ID: 949034155

View in Genome Browser
Species Human (GRCh38)
Location 2:241808911-241808933
Sequence CCTGATGCTCAGAGGGTAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 158}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949034155_949034160 3 Left 949034155 2:241808911-241808933 CCAGTTACCCTCTGAGCATCAGG 0: 1
1: 0
2: 3
3: 14
4: 158
Right 949034160 2:241808937-241808959 AACCCGCCGGCCCCAAAACCAGG 0: 1
1: 0
2: 0
3: 11
4: 51
949034155_949034164 12 Left 949034155 2:241808911-241808933 CCAGTTACCCTCTGAGCATCAGG 0: 1
1: 0
2: 3
3: 14
4: 158
Right 949034164 2:241808946-241808968 GCCCCAAAACCAGGCCCCCTTGG 0: 1
1: 0
2: 2
3: 11
4: 170
949034155_949034169 21 Left 949034155 2:241808911-241808933 CCAGTTACCCTCTGAGCATCAGG 0: 1
1: 0
2: 3
3: 14
4: 158
Right 949034169 2:241808955-241808977 CCAGGCCCCCTTGGCACATGTGG 0: 1
1: 0
2: 1
3: 20
4: 192
949034155_949034170 22 Left 949034155 2:241808911-241808933 CCAGTTACCCTCTGAGCATCAGG 0: 1
1: 0
2: 3
3: 14
4: 158
Right 949034170 2:241808956-241808978 CAGGCCCCCTTGGCACATGTGGG 0: 1
1: 0
2: 1
3: 9
4: 132
949034155_949034159 -10 Left 949034155 2:241808911-241808933 CCAGTTACCCTCTGAGCATCAGG 0: 1
1: 0
2: 3
3: 14
4: 158
Right 949034159 2:241808924-241808946 GAGCATCAGGCAGAACCCGCCGG 0: 1
1: 0
2: 1
3: 6
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949034155 Original CRISPR CCTGATGCTCAGAGGGTAAC TGG (reversed) Intronic
900482838 1:2907673-2907695 CCAGATGCTCAGAGGGGAGATGG + Intergenic
900534550 1:3170525-3170547 CCAGATGCTCCTAGGGAAACTGG - Intronic
900613016 1:3552345-3552367 CCTGATGCCAGGAGGGCAACAGG + Intronic
901651782 1:10747172-10747194 CCAGAGGCTCAGAGGGTATGGGG - Intronic
903686860 1:25138246-25138268 ACTGAGGCTCAGAGGGAAAGTGG + Intergenic
905793100 1:40800670-40800692 GCTGATGCTCAGACAGTATCTGG - Intronic
906065197 1:42975500-42975522 GCTGAAGCTCAGTGGGTAACTGG + Intergenic
907114650 1:51958285-51958307 ACTGAGGCCCAGAGGGTAAAGGG - Intronic
913331672 1:117672802-117672824 CCTGCTTCTCAGAGGGTACAAGG - Intergenic
916551008 1:165849950-165849972 CCTGTTACTCAGAGAGTGACTGG + Intronic
917538399 1:175891065-175891087 CATGATGCTGAGAGGGAAAATGG - Intergenic
917736814 1:177929002-177929024 ATTGATGTTCAGAGGGTCACTGG - Intronic
918545361 1:185677118-185677140 CCTCATGCTCAGTGGCTAACTGG + Intergenic
919049024 1:192489451-192489473 CATGACACTCAGAGGGTAAGGGG - Intergenic
924069453 1:240261273-240261295 CGTGATACTGAGAGGGTAACTGG - Intronic
1064960870 10:20963888-20963910 ACTGGTGCTGAGAGGGTAAGAGG - Intronic
1065933107 10:30496669-30496691 CCAGATGCCTAGAGGGTGACTGG + Intergenic
1073457533 10:103646697-103646719 ACTGATGCACAGAGGTGAACAGG - Intronic
1076778691 10:132711886-132711908 CCAGAGGCTCAGAGGGTACCAGG - Intronic
