032328 Original CRISPR CTGTGCCAGGGGCCCGTGGA GGG Intronic
900237121 1:1598203-1598225 CAGTGCCAGGGGCTCCAGGAGGG + Exonic
900264194 1:1749190-1749212 CTGTGCCAAGGCCCCATGGGTGG + Intergenic
900294790 1:1943446-1943468 CTGTGCCTGGGGCCGGTGCCCGG + Intronic
900323448 1:2095968-2095990 CTGTGCCAGGGGCCAGGGCAGGG + Intronic
900363163 1:2299656-2299678 TTGTGCCAGGGGCCTGGGGAAGG + Intronic
900635066 1:3659223-3659245 CTGAGCCTGGGGGCCGTGGCGGG + Intronic
900933237 1:5749440-5749462 CAGGGCCAGGAGCCCCTGGAAGG - Intergenic
901207985 1:7508239-7508261 CTGTGACAGGGGTCTGTGGAGGG - Intronic
901512091 1:9722505-9722527 CTGTGCCACCGGCCGGTGGGAGG - Intronic
901666142 1:10827502-10827524 AGGTGGCAGGGGCCCGTGGTTGG - Intergenic
902369107 1:15994225-15994247 CAGTGCCAGGGTCCCCTGCATGG - Intergenic
903259621 1:22124265-22124287 CTGGGCCAGGGGCCAGGGTAAGG + Intronic
904293246 1:29501006-29501028 GTGTTCCAGGAGCCCCTGGAAGG - Intergenic
904538101 1:31214759-31214781 CTGTGCAAAGGTCCTGTGGAGGG + Intronic
904971449 1:34422207-34422229 CTGTTCCAGGTTCCAGTGGAAGG + Intergenic
905513484 1:38542998-38543020 TTGTGCCATGTGCCTGTGGAAGG + Intergenic
905851354 1:41277418-41277440 CTGGGGCAGGGGCCCGTGGGTGG + Intergenic
906033761 1:42738638-42738660 CGGTGCCTGGGGTCGGTGGAAGG + Intronic
906101897 1:43269319-43269341 CTGTGTAAGGGGCCCATGGAGGG - Intronic
906126808 1:43431945-43431967 CTGTGCCTGGGGCCCAGGGAAGG - Intronic
906792150 1:48668483-48668505 CTGGGGCTGGGGCCTGTGGAAGG - Intronic
908331419 1:63074520-63074542 CTCTGCCAAGGGCCCGCTGATGG + Intergenic
909183058 1:72449731-72449753 CAGTGCCAGTGGCCCCAGGAAGG - Intergenic
912068673 1:105779747-105779769 CTCTACTAGGGGACCGTGGAAGG + Intergenic
912333829 1:108844470-108844492 CTTTGCCAAGGCCCAGTGGAAGG + Intronic
914854778 1:151343019-151343041 GTGAGCGAGGGGCCCGGGGAAGG + Exonic
915312523 1:155011630-155011652 CTGTGCCAGGGAACCGGGCAAGG - Intronic
916022699 1:160807952-160807974 CTCTGCCTGGGGCCTGAGGATGG - Intronic
917469181 1:175311672-175311694 AGGGGCCAGGGGCCAGTGGAAGG - Intergenic
919640224 1:200039230-200039252 CTGAGCCAGAGGGCGGTGGAGGG + Intronic
919880201 1:201896003-201896025 CTGTGCTAGGGACCAGGGGAGGG - Intergenic
920046611 1:203136814-203136836 CTGTACCAGGGCCCGGTGTAGGG - Intronic
921081096 1:211738863-211738885 CTGTGGCAGGAGCCCCTGGAAGG + Intergenic
921365837 1:214372783-214372805 GTGTGGCAGGGGCCCCTGGGTGG + Exonic
922465718 1:225844738-225844760 GTGCCCCAGGGGCCCTTGGATGG + Intronic
922466340 1:225847635-225847657 CTGTGCCTGGGGTCAGTGGCTGG - Intronic
922704436 1:227781614-227781636 CTGTGGCAGGCGGCCGTGCAGGG - Intergenic
922959962 1:229637921-229637943 CAGTGCCGGGGGCCCGGGGCTGG + Exonic
924274364 1:242370492-242370514 CTGAGCCAGGGGCCAGGGGAGGG + Intronic
1063239157 10:4150658-4150680 CTATGCTGGTGGCCCGTGGAAGG - Intergenic
1065164169 10:22957405-22957427 CTGTGCGAGGGGTCAGTGGAAGG + Intronic
1067032312 10:42886034-42886056 TTGGGCCAGGGGCCCGTGTGAGG + Intergenic
1067054700 10:43043875-43043897 CTGTCCCAGGGGGCCGGAGAGGG + Intergenic
1067092224 10:43273669-43273691 CTGTGCAAGGGGGCGGTGGGTGG + Intergenic
1069583171 10:69578744-69578766 CTGGGACAGGGGCCGCTGGACGG + Intergenic
1069658042 10:70104964-70104986 CTGTGGCAGGGGGTCGGGGAGGG + Intronic
1070845780 10:79521875-79521897 CTTGGCCAGGGGCCCTTGGCAGG + Intergenic
1070928013 10:80238443-80238465 CTTGGCCAGGGGCCCTTGGCAGG - Intergenic
1072724192 10:97801532-97801554 GTGTGCCAGGAGCCCGAGGGAGG + Intergenic
1074134978 10:110618223-110618245 CTGTGGCAGGGGCCTGAGGAGGG + Intergenic
1074145127 10:110710759-110710781 CTGTGCCAGGAGCCCAGGGCAGG - Intronic
1074868089 10:117556395-117556417 CTGTGCCTGGGTCCCTAGGAAGG + Intergenic
1074913929 10:117937950-117937972 CTGGGCCAGGGGGCCGGGCAGGG - Intergenic
1075057742 10:119232541-119232563 TTGTGGGAGGGGCCCGTGGGAGG + Intronic
1075077157 10:119359179-119359201 CTGTGCCAGAGGCCAGGGGTGGG + Intronic
1076140329 10:128073365-128073387 GTGTGCCAGTGGCCCCTGGGTGG - Exonic
1076659419 10:132045418-132045440 CTGTGCCAGGTGCGGGTAGAGGG - Intergenic
1076930720 10:133530001-133530023 CTGTGCCTTGGACCCGTGGGTGG - Intronic
1077033074 11:478955-478977 CTCTCCCAGGGGCCTGTGAAGGG + Intronic
1077133699 11:987921-987943 GTGTGCAAGGGGCTCGTGGTGGG + Intronic
1077213254 11:1383132-1383154 CTGGGCCGAGGGCCCGTGGGGGG - Intergenic
1077304951 11:1864829-1864851 CTGTGCCAGGTGCCAGAGGGAGG + Intronic
1078063439 11:8062439-8062461 CGCTGTCAGGGGCCTGTGGAGGG + Intronic
1078929291 11:15901133-15901155 CTGGGGCAGGGGCCTGGGGAAGG - Intergenic
1079144618 11:17839692-17839714 CTGTGGCATGTGCGCGTGGATGG - Intronic
1079298141 11:19253308-19253330 CTGGGCCAGGGGCCAGCGGCAGG - Intergenic
1083203397 11:61133184-61133206 CTGCAGCAGGGGCCCTTGGAAGG - Intronic
1084033575 11:66494823-66494845 CAGTGCCAGGAGCCCGTGGTGGG + Intronic
1084311146 11:68317058-68317080 CTGTGCCAGGCCGCCCTGGAGGG + Intronic
1084393914 11:68896589-68896611 CTTTGCCAGCCGCCAGTGGAAGG - Exonic
1084440672 11:69171010-69171032 ATGGGCCAGGGGCCAGCGGAAGG + Intergenic
1084676079 11:70635542-70635564 GGGTGCCAGGGGCCGGGGGAGGG + Intronic
1085122075 11:73973690-73973712 CTGGGGCAGGGGCAGGTGGAGGG + Intergenic
1085509711 11:77082114-77082136 CTGTCCCAGGGGCACCAGGATGG + Intronic
1088494687 11:110421219-110421241 CTGTTGCAGGGGCTTGTGGAGGG - Intergenic
1088799140 11:113289583-113289605 CTGTGCCAGGGTCACAAGGAGGG - Intergenic