1077169125 11:1158595-1158617 CCTGAGGCTAAGAGGGTGATGGG + Intronic
1077187283 11:1240969-1240991 CCTGAGGCAGAGAGGGTACCAGG + Exonic
1078909406 11:15717108-15717130 CCTGATGCTCAGCTGGTCTCTGG + Intergenic
1081875103 11:46403239-46403261 ACTGAGGCTCAGAGAGTCACAGG + Intronic
1083269238 11:61562966-61562988 CCAGCTGCCCAGAGGGGAACGGG + Intronic
1083489795 11:63007868-63007890 CCTGAGGCTCAGAGGGTAAGTGG + Intronic
1089695837 11:120215914-120215936 CCTGATGCTGGGAGGGGAAAGGG - Intronic
1091070047 11:132554464-132554486 CCTGATGCTCAGCAGCTAGCTGG - Intronic
1091307043 11:134542939-134542961 CCTGTGGGTCAGAGGGTAAGGGG + Intergenic
1091972109 12:4796376-4796398 CCTGATTCTCAGAGGGGACGCGG - Intronic
1092137298 12:6158909-6158931 CCTGATACTCGGAGAGTGACGGG - Intergenic
1097287556 12:57889496-57889518 CCTGAGGCCCAGAGGGAAGCAGG + Intergenic
1098702401 12:73645619-73645641 CCTGATGATCAGAGGGTGTGTGG + Intergenic
1099982646 12:89624750-89624772 CCTGATGCTTAAAGAGAAACTGG + Intronic
1100349450 12:93765211-93765233 CCTGCAGCTCAGAGAGTAAAGGG + Intronic
1101738439 12:107481398-107481420 CCTGGTGCTCAGAGGGAACCAGG - Intronic
1102247009 12:111362313-111362335 CCTGCAGCTCAGAGGGTCACTGG - Exonic
1106834132 13:33615362-33615384 GCTGATACTCAGAGGAAAACTGG + Intergenic
1108429826 13:50342431-50342453 CCTGATGCTCACAGTTTGACAGG + Intronic
1112470746 13:99686353-99686375 CCAGATGCTCAGAGGGGAGGTGG - Intronic
1113794494 13:113049237-113049259 GCTGAGGCTTAGAGGGTCACTGG + Intronic
1118105406 14:62653504-62653526 AATGAAGCTCAGAGGGTAAGTGG + Intergenic
1119556862 14:75560010-75560032 CCTAATTCTCAGGGGCTAACAGG + Intergenic
1121196774 14:92080206-92080228 CCTGATGCTAACAGGCTTACAGG + Intronic
1122341587 14:101031886-101031908 CCTGATGCGCACCGGGCAACCGG - Intergenic
1122523119 14:102360770-102360792 TCTGATGCACAGAGGGCAAGTGG - Intronic
1123167921 14:106344190-106344212 CCAGAGGCTCCGAGGGGAACTGG + Intergenic
1123170559 14:106368903-106368925 CCAGAGGCTCCGAGGGGAACTGG + Intergenic
1124356923 15:29002596-29002618 CGTGAGGCTCAGGAGGTAACTGG - Intronic
1125129854 15:36271326-36271348 CCTGATCCTCAGCCGGTAAATGG - Intergenic
1128729957 15:70014386-70014408 CCTGAAGCTCGGAGGGGAAATGG + Intergenic
1131168868 15:90162303-90162325 CCTGAAGCTCAGAGTGTTTCAGG - Intronic
1132925577 16:2427659-2427681 CCTGAAGCCCAGTGGGAAACGGG + Intergenic
1132947032 16:2537667-2537689 ACTGAGGCTCAGAGGGGACCAGG - Intergenic
1132968656 16:2673725-2673747 ACTGAGGCTCAGAGGGGACCTGG + Intergenic
1133317493 16:4893498-4893520 CCTGAGGCTCTGGGGGTACCGGG - Intronic
1133589790 16:7231022-7231044 CCTGATGCTCAGGGGGCTAGAGG - Intronic
1138217706 16:55219190-55219212 CCTAATGCTCAGCAGGTAAGGGG - Intergenic
1139092542 16:63666074-63666096 CCTCATGCTCAGATGGTGCCTGG + Intergenic