1089255827 11:117193447-117193469 CTGTTTCAAGGGCCCTTGGAAGG - Intronic
1089257211 11:117200297-117200319 CAGAGCCAGGGGCCCCTGCAGGG - Intronic
1091802648 12:3334247-3334269 CTGTGCCAAGGTCCCGTAGGTGG - Intergenic
1091877404 12:3947280-3947302 ATGTACAAAGGGCCCGTGGAAGG - Intergenic
1094604549 12:31939249-31939271 ATGTGCCAGGGGGCAGTGGCTGG + Intergenic
1096215473 12:49795706-49795728 CTGCTCCAGTGGCCTGTGGATGG + Exonic
1103704706 12:122865178-122865200 CTGTGCCAGGGGCCCTGGACAGG + Intergenic
1107123456 13:36819577-36819599 CTGTGCGAAGGGGCCGGGGATGG + Exonic
1111664488 13:91249847-91249869 CTGTGCCAGGGGCTGGTGCTGGG - Intergenic
1112300123 13:98222597-98222619 CTGTGACAGGTGCCAGTGGAGGG + Intronic
1113071577 13:106426607-106426629 CTGTGCCAGGGGCTTGTTGAGGG - Intergenic
1113603070 13:111585021-111585043 CTGTGCCTCAGGCCCGTGGCTGG + Intergenic
1113755751 13:112809495-112809517 CTGTGCCACGGGCCCGCTGCAGG - Intronic
1113787020 13:113007326-113007348 CTGAGCCAGGGGCACCAGGAGGG - Intronic
1114980531 14:28158259-28158281 GGGTGCCATGGGCACGTGGATGG - Intergenic
1117333663 14:54738275-54738297 CTGTGCCAGGCTTCCGTGAAGGG - Intronic
1121023007 14:90593255-90593277 CTGTGCCAGGGCACCGAGGCAGG + Intronic
1122011625 14:98753891-98753913 CTGTCCCAGAGGACCCTGGAGGG - Intergenic
1122550008 14:102544623-102544645 CTGCGCCAGGGGCCGGGGGCCGG + Intergenic
1122576777 14:102747857-102747879 CTGTGCCTGGGGGGCCTGGATGG + Intergenic
1122627234 14:103090846-103090868 GTGTGCCAGGGGCCCATGAGAGG + Intergenic
1122770631 14:104096101-104096123 GTGTGCCAGGGCCCCCAGGATGG - Intronic
1122822728 14:104355289-104355311 CTGTGCAAGGTGACAGTGGACGG - Intergenic
1122848205 14:104512350-104512372 CTGTGCCCTGTGCCCCTGGATGG - Intronic
1124017590 15:25890581-25890603 CAGTGCCAGGGGCGAGTGGGTGG + Intergenic
1124652632 15:31484710-31484732 CTGTGCCAGGGGCGCCTGTGTGG + Exonic
1128072704 15:64807522-64807544 CTGTGCCAGGTCCCAGTAGAGGG + Intergenic
1128385735 15:67147001-67147023 CTGTGGGAGGGGCCCCTGGCAGG - Intronic
1128385999 15:67148927-67148949 CTGTGCCAGGAGCTCCTTGAGGG - Intronic
1128498975 15:68214124-68214146 CAGGGCCTGGGGCCCGGGGAAGG - Intronic
1130666008 15:85870628-85870650 GGGTGCCAGGAGCCCATGGAAGG + Intergenic
1131257407 15:90871622-90871644 CGGGGCCCGGGGCCCGGGGAAGG + Intronic
1131832235 15:96361282-96361304 CTGTGACAGTGGCACCTGGAAGG - Intergenic
1133192939 16:4147652-4147674 CTGTGGAAGGGGCCCATGAATGG - Intergenic
1134137133 16:11684794-11684816 CTGTGCCAGCTGCCCGGGGCAGG - Intronic
1134449803 16:14356200-14356222 CTGTGCCAGAGCCCCGTGCATGG + Intergenic
1138532209 16:57640644-57640666 CTGTGCCTGGGCCCCGTCCAGGG - Intronic
1139429016 16:66901154-66901176 CTGTGCCAGGGCCTCGAGGGGGG + Intergenic
1139700699 16:68706404-68706426 CTGTGCTGGGGGACAGTGGAGGG - Intronic
1141429125 16:83961836-83961858 CTGTGCCAGAGGCACGGGGCAGG - Intronic
1141995647 16:87635033-87635055 CTGTCCCAGAGTCCAGTGGAGGG - Intronic
1142175492 16:88643256-88643278 CTCTGCCTGGGGCCGGTGGGCGG - Intergenic
1142377055 16:89711739-89711761 CGGGGCCAGAGGCCCGTGGGAGG - Intronic
1142638324 17:1271102-1271124 CCGTGCCAGGGGCGCGTGCGGGG - Exonic
1142993720 17:3748750-3748772 CAGTGCCAAGGGCCTGTGGCAGG + Intronic
1143904373 17:10197870-10197892 CAGTGGCAGGGGCCGGTGAAGGG - Intronic
1144202100 17:12950780-12950802 CTTAGCCAGGGGCCTGTGAAAGG + Intronic
1144821283 17:18076494-18076516 CTGGGCAAGGGGCCCTTGCATGG - Intergenic
1147537318 17:41329002-41329024 CAGTGCCAGGGTCCCCTGCATGG - Intergenic
1148440960 17:47711384-47711406 CAGTGCCAGGGGCACCAGGAGGG - Exonic
1150329755 17:64285344-64285366 CTGTGCCAGGAGGTCGTAGAGGG + Intergenic
1151190054 17:72391791-72391813 TTGGTCCAGGGGCCAGTGGATGG - Intergenic
1151334435 17:73431754-73431776 CAGAGCCAGGGGCCTGTGGGGGG - Intronic
1151724713 17:75877403-75877425 CTGTTCCGGGGGCCAGTGGTGGG - Intronic
1152018767 17:77769516-77769538 CTATACCATGGGCCCGGGGAGGG + Intergenic
1152135652 17:78501707-78501729 CTGTCCCAGGGGCCAGGGGAAGG - Intronic
1152161993 17:78674688-78674710 CTGGTCCAGGGTCCTGTGGAGGG + Exonic
1152468389 17:80477810-80477832 CTGTACCACGGGAGCGTGGACGG - Intronic
1152811067 17:82383068-82383090 CGGTGCCAGGGGCCGGTCGGGGG + Intergenic
1152862791 17:82705519-82705541 CTGGTCCAGGGGCCCTTGGATGG + Intergenic
1152879108 17:82805315-82805337 CTGTGCCATGGGCCCCTTCATGG + Intronic
1153959631 18:10130044-10130066 CTGTACCAGAGGCCAGCGGAGGG - Intergenic
1157392420 18:47313936-47313958 CTGTGCCAGGGGCTGGATGATGG - Intergenic
1161160033 19:2756769-2756791 GGGTTCCAGGGGCCCGTGGCTGG - Intronic
1161217711 19:3102766-3102788 CTGACGCAGGGGCCCGAGGAGGG - Intronic
1161222049 19:3122356-3122378 TTTGGCCAGGGGCGCGTGGAAGG + Exonic
1161476679 19:4489910-4489932 GGGTGCCAGGGGCCAGAGGAGGG - Intronic
1162414123 19:10524191-10524213 GGGTGCCAGGGGCACCTGGAAGG + Intergenic
1163100387 19:15092309-15092331 GTTTGCAGGGGGCCCGTGGAGGG + Intergenic
1163446118 19:17347472-17347494 GTGTGCCAGGGCCCCAGGGAAGG - Intergenic
1164496895 19:28773854-28773876 CTGTGCTGGGGGCCAGGGGAAGG + Intergenic
1164609709 19:29623847-29623869 CTGTGGCAGAGGCCCCTGGCAGG + Intergenic
1165140112 19:33694419-33694441 CTGTGCCAGGGGTCCCTGAGGGG - Intronic
1165702315 19:37948013-37948035 CCTAGCCAGGGCCCCGTGGAGGG - Intronic
1166378949 19:42344521-42344543 GGGTGCCAGGTCCCCGTGGAGGG - Exonic