1141232226 16:82179407-82179429 CCTGATGCCCAGAGGCAGACAGG - Intergenic
1141291581 16:82722773-82722795 CAAGATGCTCACAGGGTACCAGG + Intronic
1142146312 16:88494343-88494365 CCTGGTGCTGAGAGGGTAACGGG - Intronic
1143014019 17:3882287-3882309 CTTGCTGCTCAGAGGGAAGCAGG + Exonic
1146516783 17:33495690-33495712 CCTGAAGCTAACAGGGTAATGGG + Intronic
1148687379 17:49508424-49508446 CCTGAAGCTGAAAGGGGAACAGG - Intronic
1152499400 17:80697931-80697953 CCTGGTGCCCAGTGGGTCACAGG - Intronic
1203172994 17_GL000205v2_random:168692-168714 TCTGATGCTTAGAGGCTGACTGG - Intergenic
1155536861 18:26827763-26827785 CTTGAGGCTCAGAGGGGAATAGG + Intergenic
1157057462 18:44247659-44247681 CCTGAAGCTCAGAGGGGATAAGG - Intergenic
1159367164 18:67483407-67483429 CCTGAAGCTCAGTGGGCAACAGG + Intergenic
1160789816 19:918229-918251 ACTGAGGCTCAGAGGGTCAGGGG + Intronic
1161426144 19:4204317-4204339 CCTGTGGTTCAAAGGGTAACCGG - Intronic
1162103586 19:8355718-8355740 GCTGGTGCTCAGAAGGGAACGGG - Intronic
1167673521 19:50870375-50870397 CCTGATTCTCAAAGGGTCAGAGG + Intronic
1168187605 19:54709822-54709844 CAGGATGCTCAGGGGGTCACTGG - Intergenic
1168244350 19:55103681-55103703 CCTGAGTCTCAGAGGGGAGCAGG - Intronic
925335611 2:3097188-3097210 GCTGGTGCTCAGAGAGTAAGAGG - Intergenic
926238192 2:11065699-11065721 GCAGGTGCTCAGAGGGTAACTGG + Intergenic
926259125 2:11240599-11240621 CCTGGGGCTCAGAGGGTAATAGG + Intronic
929224978 2:39503311-39503333 ACTGAGGATCAGAGAGTAACTGG + Intergenic
929432691 2:41901801-41901823 CTTGTTGCTCAGAGAGTGACAGG + Intergenic
929593650 2:43162419-43162441 CCTGGGGCTCAGAGGGGAGCTGG - Intergenic
930606134 2:53495374-53495396 CCTGATGCTCAGAGTGAGAGAGG - Intergenic
932403722 2:71500029-71500051 CCTGATGAGCAGAGGGCACCTGG + Intronic
933895340 2:86806276-86806298 CCTCATGCTCTGAGGGTAAGTGG - Intronic
936149084 2:110001815-110001837 TCTGATGATCAGATGGAAACTGG - Intergenic
936195597 2:110369555-110369577 TCTGATGATCAGATGGAAACTGG + Intergenic
937320193 2:120956440-120956462 GCTCATGGTCAGAGGGTCACAGG - Intronic
939894684 2:147776982-147777004 CCTGGAGCTCAGAGTGTGACTGG + Intergenic
941874494 2:170419200-170419222 CCTGATCCTCGGAGGCTGACAGG - Intronic
945179507 2:207077421-207077443 CCTGATGATAACAGGGTAAAAGG - Exonic
945250282 2:207760146-207760168 CATGAGGCTCACAGGCTAACAGG + Intronic
946015894 2:216603399-216603421 CTTGAAGGTCAGAGGGGAACTGG + Intergenic
949034155 2:241808911-241808933 CCTGATGCTCAGAGGGTAACTGG - Intronic
1168831335 20:846783-846805 ACTGAGGCCCAGAGGGAAACTGG - Intronic
1169816023 20:9657265-9657287 CCTCGTGCTGAGAGGGAAACAGG - Intronic
1174299357 20:49570242-49570264 CCTGATGCTCATGGTGTGACAGG - Intergenic
1175762545 20:61571394-61571416 CTTGATGCCCAGAGGGTACCTGG + Intronic
1176328976 21:5530335-5530357 TCTGATGCTTAGAGGCTGACTGG - Intergenic