1166684014 19:44784364-44784386 CTGTCCCAGGTGCTCCTGGAGGG + Exonic
1166714993 19:44961291-44961313 CTGGACCAGGGGCCCTTGGAGGG + Intronic
1166750693 19:45162782-45162804 CTCTGCCAGGAGCACGGGGAGGG + Intronic
1167006379 19:46778770-46778792 CAGTACCAGGAGCCCATGGATGG + Exonic
1167383908 19:49153194-49153216 CTGTCCCAGGGGCCCTGGGGTGG - Intronic
1168061088 19:53892618-53892640 CTGCTCAAGGCGCCCGTGGATGG + Exonic
1168686111 19:58350570-58350592 CGGTGCCTGGCGCCCCTGGAGGG - Exonic
1168707657 19:58479128-58479150 CTGTGCCATGGGGCTGTGGAGGG - Intronic
924987420 2:284951-284973 GTGTGCCAGGTGCACATGGAAGG + Intronic
925874264 2:8298584-8298606 CTGGGGCAGGGGCCTGTGGATGG - Intergenic
926135258 2:10331614-10331636 CTGTGCCCGGGGTCCAGGGATGG + Intronic
926139543 2:10360032-10360054 CTGCGCCAGGAGCCCGTGCTGGG - Intronic
928406382 2:31018186-31018208 CTGGGCCAGGGGTACCTGGAGGG - Intronic
928477848 2:31649333-31649355 ATGTGTCAGGAGCCAGTGGATGG - Intergenic
929438547 2:41947793-41947815 CTGAGCCAGGAGCCCTTAGAAGG + Intronic
929542625 2:42834113-42834135 CTGTGCCCAGTGCCTGTGGATGG + Intergenic
929552082 2:42900773-42900795 CTGTTGCTGGGGCCTGTGGATGG + Intergenic
933610494 2:84429494-84429516 CTGTGCCAGGGGACTGGGCAGGG + Intronic
933912656 2:86956949-86956971 CTGTGTCAGTGGCAAGTGGATGG + Intronic
934010338 2:87812941-87812963 CTGTGTCAGTGGCAAGTGGATGG - Intronic
934567049 2:95346849-95346871 CTGGGCCGGGGCCCCGTGGAGGG - Intronic
935739937 2:106138540-106138562 CTGGGCCAGAGCACCGTGGAGGG - Intronic
935773905 2:106453661-106453683 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935906158 2:107842252-107842274 CTGTGTCAGTGGCAAGTGGATGG + Intronic
935992627 2:108734775-108734797 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936127946 2:109807417-109807439 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936216751 2:110564068-110564090 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936425890 2:112418649-112418671 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936431759 2:112470867-112470889 CTTTGCCAGAGGCCTCTGGATGG + Intergenic
937212728 2:120286747-120286769 CTGTGACAGGGGACAATGGAGGG - Intronic
938110740 2:128563259-128563281 CTACACCAGGGGCCCGGGGAGGG + Intergenic
938145974 2:128835227-128835249 TTGTCCCAAGGGCCTGTGGAGGG - Intergenic
941723445 2:168836647-168836669 CTGTGCCAGGAGTGTGTGGATGG - Intronic
944529092 2:200649957-200649979 CTGTGCCAGCTGCCCGCTGAAGG - Intronic
945679774 2:212899773-212899795 ATGTGCAAGGGTCCCGAGGAAGG + Intergenic
947744622 2:232501224-232501246 ATGTGCCAGGGGCAGGGGGAAGG - Intergenic
947753178 2:232543299-232543321 CTGGGCCAGGAGCACGTTGATGG - Exonic
947794445 2:232885226-232885248 CGGGGCCAGGGGCCTGTGCATGG + Intronic
947864886 2:233389755-233389777 CTGTGCCGGGGGACCCTGTAGGG + Intronic
948568616 2:238902131-238902153 TTCTGCCAGGGGACCCTGGAGGG - Intronic
948603668 2:239121480-239121502 CTGTTCCAAGGGCTCTTGGATGG + Intronic
948650932 2:239443282-239443304 CAATGCCAGGGTCCTGTGGAAGG - Intergenic
948781587 2:240324855-240324877 CTGTCCCATGTGCCGGTGGAGGG - Intergenic
949032328 2:241802951-241802973 CTGTGCCAGGGGCCCGTGGAGGG + Intronic
1169213248 20:3779054-3779076 CTGGCCTGGGGGCCCGTGGAAGG - Intronic
1171445994 20:25205397-25205419 CTGTGCCAGGGGCCTGAGGCAGG + Intronic
1171793130 20:29546862-29546884 CTCTGCCTGGGTCCCGTGGCCGG + Intergenic
1171880114 20:30612365-30612387 CTGTGCCAGAGGCTCATGGTTGG - Intergenic
1172271914 20:33659733-33659755 CTGTGTGTGGGGCCCGTGCAGGG + Intronic
1173452236 20:43175231-43175253 GAGTGCATGGGGCCCGTGGAGGG - Intronic
1173825272 20:46044025-46044047 CTGTGTGAGGGGCCTGTGGGAGG + Intronic
1174045212 20:47728331-47728353 CTGCACCAGGGGCCCAGGGACGG + Intronic
1174172452 20:48625895-48625917 CTCTGCCAGCCGCCGGTGGATGG - Exonic
1174281952 20:49445838-49445860 CTGGGCCAGGGAGCCCTGGAGGG + Intronic
1175184687 20:57172177-57172199 CTGTGCCAGTATCCCCTGGAAGG - Intronic
1176070272 20:63222599-63222621 CTGGGCCAGGTGCCTGGGGAGGG + Intergenic
1176139656 20:63539394-63539416 CTTTGGCCGGGGCCTGTGGACGG + Intergenic
1178951490 21:36989791-36989813 CGCGGCCAGGGGCCCGTGGGAGG + Intronic
1179173070 21:38988053-38988075 CTGTGGCAGGGGCCTGTGCAGGG - Intergenic
1179890209 21:44331437-44331459 TTGGGCCTGGGGGCCGTGGAGGG - Intronic
1180098244 21:45571477-45571499 CTGTGCTGGCTGCCCGTGGACGG - Intergenic
1180956551 22:19743835-19743857 CTGGGCCAGGGGGCTGGGGATGG - Intergenic
1181235411 22:21445415-21445437 CGGTATCAGGGGCTCGTGGATGG + Exonic
1182302129 22:29342860-29342882 ATGTGGCAGGGGCCGGTGGAGGG - Intronic
1183347419 22:37315478-37315500 CTGTGCCAGTGTTCCGGGGATGG - Intergenic
1184176636 22:42792827-42792849 CTGTGCTATGGGCCCTTAGAGGG - Intergenic
1184849874 22:47113953-47113975 CCCTGCCAGTGGCCCCTGGATGG - Intronic
1185066528 22:48635078-48635100 CTGGGCCTGGGGCCTGGGGACGG + Intronic
1185169826 22:49286224-49286246 CTGTTCCAGGAGCCCCTGGAGGG + Intergenic
950968809 3:17166267-17166289 CTGTGGCAGGGGTCCATAGAGGG - Intronic
952889625 3:38031325-38031347 CTGTGCCAGGGGCCAGAGGAGGG - Intergenic
952953964 3:38545201-38545223 CTGTGACAGGGCCACCTGGAGGG + Intergenic
954325296 3:49860170-49860192 CTTTGCCAGGGCCAAGTGGAAGG - Exonic
954623287 3:52007788-52007810 CTGTGGCAGGTGTCCGTGGGTGG - Intergenic
955331324 3:58049920-58049942 CTGTGGGAGGACCCCGTGGATGG + Intronic