1176398781 21:6290616-6290638 TCTGATGCTTAGAGGCTGACTGG + Intergenic
1176438376 21:6698488-6698510 TCTGATGCTTAGAGGCTGACTGG - Intergenic
1176462638 21:7025558-7025580 TCTGATGCTTAGAGGCTGACTGG - Intergenic
1176486199 21:7407336-7407358 TCTGATGCTTAGAGGCTGACTGG - Intergenic
1179128254 21:38611484-38611506 CCTCAAGCTCAGAAGGCAACTGG + Intronic
1180583669 22:16866420-16866442 TCTGATGATCAGATGGCAACTGG + Intergenic
1180912361 22:19460191-19460213 CCGGATGCTCAGTGGATAAGTGG - Intronic
1181864286 22:25843084-25843106 ACTGATGCTCAGAGACTTACGGG + Intronic
1183167219 22:36156778-36156800 CCGGATGCTCAGAGTTTAACGGG - Intronic
1183379046 22:37481662-37481684 CCTGATGCTCAATGGGTGAGAGG - Intronic
1183429025 22:37754724-37754746 CCTGAGGCTCAGAGAGGAAATGG + Intronic
950312193 3:11968442-11968464 CCTGTTCCTCAGAGGGCCACTGG + Intergenic
954426538 3:50446364-50446386 ACTGAGGCACAGAGAGTAACTGG + Intronic
959130944 3:102355363-102355385 CCTGGTTATCAGAGGGAAACAGG + Intronic
961967229 3:130918399-130918421 CATGCTGCTGAGAAGGTAACTGG - Intronic
964130311 3:153279590-153279612 CCTGAGGCTCACAGGGTTTCTGG - Intergenic
964249029 3:154688922-154688944 CATGATGCTCAGAGGCTAGTGGG + Intergenic
964655327 3:159060491-159060513 GGTGATGCACAGAGAGTAACCGG - Intronic
965808387 3:172566398-172566420 CCAGAGGCTCAGAGGGTAGTTGG - Intergenic
967234914 3:187374695-187374717 CCTGATCATCAGAGGGAAATAGG - Intergenic
967319908 3:188184917-188184939 CCAGATGCTGAGATGGTGACAGG + Intronic
967394933 3:188997535-188997557 CCAGAGGCTGAGAGGGTTACTGG + Intronic
968135088 3:196215219-196215241 CCTGACCCCCAGAGGGTCACTGG - Intronic
968627622 4:1634301-1634323 GATGGAGCTCAGAGGGTAACAGG - Intronic
969238580 4:5885310-5885332 GCTGAGGCTCAGAGGGGCACAGG + Intronic
985182375 4:187279443-187279465 CCAGATGCTCTGAGGGTGAACGG - Intergenic
985426231 4:189833375-189833397 TCGGATGCTCAGAGAGTAATTGG + Intergenic
985525281 5:398445-398467 ACAGATGGTCAGAGGCTAACTGG - Intronic
985767076 5:1785814-1785836 CCTTCTGCTCAGTGGGGAACTGG - Intergenic
997443480 5:133925274-133925296 GCTGGTGCTCAGAGGGTGATGGG - Intergenic
998310059 5:141121140-141121162 ACTGAAGCTCAGAGGGTAACAGG - Intronic
998616372 5:143744897-143744919 CCTGAGGCTCAGAGCCTAGCTGG - Intergenic
999239232 5:150117954-150117976 CCCGCTGCTCAGAGGGGAAAGGG + Intronic
1001812211 5:174637440-174637462 ACTGAAGCTCAGAGGGGAAATGG - Intergenic
1002107943 5:176889372-176889394 CCTGGTGCTCAGAGGTGACCTGG - Exonic
1003198767 6:3939609-3939631 CCTGCTGCTCTGAGGGCATCGGG + Intergenic
1003352017 6:5326692-5326714 CCTGCTGCTCTGAGGGCATCAGG - Intronic
1004715360 6:18211778-18211800 CCTGATTCTCAGAGGTTAGTGGG + Intronic
1005914391 6:30340113-30340135 CCTGATGTTCAAAGGGGAAAAGG - Intronic