955692541 3:61604768-61604790 CTGTGCCACGGCCACATGGAGGG + Intronic
956726362 3:72159725-72159747 CTGTGCTAGGGGCTCTAGGATGG - Intergenic
961609209 3:128123428-128123450 ATGGGCCAGGGGCTCGGGGAGGG - Intronic
963121145 3:141778149-141778171 CTGTGGGTGGGACCCGTGGAGGG - Exonic
963122698 3:141789538-141789560 CTGTCCCAGGAGCCAGAGGAAGG + Intronic
963130520 3:141853772-141853794 CTGTGCCAGGGGCCTGATGCTGG + Intergenic
967850439 3:194078581-194078603 ATGTTCCAGAGGCCCTTGGACGG - Intergenic
968636579 4:1684130-1684152 CTTTGCCCGCGGCACGTGGAGGG - Intronic
968641559 4:1717484-1717506 CTGGGCCAGGGCCGGGTGGATGG - Intronic
969455019 4:7295618-7295640 CTGTGCCTGGGAACCCTGGAGGG + Intronic
971033961 4:22672754-22672776 CTGGACCATGGGCCCCTGGAAGG - Intergenic
973317854 4:48780128-48780150 CGGAGCCAGGGGCCCGAGGGCGG - Exonic
975021909 4:69501241-69501263 CTGGGCCGGGGGCGGGTGGAAGG + Intronic
981576725 4:146213414-146213436 CTGTGTCAGGACCCAGTGGAGGG + Intergenic
982436287 4:155385193-155385215 CAGTGCCAGGGTCCCCTGCATGG - Intergenic
985780335 5:1867552-1867574 CTGTGTCGGGAGCCTGTGGAAGG - Intergenic
986544709 5:8882951-8882973 GTATGCCAGGGGCTCATGGAAGG + Intergenic
995598741 5:113774269-113774291 ATGTGCCAGGGGGCAGTGGCTGG + Intergenic
999082380 5:148856569-148856591 CTGGGCCAGAGGCCAGTGGCTGG + Intergenic
999498038 5:152119442-152119464 CTGTGTCAGGAGCAGGTGGAGGG + Intergenic
1001645623 5:173279782-173279804 CTGTGCCAGTGGGCTGTGTAGGG + Intergenic
1002493893 5:179599071-179599093 GTGTGCAAGGGGCCTGGGGAGGG + Intronic
1003298950 6:4859450-4859472 CTCTGCCAGGGGACCGTGGCAGG - Intronic
1004845666 6:19639058-19639080 CTGTGCCAGGAGCCGCTGGGTGG - Intergenic
1004998017 6:21213029-21213051 GGGAGCCAGGGGCCTGTGGAAGG - Intronic
1005883172 6:30075277-30075299 CTGAGCCTGGGGCCCGTGCGGGG - Exonic
1006166773 6:32069978-32070000 CTGTGCTAGGGGCTTGTGCAGGG + Intronic
1009385824 6:63083451-63083473 CTGTCCCAGGATTCCGTGGATGG + Intergenic
1016851602 6:148624823-148624845 GGGTGCCAGGGGCAGGTGGAGGG + Intergenic
1018373240 6:163187347-163187369 CTGTGCAAGTGGCCTGTGAAAGG + Intronic
1018899700 6:168044866-168044888 CTGTGCCAGGTGCCTCTGGCTGG - Exonic
1019442816 7:1056012-1056034 CTGCGCCAGGGTCCAGAGGACGG - Intronic
1020091770 7:5345864-5345886 CTGGGCCAGGGGGCGGTGGGGGG - Intronic
1021418399 7:20416847-20416869 TTGTGGGAGGGACCCGTGGAAGG + Intergenic
1022725693 7:32979492-32979514 CTTTGCCAAAGGCCAGTGGAAGG + Intronic
1024486446 7:49925680-49925702 CTGAGGCAGAGGCCTGTGGATGG - Intronic
1025255142 7:57379577-57379599 CTGTGCAAAGGGCCTGTGGCAGG + Intergenic
1025992045 7:66503977-66503999 TTGGGCCAGGGGCGCATGGAAGG - Intergenic
1026337735 7:69409268-69409290 GTTTGCCAGGGGCTCGGGGAGGG + Intergenic