1006837720 6:37009036-37009058 CCCGATCCTGAGAGGGTCACAGG - Exonic
1007821889 6:44566482-44566504 CCTGATGACCAGAGAGTAATGGG - Intergenic
1009718729 6:67435679-67435701 CCTGTTGCCCAGAAGGAAACAGG + Intergenic
1012866292 6:104622459-104622481 ACTGAGGCTCAGAGAGTAAAGGG + Intergenic
1014052730 6:116974754-116974776 CCTGAGGATAAGAGGATAACAGG - Intergenic
1018328668 6:162704078-162704100 ACTGAGGCTCAGCGGGTACCAGG - Intronic
1019618880 7:1979878-1979900 CCTGACGCTCAGAAGGGAGCAGG - Intronic
1021168897 7:17374015-17374037 CCTGAGGCTCAGAAGGTATGAGG + Intergenic
1022616891 7:31940807-31940829 CAGGATGCTCAGAGTGAAACTGG - Intronic
1023834832 7:44062025-44062047 CCGGATGCTCAGTGGGTGCCAGG - Intronic
1024273488 7:47659534-47659556 CCTGGTGCACAGAGGCTCACTGG + Exonic
1025251801 7:57356438-57356460 CCTGAATCTCAGGGGGCAACAGG - Intergenic
1026639545 7:72112084-72112106 CCTGATTCTCAGAGGGCACTAGG - Intronic
1026683504 7:72488635-72488657 CCTGAAGCTGGCAGGGTAACAGG - Intergenic
1028613741 7:92740538-92740560 CCTGATGCTAAGAAAGTAACTGG + Intronic
1030492796 7:110258977-110258999 CCTCATGCTCTGAGGGTACTTGG - Intergenic
1031773947 7:125883401-125883423 CATGATCTACAGAGGGTAACTGG - Intergenic
1032803044 7:135331750-135331772 CAAGATGTTCAGAGGCTAACAGG + Intergenic
1034876561 7:154729793-154729815 CCTGGGGCTCAGAAGGAAACTGG - Intronic
1037344383 8:17882493-17882515 CTTGATGCCCAGTGGGTAAGCGG + Intronic
1040087143 8:43355923-43355945 CCTGTTGCTCACAGTGTACCAGG - Intergenic
1040939645 8:52819107-52819129 CCTGCTGCTCAGGTGGTACCTGG + Intergenic
1043496793 8:80810148-80810170 CCTCATGCCCACAGGGTACCAGG + Intronic
1046087887 8:109461867-109461889 CCTGGTGCTAACATGGTAACTGG + Exonic
1048439288 8:134448041-134448063 CATGATGCCCAGAGGGTCTCTGG - Intergenic
1049696798 8:143987993-143988015 CCTGATGCTCAGAGGGCTCCAGG + Intronic
1052218468 9:25993825-25993847 CCAGAAGCTCAAAGAGTAACTGG + Intergenic
1052664223 9:31473696-31473718 CCTCATCATCAGAGGGAAACAGG + Intergenic
1052999669 9:34571029-34571051 ACTGATGCGCAAAGGGTAGCTGG - Intronic
1060525658 9:124319992-124320014 CCTGCTGCTAAGATGGCAACAGG + Intronic
1203433120 Un_GL000195v1:109987-110009 TCTGATGCTTAGAGGCTGACTGG + Intergenic
1187420952 X:19133248-19133270 GCAGATCCTCAGAGGGAAACTGG - Intergenic
1188252776 X:27919268-27919290 CCTGATGCCAACAGGGAAACAGG + Intergenic
1190845125 X:54183699-54183721 CCTTGTGCTCACAGGGTCACAGG + Intergenic
1192184303 X:68936336-68936358 CCTGCTGCTGAGAGGGGAAGAGG - Intergenic
1194887922 X:99340884-99340906 CCAGAGGCTCAGAGGGGAAGAGG - Intergenic
1195385488 X:104310037-104310059 CCTGATCCTCAGAGTGAACCTGG - Intergenic
1199683348 X:150242801-150242823 CCTCATGCTCATAGGGAACCAGG + Intergenic
1200138026 X:153884338-153884360 CCTGATGCTCAGCAGGGAGCTGG + Intronic