1026400569 7:70008495-70008517 CTGTGTCAGTGGCCTGTGTATGG + Intronic
1026864075 7:73811789-73811811 CTGTGCTAGTGGCAGGTGGAGGG - Intronic
1026905997 7:74063159-74063181 CAGTGCCTGGGGTCCTTGGAGGG + Exonic
1029457081 7:100676745-100676767 CTTTGCCAGGTGCCCACGGAGGG - Exonic
1030085127 7:105809426-105809448 GAGTGCCAGGGGCCGGAGGAAGG - Intronic
1034943063 7:155244491-155244513 CTGTTCCAGGGGCCCGTAGTGGG - Intergenic
1035470339 7:159105275-159105297 CTGTGCCAGGAGTGCATGGAGGG - Intronic
1039304892 8:36250786-36250808 CTGTGCCAGGAGGGCATGGAAGG - Intergenic
1039983511 8:42428712-42428734 CTGTCCCAGCGGCCTGGGGAAGG + Intronic
1043592577 8:81847572-81847594 ATGTGCCAGGGGGCAGTGGCTGG - Intergenic
1046712033 8:117520920-117520942 CTGAGCCTGGGGCCCGGCGAAGG - Exonic
1048989867 8:139754976-139754998 CACTGCCAGGGGCCCTGGGAAGG + Intronic
1049215797 8:141407382-141407404 CTGAGCCAGGGGGCTGTGCAAGG - Intronic
1049813080 8:144584996-144585018 CTCTGCAAGGAGCCTGTGGATGG + Intronic
1050472314 9:6007100-6007122 CTGGGCCAGGGGCCTGGGGGCGG - Intronic
1051070352 9:13158648-13158670 CTGTGCCAGGTTCCTCTGGATGG - Intronic
1056954603 9:91072191-91072213 CTCGGCCAGGGGCATGTGGAAGG - Intergenic
1057396924 9:94688894-94688916 CTGTGCCAGGGTCCTGAGGCAGG + Intergenic
1057804595 9:98211269-98211291 CTGTGCCAGGCACCCTGGGAAGG - Intronic
1059275216 9:113090496-113090518 CTGGGCCTGGGGCCGGTGTAGGG + Intergenic
1059486307 9:114629694-114629716 CTGTGCCAGGGATCGGGGGATGG - Intronic
1061448164 9:130653593-130653615 GTGTGCCAGGGGCTGGTGGTGGG - Intergenic
1061922270 9:133788712-133788734 CTGTGCCAGGAGCCCTTCAAGGG + Intronic
1062392347 9:136338880-136338902 TTGTGCCAGGGGTCAGTGGCCGG - Intronic
1203761200 EBV:13568-13590 CTGGGCCCGGGAGCCGTGGACGG - Intergenic
1203762129 EBV:16640-16662 CTGGGCCCGGGAGCCGTGGACGG - Intergenic
1203763058 EBV:19712-19734 CTGGGCCCGGGAGCCGTGGACGG - Intergenic
1203763987 EBV:22784-22806 CTGGGCCCGGGAGCCGTGGACGG - Intergenic
1203764916 EBV:25856-25878 CTGGGCCCGGGAGCCGTGGACGG - Intergenic
1203765845 EBV:28928-28950 CTGGGCCCGGGAGCCGTGGACGG - Intergenic
1203766774 EBV:32000-32022 CTGGGCCCGGGAGCCGTGGACGG - Intergenic
1203767703 EBV:35072-35094 CTGGGCCCGGGAGCCGTGGACGG - Intergenic
1189976346 X:46464234-46464256 CTTTGCCATGGGCCAGTGAAGGG - Intronic
1190232142 X:48590473-48590495 GTGAGCCAGGGGCCAGTGGTGGG + Intronic
1192209976 X:69121765-69121787 CTGTGCCTGGGCCCTGTGGGCGG - Intergenic
1195258415 X:103110493-103110515 CTGTGCCAGGGTACCAGGGAGGG + Intergenic
1200231756 X:154447274-154447296 TTGTGTCACGGGCCCCTGGAGGG + Intronic
1201921168 Y:19234463-19234485 CTTTGCCAGGATCCCTTGGAAGG + Intergenic